SEARCH

SEARCH BY CITATION

Keywords:

  • O antigen;
  • Wzx;
  • membrane topology

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. References

The O-antigen translocase, Wzx, is involved in translocation of bacterial polysaccharide repeat units across the cytoplasmic membrane, and is an unusually diverse, highly hydrophobic protein, with high numbers of predicted α-helical transmembrane segments (TMS). The Salmonella enterica serovar Typhimurium Group B O-antigen Wzx was an ideal candidate for topological study as the O-antigen gene cluster is one of only a few that have been well characterized. The topology profile prediction for this protein was determined using five programs, with different recognition parameters, which consistently predict that 12 TMS are present. A membrane topology model was constructed by analysis of lacZ and phoA gene fusions at randomly selected and targeted fusion sites within wzx. Enzyme activity of these, and full-length C-terminal fusion proteins, confirmed the 12-TMS topology for this Wzx, and also indicated that the C-terminus was located within the cytoplasm, which is consistent with the predicted topology.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. References

O antigens are a major component of the bacterial cell wall lipopolysaccharide, a known virulence factor for mammalian infection that also acts as a protective barrier during environmental stress (Zhang et al., 1997; Lerouge & Vanderleyden, 2002). O antigens exhibit extreme structural diversity with differences in sugar composition and arrangement in addition to sugar linkage differences within and between the repeat units that comprise this polysaccharide. Even within a species, this diversity is evident, with, for example, 186 O antigens identified in Escherichia coli (including Shigella strains) and 46 in Salmonella enterica (Ewing et al., 1958; Brenner, 1984; Ewing, 1986; Lior, 1994; Popoff & Minor, 1997). Three groups of proteins are involved in the synthesis of these and other bacterial polysaccharides: nucleotide sugar biosynthesis, glycosyl transferase and repeat-unit processing (Valvano, 2003). Most O-antigen synthesis is Wzy dependent, where synthesis occurs at the cytoplasmic face of the inner membrane and repeat units are built upon a lipid carrier, undecaprenol phosphate, by sequential sugar transfer by glycosyl transferases. These lipid-linked repeat units are thought to be transferred by Wzx to the periplasmic face of the inner membrane (Liu et al., 1996), but the mechanism for this process is unknown. The repeat units are then polymerized by Wzy, with the polysaccharide chain length determined by Wzz, and the polymer is then transferred onto lipid A to form a complete lipopolysaccharide molecule.

Wzx proteins are unusually diverse in sequence but commonly have high numbers of predicted transmembrane segments (TMS), are members of the polysaccharide-specific transport family (Paulsen et al., 1997), and have the Pfam family domain Polysac_synth PF01943 (http://pfam.sbc.su.se:43210/family?acc=PF01943). Wzx proteins are the least studied of the repeat-unit processing proteins with regard to function, due to difficulties in mutagenesis, cloning and expression, with studies generally confined to gene knockout and complementation (Schnaitman & Klena, 1993; Macpherson et al., 1995; Liu et al., 1996; Burrows & Lam, 1999; Feldman et al., 1999; Rick et al., 2003; Marolda et al., 2004; Mazur et al., 2005; Xayarath & Yother, 2007). Despite the large sequence diversity, it appears that Wzx has quite relaxed substrate specificity.

There are topology models for two Wzy proteins, from Rhizobium leguminosarum bv. trifolii (PssT) and Shigella flexneri, that are, respectively, involved in exopolysaccharide and O-antigen synthesis, whereas there is only one published topology model for Wzx, from R. leguminosarum bv. trifolii (Daniels et al., 1998; Mazur et al., 2003, 2005).

The S. enterica sv. Typhimurium Group B O antigen is an ideal candidate for Wzx topology studies as the gene cluster involved has been sequenced (Jiang et al., 1991), and it is one of the few for which all the biosynthesis proteins involved have been identified, these being for (1) nucleotide sugar biosynthesis of dTDP-rhamnose (Glaser & Kornfeld, 1961; Kornfeld & Glaser, 1961; Nikaido et al., 1966; Graninger et al., 1999), GDP-mannose (Elling et al., 1996) and CDP-abequose (Wyk & Reeves, 1989), (2) the initial transferase WbaP (Wang & Reeves, 1994; Wang et al., 1996), for galactose phosphate, and the other three transferases WbaN, WbaU and WbaV, which are responsible for the respective addition of rhamnose, mannose and abequose residues (Liu et al., 1993, 1995) and (3) the O-unit-processing proteins Wzx (Feldman et al., 1999; Marolda et al., 2004), Wzy (Collins & Hackett, 1991; Wong et al., 1999) and Wzz (Murray et al., 2003).

