SEARCH

SEARCH BY CITATION

Keywords:

  • Streptococcus parauberis;
  • Streptococcus iniae;
  • Paralichthys olivaceus;
  • phenotypic characteristics

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

The etiological agents of streptococcosis were isolated from diseased olive flounder collected on the Jeju island of Korea. A total of 151 bacterial isolates were collected between 2003 and 2006. The isolates were examined using various phenotypic and proteomic analyses, including sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), immunoblotting, and glycoprotein assays. In addition, isolates were grown on blood agar to assess hemolytic activity, and biochemical assays were performed using the API20 Strep kit. Our results revealed that all isolates were nonmotile, Gram-positive cocci that displayed negative catalase and oxidase activities. Multiplex PCR assays revealed that 43% and 57% of the isolates were Streptococcus iniae and Streptococcus parauberis, respectively. These results were consistent with those of the SDS-PAGE and immunoblot analyses using whole-cell lysates of bacterial isolates. Significant differences were observed with respect to the Voges–Proskauer, pyrrodonyl arylamidase, alkaline phosphatase, and hemolytic activities of the S. iniae and S. parauberis isolates. Isolates of S. iniae displayed uniform profiles in the immunoblot and glycoprotein assays; however, immunoblot assays of S. parauberis isolates (using a chicken IgY antibody raised against a homologous isolate) revealed three distinct antigenic profiles. Our findings suggest that S. parauberis and S. iniae are endemic pathogens responsible for the development of streptococcosis in olive flounder.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Streptococcosis of cultured fish contributes to major economic losses in the aquaculture industries of many countries, including Israel (Eldar et al., 1995), Italy (Ghittino & Prearo, 1992), Japan (Kitao, 1993), Korea (Baeck et al., 2006; Shin et al., 2006) and the United States (Perera et al., 1994). The major species responsible for this disease include Streptococcus parauberis, Streptococcus iniae, Streptococcus difficilis, Lactococcus garvieae, Lactococcus piscium, Vagococcus salmoninarum, and Carnobacterium piscicola (Mata et al., 2004). In particular, S. iniae and L. garvieae are known to infect many fish species, including olive flounder (Paralichthys olivaceus) (Nakatsugawa, 1983; Shin et al., 2006), rainbow trout (Oncorhynchus mykiss) (Chang et al., 2002; Diler et al., 2002), red drum (Sciaenops ocellatus) (Eldar et al., 1999), rabbitfish (Siganus canaliculatus) (Yuasa et al., 1999), yellowtail (Seriola quinqueradiata) (Kusuda et al., 1976), and barramundi (Lates calcarifera) (Bromage et al., 1999; Creeper & Buller, 2006). Recently, S. parauberis was determined to be the etiological agent of streptococcosis in turbot and olive flounder (Doménech et al., 1996; Mata et al., 2004; Baeck et al., 2006).

Unfortunately, conventional biochemical tests do not allow for the precise identification and classification of streptococcal isolates, because of differences in growth rates, inoculum levels, and incubation periods (Facklam & Elliott, 1995). Consequently, the number and the nature of bacterial species associated with fish streptococcosis remains controversial (Romalde et al., 2008). Recently, Shin et al. (2006) used molecular and serological tests to identify several distinguishing characteristics of S. iniae and L. garvieae. In addition, Baeck et al. (2006) used biochemical and serological methods (e.g. slide agglutination, hemolytic tests, antimicrobial susceptibility tests, and multiplex PCR analyses) to characterize S. parauberis isolates from diseased olive flounder. However, few studies have explored the phenotypic and serological characteristics of these pathogens.

Here, we use biochemical, serological, molecular, and traditional microbiological techniques to identify and characterize the streptococcal strains isolated from diseased olive flounder. Our findings will assist with future epidemiological studies and will promote the development of appropriate vaccines against streptococcosis.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Collection of bacterial isolates

A total of 151 bacterial strains were isolated from the spleens of diseased olive flounder, which were obtained from aquaculture farms on the Jeju island of Korea between 2003 and 2006. Bacterial isolates were cultured on tryptic soy agar (TSA, Oxoid) at 25 °C for 24 h. Individual colonies were recultured on TSA to ensure purity. The isolates were then identified according to their source of collection (Table 1) and stored at −70 °C, in tryptic soy broth (TSB) containing 10% (v/v) glycerol, until further use.

Table 1.   Origins of bacterial isolates
YearsSpeciesNumber of isolates per month
JanuaryFebruaryMarchAprilMayJuneJulyAugustSeptemberOctoberNovemberDecemberTotal
  1. SI, Streptococcus iniae; SP, Streptococcus parauberis.

2003SI11000245323223
SP42322322121327
2004SI11011222022115
SP11412221012219
2005SI10002111221213
SP22211212222120
2006SI10111122211114
SP11123105221120
Total1281181214142012141313151

Bacterial cultures and biochemical test

Bacterial cultures and biochemical tests were performed as described previously (Shin et al., 2006). Briefly, stored isolates were inoculated in TSB, incubated at 25 °C for 24 h, and cultured on blood agar at 25 °C for 24 h. Colonies from the blood agar plates were subcultured in TSB and grown to an OD610 nm of 1.0 (i.e. c. 4 × 109 CFU mL−1) for use in PCR, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and immunoblot assays. In addition, colonies were suspended in phosphate-buffered saline (PBS) (3 mM KCl, 137 mM NaCl, 1.5 mM KH2PO4, and 8 mM Na2HPO4, pH 7.4) for catalase, oxidase, and motility tests. Other biochemical tests were performed using the API 20 Strep kit (BioMerieux Inc.) according to the manufacturer's instructions. Bacterial motility test was performed by the wet mount method using Nikon Eclipse TE2000-S microscope. Reference strains [S. iniae ATCC29178, S. parauberis (Dong-bo), and L. garvieae KG9408] were used as positive controls for comparing the results.

Multiplex PCR assays

Multiplex PCR assays were used to simultaneously detect S. iniae, S. parauberis, and L. garviae. The stored isolates were cultured in TSB at 25 °C for 24 h, and DNA was extracted using the AccuPrep® Genomic DNA Extraction Kit (Bioneer, Korea) according to the manufacturer's instructions. The oligonucleotide primer sets used to identify isolates were derived from published sequences (Table 2). Multiplex PCR was performed in 20-μL reaction mixtures containing 1 μL template DNA, 0.05 μM of each primer (Bioneer), and the AccuPower PCR® premix (Bioneer). Amplification was performed using a PTC-100TM programmable thermal controller (MJ Research Inc.). The PCR conditions included an initial denaturation cycle of 94 °C for 5 min; 30 serial cycles that each included a denaturation step at 94 °C for 30 s, an annealing step at 50 °C for 30 s, and an extension step at 72 °C for 30 s; and a final extension step at 72 °C for 7 min. Multiplex PCR products were analyzed on a 2% (w/v) agarose gel containing 1% (w/v) ethidium bromide. DNA bands were visualized under UV transillumination and photographed.

Table 2.   Multiplex PCR primers
PathogenPrimerNucleotide sequence (5′–3′)Expected size (bp)References
S. iniaeSin 1bCTAGAGTACACATGTAGCTAAG300Zlotkin et al. (1998)
Sin 2GGATTTTCCACTCCCATTAC  
S. parauberisSpa 2152TTTCGTCTGAGGCAATGTTG718Mata et al. (2004)
Spa 2870GCTTCATATATCGCTATACT  
L. garvieaepLG 1CATAACAATGAGAATCGC1100Mata et al. (2004)
pLG 2GCACCCTCGCGGGTTG  