The topology of membrane proteins can be elucidated using gene fusion analysis, whereby the N- or the C-terminus of the target protein, or fragments thereof, are fused with an easily detectable protein that is dependent on cellular location for biochemical activity; for example, LacZ and PhoA, which encode β-galactosidase (β-Gal) and alkaline phosphatase (AP), respectively (Froshauer et al., 1988; San Millan et al., 1989; Ehrmann et al., 1990). This paper describes the cloning of the Group B wzx gene, construction of phoA and lacZ fusions and analysis and establishment of an O-antigen Wzx membrane topology.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. References

The bacterial strains and plasmids used in this study are described in Table 1. Topology vectors pRMCD28 and pRMCD70 were kindly provided by R. Morona. Escherichia coli strains JM109, DH5α and MC4100 were used, respectively, as hosts for plasmid propagation, AP and β-Gal assays. Bacteria were grown in Luria–Bertani medium (Sambrook et al., 1989) at 37 °C overnight. Where required, cultures were supplemented with 50 μg mL−1 ampicillin (Amp) and, for indicator plates, either 40 μg mL−1 5-bromo-4-chloro-3-indolyl phosphate to detect AP activity or 40 μg mL−1 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside to detect β-gal activity (Sigma-Aldrich).

Table 1.   Bacterial strains and plasmids used in this study
Strain or plasmidStrain or plasmid descriptionSources/References
  • *

    In-frame constructs derived from ExoIII deletion time course of EcoRV/PstI digested pPR2100. Wzx fragment size is based on the last complete wzx codon present in construct.

  • Fragments of wzx were cloned into the XbaI and BamHI restriction sites of parent vectors pPR2099 and pRMCD70 to construct respective in-frame fusions with phoA and lacZ.

Strains
 P9003S. enterica sv. Typhimurium Group B wild type (O4)Ornellas & Stocker (1974)
 JM109endA1, recA1, gyrA96, thi, hsdR17, (rk−, mk+), relA1, supE44,λ−, Δ (lac-proAB), (F′, traD36, proAB, lacIqZ M15)Promega
 DH5αendA, hsdR, supE44, thi-1, recA1, gyrA, relAΔ, (lacZYA-argF), U169 [Φ80 dlacΔ(lacZ) M15] phoAPromega
 MC4100FaraD139Δ (argF-lac)U169 rpsL150 relA1 flbB5301 deoC1 ptsF25 rbsRCasadaben (1976)
Plasmids
 pET22b+Expression vector. AmpRNovagen
 pRMCD28E. coli phoA low-copy number topology vector. AmpRDaniels et al. (1998)
 pRMCD70E. coli lacZ low-copy number topology vector. AmpRDaniels et al. (1998)
 pPR2066pET22b+with S. enterica sv. Typhimurium Group B wzx. AmpRThis study
 pPR2096XbaI–RBS–wzx–NcoI–XbaI fragment cloned out of frame with lacZ into XbaI site of pRMCD70. AmpRThis study
 pPR2099pRMCD28 with a replacement BamHI–phoA–XhoI fragment. AmpRThis study
 pPR2100XbaI–RBS–wzx–EcoRV–XbaI fragment cloned out of frame with phoA into XbaI site of pRMCD28. AmpRThis study
 pPR2101pPR2096 BamHI digested and religated vector backbone. Wzx in-frame with lacZ. AmpRThis study
 pPR2112pPR2099 with the XbaI–RBS–wzx–NcoI–XbaI fragment of pPR2096 at XbaI site. AmpRThis study
 pPR2113pPR2100 derivative with wzx fragment (1–135 bp)*. AmpRThis study
 pPR2114pPR2100 derivative with wzx fragment (1–225 bp)*. AmpRThis study
 pPR2115pPR2100 derivative with wzx fragment (1–267 bp)*. AmpRThis study
 pPR2116pPR2100 derivative with wzx fragment (1–336 bp)*. AmpRThis study
 pPR2117pPR2100 derivative with wzx fragment (1–363 bp)*. AmpRThis study
 pPR2118pPR2100 derivative with wzx fragment (1–363 bp)*. AmpRThis study
 pPR2119pPR2100 derivative with wzx fragment (1–375 bp)*. AmpRThis study
 pPR2120pPR2100 derivative with wzx fragment (1–432 bp)*. AmpRThis study
 pPR2121pPR2100 derivative with wzx fragment (1–750 bp)*. AmpRThis study
 pPR2122pPR2100 derivative with wzx fragment (1–783 bp)*. AmpRThis study
 pPR2123pPR2100 derivative with wzx fragment (1–795 bp)*. AmpRThis study
 pPR2124pPR2100 derivative with wzx fragment (1–831 bp)*. AmpRThis study
 pPR2125pPR2100 derivative with wzx fragment (1–1023 bp)*. AmpRThis study
 pPR2126pPR2100 derivative with wzx fragment (1–1026 bp)*. AmpRThis study
 pPR2127pPR2100 derivative with wzx fragment (1–1161 bp)*. AmpRThis study
 pPR2128pPR2100 derivative with wzx fragment (1–1164 bp)*. AmpRThis study
 pPR2129pPR2100 derivative with wzx fragment (1–1215 bp)*. AmpRThis study
 pPR2130pPR2100 derivative with wzx fragment (1–1236 bp)*. AmpRThis study
 pPR2131pPR2100 derivative with wzx fragment (1–1242 bp)*. AmpRThis study
 pPR2132pPR2100 derivative with wzx fragment (1–1251 bp)*. AmpRThis study
 pPR2133pPR2099 with wzx fragment (1–126 bp). AmpRThis study
 pPR2134pPR2099 with wzx fragment (1–225 bp). AmpRThis study
 pPR2135pPR2099 with wzx fragment (1–366 bp). AmpRThis study
 pPR2136pPR2099 with wzx fragment (1–468 bp). AmpRThis study
 pPR2137pPR2099 with wzx fragment (1–558 bp). AmpRThis study
 pPR2138pPR2099 with wzx fragment (1–657 bp). AmpRThis study
 pPR2139pPR2099 with wzx fragment (1–765 bp). AmpRThis study
 pPR2140pPR2099 with wzx fragment (1–894 bp). AmpRThis study
 pPR2141pPR2099 with wzx fragment (1–987 bp). AmpRThis study
 pPR2142pPR2099 with wzx fragment (1–1095 bp). AmpRThis study
 pPR2143pPR2099 with wzx fragment (1–1188 bp). AmpRThis study
 pPR2144pRMCD70 with wzx fragment (1–126 bp). AmpRThis study
 pPR2145pRMCD70 with wzx fragment (1–225 bp). AmpRThis study
 pPR2146pRMCD70 with wzx fragment (1–366 bp). AmpRThis study
 pPR2147pRMCD70 with wzx fragment (1–468 bp). AmpRThis study
 pPR2148pRMCD70 with wzx fragment (1–558 bp). AmpRThis study
 pPR2149pRMCD70 with wzx fragment (1–657 bp). AmpRThis study
 pPR2150pRMCD70 with wzx fragment (1–765 bp). AmpRThis study
 pPR2151pRMCD70 with wzx fragment (1–894 bp). AmpRThis study
 pPR2152pRMCD70 with wzx fragment (1–987 bp). AmpRThis study
 pPR2153pRMCD70 with wzx fragment (1–1095 bp). AmpRThis study
 pPR2154pRMCD70 with wzx fragment (1–1188 bp). AmpRThis study