Production of chicken anti-S. parauberis (Dong-bo) IgY

Anti-S. parauberis (Dong-bo) IgY antibodies were raised in a chicken as described previously (Shin et al., 2006). The advantage of using IgY is that a large amount of specific antibodies can be produced without sacrificing experimental animals. Briefly, chickens were immunized with 108 CFU mL−1 of formalin-killed bacteria (FKB, the Dong-bo isolate of S. parauberis) that had been mixed with an equal volume of Freund's complete adjuvant. The chickens were then injected every 2 weeks, for a total of three injections, with 108 CFU mL−1 of FKB emulsified with Freund's incomplete adjuvant. A week after the final immunization, chicken eggs were collected and IgY was purified using the EggSTRACT® IgY purification kit (Promega, Madison, WI) according to the manufacturer's instructions. The purified IgY pellet was resuspended in PBS and stored at −20 °C until further use.

SDS-PAGE

SDS-PAGE analyses were performed on 12.5% (w/v) separating gels, according to the method of Laemmli (1970). Bacterial isolates were cultured in TSB at 25 °C for 24 h, centrifuged at 2000 g for 30 min, washed three times in PBS, resuspended in 200 μL of PBS, and mixed with 50 μL of 5 × sample buffer [5 : 1; 60 mM Tris-HCl, 25% (v/v) glycerol, 2% (w/v) SDS, 14.4 mM 2-mercaptoethanol, and 0.1% (w/v) bromophenol blue]. The samples were then sonicated 10 times (XL-2020, Misonix Inc., Farmingdale, NY) (5.5 W, 10 s intervals), boiled for 10 min, cooled on ice, and centrifuged at 16 000 g for 20 min at 4 °C. The supernatants were collected and stored at −20 °C until further use. After SDS-PAGE analysis, gels were stained with Coomassie Brilliant Blue R-250. Additional SDS-PAGE gels were run for use in Western blotting assays.

Immunoblot assays

After proteins were resolved via SDS-PAGE, gels were electroblotted onto polyvinylidene difluoride (PVDF) membranes (70 V for 70 min). The membranes were then soaked in 100% methanol for 20 s and dried at room temperature (RT). The membranes were blocked with 5% (w/v) skim milk in PBS-T [3 mM KCl, 137 mM NaCl, 1.5 mM KH2PO4, 8 mM Na2HPO4 (pH 7.2), and 0.05% (v/v) Tween-20] for 60 min at RT, washed three times with PBS-T, and incubated with anti-S. parauberis (Dong-bo) chicken IgY (1 : 200) for 60 min at RT. Membranes were then washed three times with PBS-T and incubated with rabbit anti-chicken IgG-HRP (1 : 4000) (Cappel Biologicals) for 90 min at RT. After three washes with PBS-T for 15 min each, the membrane was developed using the enhanced chemiluminescence kit (Amersham Biosciences) and exposed to an X-ray film to allow visualization of antigenic proteins.

Glycoprotein detection assays

In preparation for glycoprotein assays, bacterial proteins were resolved on SDS-PAGE and electroblotted onto a PVDF membrane as described above. Glycoproteins were detected using an immunoblot kit from Bio-Rad Laboratories (catalog no. 170-6490) according to the manufacturer's instructions. The membranes were washed with PBS (9 mM NaH2PO4, 27 mM NaCl, pH 7.2) for 10 min at RT, and immersed in sodium acetate/EDTA buffer containing sodium periodate (100 mM sodium acetate, 5 mM EDTA, 10 mM sodium periodate, pH 5.5) and incubated in the dark for 20 min at RT. The membranes were then washed three times with PBS, for 10 min each. A biotinylation solution was prepared immediately before use, by adding 2 μL hydrazide solution to 10 mL sodium acetate/EDTA buffer (without sodium periodate) and the membranes were immersed in this solution for 60 min at RT. The membranes were then washed three times, 10 min each at RT, with Tris-buffered saline (TBS: 50 mM Tris base, 27 mM NaCl, pH 7.2) and incubated for 30 min at RT with blocking solution (dissolve reagent 0.5 g provided product in 100 mL TBS) and washed three times with TBS for 10 min each at RT. Streptavidin–alkaline phosphatase conjugate was prepared and the membranes were incubated in this solution for 60 min at RT, and were again washed with TBS. Gentle agitation was applied to the membranes throughout the procedure, except during the development of the reaction. The developer was prepared immediately before use by mixing together nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate, according to manufacture's specifications. The membranes were incubated in this solution at RT until the required reaction intensity was achieved. The reaction was stopped by rinsing the membrane several times in ddH2O.

Experimental challenges

Duplicate groups of fish (n=15 per group) were intraperitoneally injected with 4 × 108 CFU of randomly selected S. iniae and S. parauberis isolates (or a TSB control). Olive flounder (20±2 cm in length) were purchased from a commercial aquaculture farm, and were determined to be free of streptococcal infection by conducting the above-mentioned microbiological tests and multiplex PCR analysis. The challenge room was maintained at 24±1 °C. Fish were maintained in 200-L fiberglass-reinforced plastic aquaria supplied with flow-through seawater, and were subjected to 12-h light/dark cycles. Fish were monitored daily (for a total of 15 days after challenge) for clinical signs of disease and mortality. Moribund and dead fish were removed twice daily, and bacterial samples were cultured at 25 °C for 24 h on sheep blood agar obtained from head kidneys. Isolates were identified using multiplex PCR, as described above.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Identification of the streptococcal agents of olive flounder

Bacterial isolates were collected from olive flounder exhibiting clinical signs of streptococcosis. General microbiological examinations revealed that the isolates were nonmotile, Gram-positive cocci, with no catalase or oxidase activities. Hemolytic analysis showed that 65 isolates were β-hemolytic, whereas 86 isolates were α-hemolytic. The β-hemolytic and α-hemolytic isolates were identified as S. iniae and S. parauberis, respectively, via multiplex PCR (Fig. 1).

image

Figure 1.  Multiplex PCR assays of Streptococcus iniae and Streptococcus parauberis. Lanes: M, 100 bp DNA ladder; 1, mixed template (DNA from S. iniae, S. parauberis, and Lactococcus garvieae); 2, negative control; 3, group A (S. iniae); 4, group B (S. parauberis).

Download figure to PowerPoint

Biochemical characterization of streptococcal isolates

Biochemical analyses revealed consistent patterns in most S. iniae isolates (e.g. positive reactions on the PYRA, PAL, and LAP tests and negative reactions on the VP, HIP, ESC αGAL, βGUR, βGAL, ARA, SOR, LAC, INU, and RAF tests). In addition, variable reactions were observed on the ADH, RIB, MAN, TRE, AMD, and GLYG tests. Most S. parauberis isolates displayed positive reactions to VP, LAP, and TRE and negative reactions to αGAL, βGUR, βGAL, PAL, ARA, RAF, AMD, and GLYG. However, S. parauberis isolates displayed variable reactions to HIP, ESC, PYRA, ADH, RIB, MAN, SOR, LAC, and INU (Table 3).

Table 3.   Biochemical characteristics of Streptococcus iniae and Streptococcus parauberis from diseased olive flounder using olive flounder*
 S. iniaeS. iniae ATCC29178 Buller (2004)S. parauberisS. parauberis (Dong-bo)
  • *

    Following analysis using API 20 strep kits, isolates were identified as either Streptococcus iniae or Streptococcus parauberis by multiplex PCR.

  • Percent positive reactions are shown in parentheses.

  • Cat, catalase; Oxi, oxidase; Hem, hemolysis; VP, Voges–Proskauer; HIP, hipuric acid; ESC, esculin; PYRA, pyrrolidonyl arylamidase; αGAL, α-galactosidase; βGUR, β-glucuronidase; βGAL, β-galactosidase; PAL, alkaline phosphatase; LAP, leucine aminopeptidase; ADH, arginine dihydrolase; RIB, ribose; ARA, arabinose; MAN, mannitol; SOR, sorbitol; LAC, lactose; TRE, trehalose; INU, inulin; RAF, rafinose; AMD, amidon; GLYG, glycogen; −, negative reaction; +, positive reaction.