Molecular techniques

Chromosomal DNA was extracted using the Wizard chromosomal DNA purification kit (Promega). High fidelity and standard PCR using, respectively, Vent and Standard Taq DNA polymerases (New England Biolabs; NEB), were used for clone construction and construct screening, respectively, as described previously (Cunneen & Reeves, 2007).

PCR products and DNA fragments obtained by restriction endonuclease digestion were purified using the UltraClean Purification System (Mo Bio) and DNA fragments were cloned into plasmid vectors using T4 DNA ligase (NEB). Plasmid DNA was extracted using Miniprep and Midiprep Kits (Promega) and sequenced at the Australian Genomic Research Facility (Brisbane, Australia) using an Applied Biosystems model AB3730xL automated DNA sequencing system with an ABI Dye Terminator cycle sequencing kit. The Erase-a-base System (Promega) was used for construction of randomly generated fusions by unidirectional ExoIII digestion. Restriction endonucleases (NEB), kits and reagents were used according to the manufacturer's instructions.

Bioinformatics

TMS predictions of the S. enterica sv. Typhimurium Group B Wzx were obtained using the topred (von Heijne, 1992), tmhmm (Sonnhammer et al., 1998), das-tmfilter (Cserzo et al., 1997, 2002) sosui, (Hirokawa et al., 1998) and hmmtop (Tusnady & Simon, 1998, 2001) programs, with the default settings for each.

Cloning the S. enterica wzx gene

The S. enterica sv. Typhimurium wzx gene (GenBank Accession X56793) was amplified from genomic DNA by high-fidelity PCR using primers 4936F and 4937R that contain, respectively, the NdeI and XhoI restriction sites (see Table 2 for primers). The purified product was digested with NdeI and XhoI, purified and then cloned between these respective sites of pET22b+(Novagen) to form pPR2066, with the junction sites confirmed by sequencing.

Table 2.   Primers used in this study
Primer*Sequence (5′–3′)Description
  • *

    Primer orientation is indicated; F, forward; R, reverse.

  • Restriction endonuclease site is in lower case.

  • Restriction endonuclease site is underlined.

  • §

    First codon of phoA fragment is in bold.

  • In some cases primers were designed to reduce secondary structures or to introduce a BamHI restriction site. Codon changes and details are given in brackets in primer description.