Cat0 (0%)0 (0%)
Oxi0 (0%)0 (0%)
Hemβ (100%)βα (100%)α
VP0 (0%)86 (100%)+
HIP0 (0%)59 (68.6%)+
ESC2 (3.1%)+65 (80%)+
PYRA65 (100%)+6 (6.9%)
αGAL0 (0%)0 (0%)
βGUR1 (1.5%)0 (0%)
βGAL0 (0%)0 (0%)
PAL65 (100%)+1 (1.2%)+
LAP65 (100%)+86 (100%)+
ADH7 (10.8%)+44 (51.2%)+
RIB50 (76.9%)40 (46.5%)+
ARA0 (0%)1 (1.2%)
MAN45 (69.2%)75 (87.2%)+
SOR0 (0%)58 (67.4%)+
LAC0 (0%)27 (31.3%)
TRE62 (95.4%)+86 (100%)+
INU0 (0%)52 (60.5%)+
RAF0 (0%)1 (1.2%)
AMD48 (73.8%)+0 (0%)
GLYG37 (56.9%)+1 (1.2%)

SDS-PAGE and immunoblot profiling

We performed SDS-PAGE and immunoblot assays to compare the proteomic and antigenic profiles of the two types of streptococcal isolates (Fig. 2). The SDS-PAGE profiles of the S. iniae isolates consisted of eight major bands, with approximate molecular weights (MWs) of 65, 60, 48, 46, 44, 35, 32, and 26 kDa. The S. parauberis isolates exhibited five major bands, with approximate MWs of 46, 43, 35, 26, and 23 kDa.

image

Figure 2.  SDS-PAGE analysis of whole-cell lysates from Streptococcus iniae and Streptococcus parauberis.

Download figure to PowerPoint

Immunoblot assays using anti-S. parauberis (Dong-bo) IgY antibody revealed a uniform antigenic pattern for S. iniae isolates (antigens with MWs of 83, 78, 53, 50, 46, 33, and 25 kDa were identified) (Fig. 3, lane 1). However, S. parauberis isolates exhibited three distinct antigenic profiles, in which major common antigens of 83, 52, 46, 33, and 25 kDa were identified (Fig. 3, lanes 2, 3 and 4). The S. parauberis isolates could be separated into three types, according to the presence of additional antigenic bands. The first pattern consisted of additional antigens with MWs of 72, 65, 42, and 22 kDa, whereas the second pattern consisted of additional antigens with MWs of 78, 40, 28, and 23 kDa. The third pattern consisted of additional antigens with MWs of 78, 55, and 42 kDa (Fig. 3, lanes 2, 3 and 4). The first, second, and third antigenic protein patterns were observed in 67, 18, and 1 isolate of S. parauberis, respectively.

image

Figure 3.  Immunoblot assays of whole-cell lysates from Streptococcus parauberis and Streptococcus iniae, using chicken anti-S. parauberis (Dong-bo) IgY antibody. Lanes: 1, antigenic profiles of S. iniae (65 isolates); 2, antigenic profiles of S. parauberis (67 isolates); 3, antigenic profiles of S. parauberis (18 isolates); 4, antigenic profile of S. parauberis (one isolate).

Download figure to PowerPoint

Glycoprotein detection assays

The glycoproteins of S. iniae and S. parauberis were examined for differences in their carbohydrate structures (Fig. 4). The glycoprotein profile of S. iniae was uniform, with a unique band of 28 kDa (Fig. 4, lane 1). With the exception of one isolate, all S. parauberis isolates exhibited two major glycoprotein bands of 26 and 30 kDa (Fig. 4, lane 2). The remaining S. parauberis isolate exhibited three major glycoprotein bands of 20, 25, and 28 kDa (Fig. 4, lane 3).

image

Figure 4.  Glycoprotein analysis of whole-cell lysates of Streptococcus iniae and Streptococcus parauberis. Lanes: 1, S. iniae (65 isolates); 2, S. parauberis (85 isolates); 3, S. parauberis (one isolate).

Download figure to PowerPoint

Experimental challenge

Mortality in the fish injected with S. iniae started after day 4 of the challenge, with none surviving past the sixth day. Fish injected with S. parauberis began to die 7 days after the challenge, with 26% survival on the final day of the experiment. No fish died in control groups (Fig. 5). The clinical signs of S. iniae infection included hemorrhagic septicemia, enterocele, exophthalmia, and erratic swimming. The clinical signs of S. parauberis infection included darkened body coloration and cachexia.

image

Figure 5.  Survival of olive flounder (%) after artificial infection with a TSB control (◆), 4 × 109 cells of Streptococcus iniae (▪) or 4 × 109 cells of Streptococcus parauberis (▴).

Download figure to PowerPoint

Microbiological analysis of the bacterial isolates collected from moribund or dead fish was positive for their respective groups, i.e. β-hemolytic for the S. iniae-infected group and nonhemolytic for the S. parauberis group. These isolates were further confirmed as S. iniae and S. parauberis, respectively, by multiplex PCR analysis.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Streptococcosis is associated with acute and chronic mortality in many aquaculture species. In this study, we obtained bacterial isolates from olive flounder exhibiting clinical symptoms of hemorrhagic septicemia, exophthalmia, and meningitis. All bacterial isolates (n=151) were nonmotile, Gram-positive cocci, with no oxidase or catalase activities. Similar symptoms and clinical signs are associated with warm-water streptococcosis (Doménech et al., 1996; Eldar et al., 1999) caused by L. garviae, S. parauberis, S. iniae, and S. difficilis (Muzquiz et al., 1999).

Phenotypic and biochemical characterizations (i.e. growth on blood agar and analysis using the API20 Strep kit, respectively) revealed the presence of two streptococcal species in infected olive flounder. However, the biochemical results obtained from the API 20 Strep kit were not consistent with those reported for S. parauberis (Baeck et al., 2006) and S. iniae (Shin et al., 2006). These variations may reflect differences in the number of isolates tested, geographical locations, or physiochemical factors (e.g. temperature and salinity). On the other hand, RNA sequencing is a powerful method for analyzing phylogenic interrelationship in Streptococcus species. The 16S rRNA gene sequence of S. iniae and S. parauberis is reported to have 98.1% homology (Bentley et al., 1991). However, the high homology was suspected to be due to the difference in the pathogenicity: S. iniae showed acute mortality, but S. parauberis demonstrated a chronic pattern. Further investigation on the relationships between S. iniae and S. parauberis by rRNA might be needed with the isolates. The inconsistencies in these biochemical tests and rRNA analysis reveal the inadequacies of currently appropriate identification methods. In the present situation, analysis via multiplex PCR revealed that 43% (65 of 151) and 57% (86 of 151) of the bacterial isolates were S. iniae and S. parauberis, respectively. These results are consistent with previous reports (Baeck et al., 2006), suggesting that S. parauberis may be the dominant strain responsible for streptococcosis of olive flounder in Korea.

Analysis of whole-cell protein profiles by SDS-PAGE has been suggested to be an efficient tool for differentiating various streptococcal species (Vandamme et al., 1998). Shin et al. (2006) reported several differences in the SDS-PAGE protein profiles of S. iniae and L. garvieae isolates from olive flounder. Similarly, in the present study, we observed differences in the whole-cell protein profiles of S. iniae and S. parauberis isolates. Immunoblot assays were performed to compare the antigenic protein profiles of whole-cell bacterial lysates using anti-S. parauberis (Dong-bo) chicken IgY. This assay provides useful information on similarities and differences between various bacterial isolates (Schade et al., 2000), and will assist in the development of an effective vaccine. The results of our immunoblot assays revealed several common and species-specific antigenic bands, which were used to distinguish the S. iniae and S. parauberis isolates. However, S. parauberis isolates exhibited three distinct antigenic patterns (Fig. 3). This serological heterogeneity may reflect differences in the virulence of the isolates. We are currently investigating possible virulence differences between serologically heterogeneous S. parauberis isolates, to assist in the development of an effective vaccine.