4936FGGGAATTccatatggTGAAGTTCAATTGTTAAAStart of wzx with NdeI site
4937RCCGGctcgagTCCCTTATTTGCCTTAAATTAEnd of wzx, excluding the stop codon, with XhoI site
5371FTTAATACGACTCACTATAGGGT7 promotor primer located upstream of pET22b+MCS (Novagen)
5377RCCATCGCCAATCAGCAAAIn phoA. For sequencing over fusion junctions
5378RTACGCCAGCTGGCGAAAGIn lacZ. For sequencing over fusion junctions
5558RCTAGtctagaCTGATATCTCCCTTATTTGCCTTAATEnd of wzx with EcoRV and XbaI sites
5559RCTAGtctagaCTCCATGGTCCCTTATTTGCCTTAATEnd of wzx with NcoI and XbaI sites
5622RgcgtaataagactcactaDownstream of phoA in pRMCD28
5758FcatgggatccTGTTCTGGAAAACCGGGStart of phoA§ with a BamHI site
5706FTCCCctctagAAATAATTTTGTUpstream of the RBS and wzx gene in pPR2066, with XbaI site
5707RCCACggatccTCACCTAGCATAGAAATAwzx primer at base 126 with BamHI site. Codon change in wzx at base 126; GAA (E) to GAG (E)
5708RCGTCggatccTCTGATATATAATTTTGCwzx primer at base 225 with BamHI site. Codon change in wzx at base 225; GAA (E) to GAG (E)
5709RCGTCggatccTCATGAAAAGAAGAAAGAwzx primer at base 366 with BamHI site
5710RCGTCggatccAATTCGGCAAAAAGTATwzx primer at base 468 with BamHI site
5711RGTTCggatccACTGAGATGCCCCTATAGTATwzx primer at base 558 with BamHI site. Codon change in wzx at base 558; GTT (V) to GTG (V), and at base 549; GGG (G) to GGC (G)
5712RGACAggatccGTTTTAACATGATAAAGCwzx primer at base 657 with BamHI site. Codon change in wzx at base 657; ACA (T) to ACG (T)
5713RCGCGggatccCTTTGAGAAATGACCATwzx primer at base 765 with BamHI site
5714RTGA CggatccCATTGCTGTTTGACTCTwzx primer at base 894 with BamHI site
5715RCGCCggatccTGTTCTTTAAATAAATAwzx primer at base 987 with BamHI site
5716RCATCggatccATTGCATAAGTGTCACAwzx primer at base 1095 with BamHI site
 wzx primer at base 1188 with BamHI site
5717RCTGCggatccGAAGAAAAATACCATTGTGCCodon change in wzx at bases 1185–1188; AGT (S) to TCG (S)

Vector construction for Wzx topology analysis

Out-of-frame wzx fusions to phoA (pPR2100) and lacZ (pPR2096) were constructed, for use in subsequent ExoIII digests, using XbaI restriction sites of topology reporter plasmids pRMCD28 and pRMCD70. Briefly, this entailed high-fidelity PCR to amplify the wzx fragment from pPR2066, inclusive of the ribosomal-binding site upstream, using primers 5371F and either 5558R (for pRMCD28) or 5559R (for pRMCD70). These PCR products contained XbaI sites upstream and downstream of wzx for cloning, and incorporated, respectively, either an EcoRV or an NcoI restriction site downstream of wzx that are suitable targets for subsequent ExoIII digestion. Insert orientation and fusion sites of wzx in constructs pPR2100 and pPR2096, respectively, were confirmed by restriction analysis and sequencing (not shown).

Construction of random wzxphoA fusions with ExoIII

The Erase-a-base System (Promega) was used to construct random, unidirectional deletions from the end of wzx in pPR2100. Firstly, pPR2100 was digested with EcoRV and PstI, with the overhangs generated being, respectively, susceptible and resistant to subsequent ExoIII digestion. The digests were purified and then treated with ExoIII at 22 °C and 20 samples were taken at 30-s intervals. The resultant fragments were repaired, recircularized by ligation and transformed into DH5α.

Vector construction to determine Wzx C-terminal location

An in-frame wzxlacZ fusion was constructed from pPR2096 by restriction endonuclease digestion with BamHI, which excised most of the MCS (multiple cloning site) region between wzx and lacZ, and then gel extracting, purifying and self-ligating the linearized vector backbone to form pPR2101, whose fusion junction was confirmed by sequencing.

To construct an in-frame wzxphoA fusion, and subsequent site-specific fusions, pRMCD28 was modified to remove most of the MCS upstream of phoA to allow in-frame cloning and to standardize the fusion junctions of phoA and lacZ to wzx fragments. To accomplish this, the phoA fragment of pRMCD28, along with the BamHI–HindIII MCS region upstream of phoA, was replaced with a PCR product that contained phoA with a BamHI restriction site upstream and an XhoI site downstream for cloning. The phoA PCR product was amplified from pRMCD28 by high-fidelity PCR with primers 5758F and 5622R, purified and digested with BamHI and XhoI. The digested product was again purified and then ligated to the purified vector backbone of similarly digested pRMCD28, to form pPR2099. The gel-extracted, purified wzx insert from XbaI-digested pPR2096 was then ligated into pPR2099 at the XbaI site, to form an in-frame wzxphoA fusion construct pPR2112. The fusion junction was confirmed by sequencing.

Construction of targeted wzxphoA and wzxlacZ fusions

Suitable fusion sites in the periplasmic and cytoplasmic loops were identified using a consensus based on the TMS prediction data obtained (Table 3). The sites selected correspond to amino acids E42, E75, E122, L156, V186, T219, R255, W298, Q329, M365 and S396. One of these sites is identical to the E75 fusion obtained by ExoIII digestion with another three sites (E42, E122 and S396) in the vicinity of the Y45-, H121- and G388 ExoIII-derived fusions.

Table 3.   TMS predictions for five different programs
TMS numberProgram predictions for Wzx TMS start and end positionsModel TMS positions*
dastopredsosuitmhmmhmmtop
  • *

    Model TMS positions based on at least a three program consensus on TMS location.

126–3921–4113–3512–3412–3613–36
251–6245–6545–6747–6945–6945–67
395–11593–11393–11590–11294–11393–113
4136–151129–149132–154132–154130–149132–151
5171–183161–181160–182161–180162–181161–181
6192–212189–209187–209190–212190–209190–209
7237–248230–250232–254233–250234–253233–250
8272–286270–290270–292270–292270–289270–290
9311–328306–326303–325304–326304–325304–326
10346–359340–360334–356341–360342–360341–360
11377–389374–394371–393372–394375–394374–394
12402–424400–420401–423399–421403–425401–423
Total TMS121212121212

LacZ and PhoA fusion construction at these 11 Wzx sites involved amplifying fragments of wzx using primer 5371F, which is located upstream of wzx in pPR2066 and reverse primers, 5707R–5717R, located at various locations along the length of wzx (Table 2), and that incorporated a BamHI restriction site for cloning. Purified PCR products were digested with XbaI and BamHI, purified and cloned into similarly digested pRMCD70 and pPR2099. The fusion junction of each construct was confirmed by sequencing using primer 5377R for phoA or 5378R for lacZ fusions.

AP assays were carried out according to the method of Daniels et al. (1998). β-Gal assays were carried out according to the method of Baker et al. (1997), with the exception that overnight cultures were subcultured and grown to OD∼0.6 before activity assays. Samples were assayed in triplicate over at least three independent experiments with the average enzyme activities given in Fig. 1.

image

Figure 1. Salmonella enterica sv. Typhimurium Group B Wzx topology model. Information from five TMS prediction programs were used to construct model (TMS positions used are given in Table 3). Mean enzyme activities (in Miller units) from three independent experiments are indicated at fusion sites; ExoIII-generated PhoA fusions (clear ovals), site-specific fusions to PhoA (clear boxes) and LacZ (grey boxes). SDs are indicated at each fusion site. Positively charged amino acids are high lighted in black. Activities marked with (a) and (b) distinguish fusions that share a common fusion site. *Constructs with either partially or fully deleted fusion junctions and are discussed in the text.

Download figure to PowerPoint

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. References

The S. enterica sv. Typhimurium Group B Wzx protein is 430 amino acids in length, and five TMS programs predict the presence of 12 TMS that vary slightly in the start and end positions depending on the program (Table 3).

Wzx–PhoA fusions were generated at random locations within Wzx by ExoIII digestion from the end of wzx. Two ExoIII deletion series resulted in hundreds of blue transformants on AP indicator plates with three different colony phenotypes observed after overnight growth at 37 °C: small (1–2 mm) dark blue colonies and larger (3–5 mm) light blue colonies, with or without a white margin. Colony PCR of 200 transformants, representing all three observed phenotypes, using primers 5271F (located at the start of wzx) and 5377R (near the start of phoA), and gel electrophoresis showed that 57 had a noticeably reduced wzx fragment size. Plasmid DNA was extracted from these and the fusion junction of each was sequenced using primer 5377R, which revealed 20 unique in-frame fusions. Representative plasmids were named pPR2113-2132 (Table 1).

AP assays were carried out on the 20 constructs, along with controls pRMCD28 and pPR2112, all in DH5α. Four constructs with fusions between TMS 3 and 4, or between TMS 7 and 8, demonstrated high AP activity, which clearly supports the predicted periplasmic location of these two loops, and two others had lower levels of activity. Most other fusions, and both controls, had essentially no AP activity. Three other constructs demonstrated AP activity. One, in the predicted cytoplasmic loop region between TMS 2 and 3 (at E75), had a medium level of activity, which was also not in agreement with the strong support for the adjacent loop between TMS 3 and 4 being periplasmic. Two fusions within the predicted TMS 3 and 4, which demonstrated AP activity, may reside sufficiently near the periplasm for PhoA to be exported through, and so be functional, or the TMS involved may not have been anchored sufficiently to be contained within the inner membrane.

For transformants with colonies having a light blue centre with a white margin, the AP activities were negligible, or many times less, than those that had blue colonies. Cell lysis could account for light blue colonies, as it can lead to oxidation of cytoplasmic PhoA and appear to be AP positive on indicator plates (Derman & Beckwith, 1995).

For several ExoIII-derived fusions (marked with an asterisk in Fig. 1), part or all of the fusion junction between wzx and the phoA fragment had been deleted, along with the PstI restriction site, with between 11 and 45 bp missing, that, in some cases, also extended into the start of the phoA fragment. These generally had a lower AP activity than other fusions. Two fusion constructs were obtained at residue H121 (Fig. 1) that indicate that AP activity was affected by the length and quality of the fusion junction with almost a 10-fold difference in activity. These two fusions differed in the length of sequence between wzx and phoA, with pPR2117 (H121a in Fig. 1) being a direct wzx–phoA fusion lacking part of phoA and pPR2118 (H121b in Fig. 1) having the expected parent vector sequence, spanning eight codons, between wzx and phoA.