Glycoproteins vary considerably between bacterial species and protect against cell death (mediated either by attack from normal and immune sera or by phagocytosis). In addition, glycoproteins mediate attachment to host cells (Hansmeier et al., 2004). We observed several distinct differences in the glycoprotein patterns of S. iniae and S. parauberis. Variations in glycoproteins may reflect differences in the pathogenic characteristics of S. iniae (which causes an acute infection) and S. parauberis (which causes a chronic infection). However, we cannot presently confirm this hypothesis.

The experimental challenge revealed that S. iniae and S. parauberis differ with respect to virulence and clinical signs. Infection with S. iniae proceeds faster in olive flounder than does infection with S. parauberis. In addition, S. iniae induces the typical clinical signs of streptococcosis (Roberts, 2001), whereas S. parauberis infections manifest as darkened body surfaces and cachexia. We propose that the pathogenic variations reflect differences in virulence factors and pathogenic mechanisms used by the bacteria; such differences have not been examined in previous studies. Thus, further studies should investigate virulence factors and pathogenic mechanisms used by streptococcal species.

Here, we characterized S. iniae and S. parauberis isolates from diseased olive flounder using microbiological and biochemical tests, multiplex PCR, SDS-PAGE, immunoblot analysis, and glycoprotein assays. Our results strongly indicate that S. parauberis is an emerging pathogen causing streptococcosis in cultured olive flounder in Korea. Further examination of the virulence of serologically heterogeneous S. parauberis isolates is currently underway, in an effort to develop effective vaccines against streptococcosis in olive flounder.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

This research was supported by grant E00424 from the Korean Research Foundation.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  • Baeck GW, Kim JH, Gomez DK & Park SC (2006) Isolation and characterization of Streptococcus sp. from diseased flounder (Paralichthys olivaceus) in Jeju Island. J Vet Sci 7: 5358.
  • Bentley RW, Leigh JA & Collins MD (1991) Intrageneric structure of Streptococcus based on comparative analysis of small-subunit rRNA sequences. Int J Syst Bacteriol 41: 487494.
  • Bromage ES, Thomas A & Owens L (1999) Streptococcus iniae, a bacterial infection in barramundi Lates calcarifer. Dis Aquat Organ 31: 177181.
  • Buller NB (2004) Bacteria from Fish and Other Aquatic Animal. CABI Publishing, London.
  • Chang PH, Lin CW & Lee YC (2002) Latococcus garvieae infection of cultured rainbow trout, (Oncorhynchus mykiss) in Taiwan and associated biophysical characteristics and histopathology. Bull Eur Assn Fish P 22: 319327.
  • Creeper JH & Buller NB (2006) An outbreak of Streptococcus iniae in barramundi (Lates calcarifera) in freshwater cage culture. Aust Vet J 84: 408411.
  • Diler O, Altun S, Adiloglu AK, Kubilay A & Isikli B (2002) First occurrence of streptococcosis affecting farmed rainbow trout (Oncorhynchus mykiss) in Turkey. Bull Eur Assn Fish P 22: 2126.
  • Doménech A, Fernández-Garayzábal JF, Pascual C, García JA, Cutuli MT, Moreno MS, Collins MD & Domínguez L (1996) Streptococcosis in cultured turbot (Schophtalmus maximus) associated with Streptococcus parauberis. J Fish Dis 19: 3338.
  • Eldar A, Frelier PF, Asanta L, Varner PW, Lawhon S & Bercovier H (1995) Streptococcus shiloi, the name for an agent causing septicemic infection in fish, is a junior synonym of Streptococcus iniae. Int J Syst Bacteriol 45: 840842.
  • Eldar A, Perl S, Frelier PF & Bercovier H (1999) Red drum (Sciaenops ocellatus) mortalities associated with Streptococcus iniae infection. Dis Aquat Organ 36: 121127.
  • Facklam RR & Elliott JA (1995) Identification, classification and clinical relevance of catalase-negative, gram-positive cocci, excluding the streptococci and enterococci. Clin Microbiol Rev 8: 479495.
  • Ghittino C & Prearo M (1992) Report of streptococcosis in rainbow trout (Oncorhynchus mykiss) in Italy: preliminary note. Soc Ital Pathol Ittica Bull 8: 411.
  • Hansmeier N, Bartels FW, Ros R, Anselmetti D, Tauch A, Pühler A & Kalinowski J (2004) Classification of hyper-variable Corynebacterium glutamicum surface-layer proteins by sequence analyses and atomic force microscopy. J Biotechnol 112: 177193.
  • Kitao T (1993) Streptococcal infections. Bacterial Disease of Fish (InglisV, RobertsRJ & BromageNR, eds), pp. 196210. Blackwell Scientific Publications, Oxford.
  • Kusuda R, Kawai K, Toyoshima T & Komatsu I (1976) A new pathogenic bacterium belonging to the genus Streptococcus, isolated from epizootic of cultured yellowtail. B Jpn Soc Sci Fish 42: 13451352.
  • Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685.
  • Mata AI, Gibello A, Casamayor A, Blanco MM, Domínquez L & Fernández-Garayzábal JF (2004) Multiplex PCR assay for detection of bacterial pathogens associated with warm-water streptococcosis in fish. Appl Environ Microb 70: 31833187.
  • Muzquiz JL, Royo FM, Ortega C, De Blas I, Ruiz I & Alonso JL (1999) Pathogenicity of streptococcosis in rainbow trout (Orcorhynchus mykiss): dependence on age of diseased fish. Bull Eur Assn Fish P 19: 114119.
  • Nakatsugawa T (1983) A streptococcal disease of cultured olive flounder. Fish Pathol 17: 281285.
  • Perera RP, Johnson SK, Collins MD & Lewis DH (1994) Streptococcus iniae associated with mortality of Tilapia nilotica X T aurea hybrids. J Aquat Anim Health 6: 335340.
  • Roberts RJ (2001) The bacteriology of teleosts. Fish Pathology (RobertsRJ, ed), pp. 297331. W. B. Saunders Publishing, London.
  • Romalde JL, Ravelo C, Valdes I, Magarinos B, De La Fuente E, Martin CS, Avendano-Herrera R & Toranzo AE (2008) Streptococcus phocae, an emerging pathogen for salmonid culture. Vet Microbiol 130: 198207.
  • Schade R, Behn I, Erhard M, Hlinak A & Staak C (2000) Chicken Egg Yolk Antibodies, Production and Application: IgY-Technology. Springer-Verlag, Berlin.
  • Shin GW, Palaksha KJ, Yang HH et al. (2006) Discrimination of streptococcosis agents in olive flounder (Paralichthys olivaceus). Bull Eur Assn Fish P 26: 6879.
  • Vandamme P, Torck U, Falsen E, Pot B, Goossens H & Kersters K (1998) Whole-cell protein electrophoretic analysis of viridans streptococci: evidence for heterogeneity among Streptococcus mitis biovars. Int J Syst Bacteriol 48: 117125.
  • Yuasa K, Kitancharoen N, Kataoka Y & Abduljalil Al-Murbaty F (1999) Streptococcus iniae the causative agent of mass mortality in Rabbitfish Siganus canaliculatus in Bahrain. J Aquat Anim Health 11: 8793.
  • Zlotkin A, Eldar A, Ghittino C & Bcovier H (1998) Identification of Lactococcus garvieae by PCR. J Clin Microbiol 36: 983985.