Attempts to use ExoIII digestion on NcoI/PstI-digested pPR2096 to construct wzxlacZ fusions was not successful (data not shown), and site-specific fusions of wzx to phoA and lacZ were constructed at predicted loop sites and then assayed to provide further topological data.

The assay data from both methods were used to generate a membrane topology model for Wzx in the cytoplasmic membrane (Fig. 1) that agreed with the 12 TMS predicted, with the full-length fusions clearly indicating that the C-terminus is located in the cytoplasm.

Fusions at E75, in the loop between TMS 2 and 3, gave ambiguous results with the ExoIII-generated phoA fusion (pPR2114) demonstrating AP activity but both site-specific fusions had low activity, although for the latter the LacZ fusion activity was greater than the PhoA counterpart. In contrast, the ExoIII fusion at S89 within the same predicted loop, had negligible AP activity. Four positively charged residues (K and R) are present between Wzx residues E75 and S89, that are involved in stopping transfer through the inner membrane of newly synthesized proteins and are cytoplasmic loop determinants (Ehrle et al., 2003). The absence of these residues in the E75 fusion may have resulted in the upstream region not being anchored within the cytoplasm and with the extra eight codons present at the fusion junction in ExoIII-derived constructs, but not site-specific ones, may have allowed the PhoA fragment to span and clear the inner membrane to the periplasm and account for the activity observed. Considering all the fusion data obtained, and the TMS prediction data, it is likely then that this is a cytoplasmic loop.

There is only one other putative Wzx for which a topology model has been proposed: that of PssL, involved in R. leguminosarum bv. trifolii exopolysaccharide synthesis. It is also based on phoA and lacZ gene fusion analysis and is a 12-TMS model with cytoplasmic N- and C-termini (Mazur et al., 2005). These two Wzx proteins have only 22% identity in a BESTFIT alignment (not shown) and illustrate the sequence diversity common between many Wzx proteins. The most notable difference between the two topology models is the presence of a large 81-residue cytoplasmic loop between TMS 6 and 7 in R. leguminosarum bv. trifolii, in contrast to S. enterica sv. Typhimurium Wzx, which has no predicted loop region >25 residues in length. Another difference between them is in the Wzx N- and C-termini tail lengths that are exposed in the cytoplasm, being c. 30 residues in R. leguminosarum bv. trifolii and only c. 10 in S. enterica sv. Typhimurium.

Final comments

For this study, three approaches were used to obtain topological data for the Wzx of the S. enterica sv. Typhimurium Group B O antigen: TMS predictions, ExoIII-generated constructs and site-specific constructs fusing fragments of wzx to phoA or lacZ. While ExoIII generated hundreds of transformants, the final number of in-frame constructs useful for further analysis was quite low and did not represent all the predicted Wzx loop regions. However, site-specific constructs were generally useful and a full topology model was completed. The data presented here provide a foundation for advancing Wzx structure and function studies particularly as Wzx function is poorly understood. Currently, no crystal diffraction data are available for any Wzx and the only available structures for other polysaccharide-processing proteins are a Wza–Wzc complex involved in capsular export (Collins et al., 2007) and the chain-length determinant Wzz (Tang et al., 2007; Marolda et al., 2008).

Wzx are highly diverse in sequence but the reasons for this diversity are unclear. However, the differences identified between the Wzx topology models from an exopolysaccharide and an O-antigen system could indicate that although a 12-TMS topology model was found for both, there are differences in function, some of which could relate to the biosynthesis differences between these two polysaccharide types.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. References
  • Baker SJ, Daniels C & Morona R (1997) PhoP/Q regulated genes in Salmonella typhi identification of melittin sensitive mutants. Microb Pathogen 22: 165179.
  • Brenner DJ (1984) Recommendations on recent proposals for the classification of Shigellae. Int J Syst Bacteriol 34: 8788.
  • Burrows LL & Lam JS (1999) Effect of wzx (rfbX) mutations on A-band and B-band lipopolysaccharide biosynthesis in Pseudomonas aeruginosa O5. J Bacteriol 181: 973980.
  • Casadaban MJ (1976) Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu. J Mol Biol 104: 541555.
  • Collins LV & Hackett J (1991) Molecular cloning, characterization, and nucleotide sequence of the rfc gene, which encodes an O-antigen polymerase of Salmonella typhimurium. J Bacteriol 173: 25212529.
  • Collins RF, Beis K, Dong C, Botting CH, McDonnell C, Ford RC, Clarke BR, Whitfield C & Naismith JH (2007) The 3D structure of a periplasm-spanning platform required for assembly of group 1 capsular polysaccharides in Escherichia coli. Proc Natl Acad Sci 104: 23902395.
  • Cserzo M, Wallin E, Simon I, Von Heijne G & Elofsson A (1997) Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method. Protein Eng 10: 673676.
  • Cserzo M, Eisenhaber F, Eisenhaber B & Simon I (2002) On filtering false positive transmembrane protein predictions. Protein Eng 15: 745752.
  • Cunneen MM & Reeves PR (2007) The Yersinia kristensenii O11 O-antigen gene cluster was acquired by lateral gene transfer and incorporated at a novel chromosomal locus. Mol Biol Evol 24: 13551365.
  • Daniels C, Vindurampulle C & Morona R (1998) Overexpression and topology of the Shigella flexneri O-antigen polymerase (Rfc/Wzy). Mol Microbiol 28: 12111222.
  • Derman AI & Beckwith J (1995) Escherichia coli alkaline phosphatase localized to the cytoplasm slowly acquires enzymatic activity in cells whose growth has been suspended: a caution for gene fusion studies. J Bacteriol 177: 37643770.
  • Ehrle R, Mikhaleva N, Boyd D, Davidson AL & Ehrmann M (2003) Context-dependent effects of charged residues in transmembrane segments of MalF–PhoA fusions. Res Microbiol 154: 654657.
  • Ehrmann M, Boyd D & Beckwith J (1990) Genetic analysis of membrane protein topology by a sandwich gene fusion approach. Proc Natl Acad Sci USA 87: 75747578.
  • Elling L, Ritter JE & Verseck S (1996) Expression, purification and characterization of recombinant phosphomannomutase and GDP-alpha-d-mannose pyrophosphorylase from Salmonella enterica, group B, for the synthesis of GDP-alpha-d-mannose from d-mannose. Glycobiology 6: 591597.
  • Ewing WH (1986) Edwards and Ewing's Identification of the Enterobacteriaceae. Elsevier Science Publishers, Amsterdam, the Netherlands.
  • Ewing WH, Reavis RW & Davis BR (1958) Provisional Shigella serotypes. Can J Microbiol 4: 89107.
  • Feldman MF, Marolda CL, Monteiro MA, Perry MB, Parodi AJ & Valvano MA (1999) The activity of a putative polyisoprenol-linked sugar translocase (Wzx) involved in Escherichia coli O antigen assembly is independent of the chemical structure of the O repeat. J Biol Chem 274: 3512935138.
  • Froshauer S, Green GN, Boyd D, McGovern K & Beckwith J (1988) Genetic analysis of the membrane insertion and topology of MalF, a cytoplasmic membrane protein of Escherichia coli. J Mol Biol 200: 501511.
  • Glaser L & Kornfeld S (1961) The enzymatic synthesis of thymidine-linked sugars. II. Thymidine diphosphate-l-rhamnose. J Biol Chem 236: 17951799.
  • Graninger M, Nidetzky B, Heinrichs DE, Whitfield C & Messner P (1999) Characterization of dTDP-4-dehydrorhamnose 3,5-Epimerase and dTDP-4-dehydrorhamnose reductase, required for dTDP-l-rhamnose biosynthesis in Salmonella enterica serovar Typhimurium LT2. J Biol Chem 274: 2506925077.
  • Hirokawa T, Boon-Chieng S & Mitaku S (1998) SOSUI: classification and secondary structure prediction system for membrane proteins. Bioinformatics 14: 378379.
  • Jiang XM, Neal B, Santiago F, Lee SJ, Romana LK & Reeves PR (1991) Structure and sequence of the rfb (O antigen) gene cluster of Salmonella serovar Typhimurium (strain LT2). Mol Microbiol 5: 695713.
  • Kornfeld S & Glaser L (1961) The enzymatic synthesis of thymidine-linked sugars. I. Thymidine diphosphate glucose. J Biol Chem 236: 17911794.
  • Lerouge I & Vanderleyden J (2002) O-antigen structural variation: mechanisms and possible roles in animal/plant–microbe interactions. FEMS Microbiol Rev 26: 1747.
  • Lior H (1994) Classification of Escherichia coli. Escherichia coli in Domestic Animals and Humans (GylesCL, ed), pp. 3172. CAB International, Wallingford, UK.
  • Liu D, Haase AM, Lindqvist L, Lindberg AA & Reeves PR (1993) Glycosyl transferases of O-antigen biosynthesis in Salmonella enterica: identification and characterization of transferase genes of groups B, C2, and E1. J Bacteriol 175: 34083413.
  • Liu D, Lindqvist L & Reeves PR (1995) Transferases of O-antigen biosynthesis in Salmonella enterica: dideoxyhexosyltransferases of groups B and C2 and acetyltransferase of group C2. J Bacteriol 177: 40844088.
  • Liu D, Cole RA & Reeves PR (1996) An O-antigen processing function for Wzx (RfbX): a promising candidate for O-unit flippase. J Bacteriol 178: 21022107.
  • Macpherson DF, Manning PA & Morona R (1995) Genetic analysis of the rfbX gene of Shigella flexneri. Gene 155: 917.
  • Marolda CL, Vicarioli J & Valvano MA (2004) Wzx proteins involved in biosynthesis of O antigen function in association with the first sugar of the O-specific lipopolysaccharide subunit. Microbiol 150: 40954105.
  • Marolda CL, Haggerty ER, Lung M & Valvano MA (2008) Functional analysis of predicted coiled-coil regions in the Escherichia coli K-12 O-antigen polysaccharide chain length determinant Wzz. J Bacteriol 190: 21282137.
  • Mazur A, Krol JE, Marczak M & Skorupska A (2003) Membrane topology of PssT, the transmembrane protein component of the type I exopolysaccharide transport system in Rhizobium leguminosarum bv. trifolii strain TA1. J Bacteriol 185: 25032511.
  • Mazur A, Marczak M, Krol JE & Skorupska A (2005) Topological and transcriptional analysis of pssL gene product: a putative Wzx-like exopolysaccharide translocase in Rhizobium leguminosarum bv. trifolii TA1. Arch Microbiol 184: 110.
  • Murray GL, Attridge SR & Morona R (2003) Regulation of Salmonella typhimurium lipopolysaccharide O antigen chain length is required for virulence; identification of FepE as a second Wzz. Mol Microbiol 47: 13951406.
  • Nikaido H, Nikaido K & Mäkelä PH (1966) Genetic determination of enzymes synthesizing O-specific sugars of Salmonella lipopolysaccharides. J Bacteriol 91: 11261135.
  • Ornellas EP & Stocker BAD (1974) Relation of lipopolysaccharide character to P1 sensitivity in Salmonella typhimurium. Virology 60: 491502.
  • Paulsen IT, Beness AM & Saier MH Jr (1997) Computer-based analyses of the protein constituents of transport systems catalysing export of complex carbohydrates in bacteria. Microbiology 143: 26852699.
  • Popoff MY & Minor LL (1997) Antigenic Formulas of the Salmonella Serovars, 7th Revision. WHO Collaborating Centre for Reference and Research on Salmonella. Institut Pasteur, Paris, France.
  • Rick PD, Barr K, Sankaran K, Kajimura J, Rush JS & Waechter CJ (2003) Evidence that the wzxE gene of Escherichia coli K-12 encodes a protein involved in the transbilayer movement of a trisaccharide-lipid intermediate in the assembly of enterobacterial common antigen. J Biol Chem 278: 1653416542.
  • Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • San Millan JL, Boyd D, Dalbey R, Wickner W & Beckwith J (1989) Use of phoA fusions to study the topology of the Escherichia coli inner membrane protein leader peptidase. J Bacteriol 171: 55365541.
  • Schnaitman CA & Klena JD (1993) Genetics of lipopolysaccharide biosynthesis in enteric bacteria. Microbiol Rev 57: 655682.
  • Sonnhammer EL, Von Heijne G & Krogh A (1998) A hidden Markov model for predicting transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol; ISMB 6: 175182.
  • Tang KH, Guo H, Yi W, Tsai MD & Wang PG (2007) Investigation of the conformational states of Wzz and the Wzz-O-antigen complex under near-physiological conditions. Biochemistry 46: 1174411752.
  • Tusnady GE & Simon I (1998) Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J Mol Biol 283: 489506.
  • Tusnady GE & Simon I (2001) The HMMTOP transmembrane topology prediction server. Bioinformatics 17: 849850.
  • Valvano MA (2003) Export of O-specific lipopolysaccharide. Front Biosci 8: s452s471.
  • Von Heijne G (1992) Membrane protein structure prediction. Hydrophobicity analysis and the positive-inside rule. J Mol Biol 225: 487494.
  • Wang L & Reeves PR (1994) Involvement of the galactosyl-1-phosphate transferase encoded by the Salmonella enterica rfbP gene in O antigen subunit processing. J Bacteriol 176: 43484356.
  • Wang L, Liu D & Reeves PR (1996) C-terminal half of Salmonella enterica WbaP (RfbP) is the galactosyl-1-phosphate transferase domain catalyzing the first step of O-antigen synthesis. J Bacteriol 178: 25982604.
  • Wong DK, Morris C, Lam TL, Wong WK & Hackett J (1999) Identification of O-antigen polymerase transcription and translation start signals and visualization of the protein in Salmonella enterica serovar Typhimurium. Microbiology 145: 24432451.
  • Wyk P & Reeves P (1989) Identification and sequence of the gene for abequose synthase, which confers antigenic specificity on group B Salmonellae: homology with galactose epimerase. J Bacteriol 171: 56875693.
  • Xayarath B & Yother J (2007) Mutations blocking side chain assembly, polymerization, or transport of a Wzy-dependent Streptococcus pneumoniae capsule are lethal in the absence of suppressor mutations and can affect polymer transfer to the cell wall. J Bacteriol 2007: 33693381.
  • Zhang L, Radziejewska-Lebrecht J, Krajewska-Pietrasik D, Toivanen P & Skurnik M (1997) Molecular and chemical characterization of the lipopolysaccharide O-antigen and its role in the virulence of Yersinia enterocolitica serotype O:8. Mol Microbiol 23: 6376.