SEARCH

SEARCH BY CITATION

Keywords:

  • Group A Streptococcus;
  • M49;
  • bacteriophage;
  • virulence;
  • integrase

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacteriophages are common autonomous migrating mobile genetic elements in group A Streptococcus (GAS) and are often associated with the carriage of various virulence genes, including toxins, mitogens and enzymes. Two collections of GAS type M49 strains isolated from invasive (22 strains) and noninvasive (16 strains) clinical cases have been studied for the presence of phage and phage-associated virulence genes. All the GAS strains carried from at least two to six phage genomes as determined by the number of known phage integrase genes found. A sampling of the invasive M49 strains showed that they belonged to the same multilocus sequence typing type, carried two specific integrase genes (int5 and int7), and contained the toxin genes speA, speH and speI. Other invasive strains lacking this gene profile carried the prophage integrating in mutL–mutS region and inducing the ‘mutator’ phenotype. We suggest that this specific phage-related virulence gene constellation might be an important factor increasing M49 GAS pathogenicity.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Streptococcus pyogenes, the group A streptococci (GAS), are the cause of a variety of severe diseases and have been the target of intensive molecular biological studies in recent years. The genomes of 13 different GAS strain have been completely sequenced, including strains isolated from patients with invasive diseases (M1, M3, M3, M28), noninvasive diseases (M1, M2, M4, M6, M12, M12), rheumatic fever (M5, M18) and acute post-streptococcal glomerulonephritis (M49) (Ferretti et al., 2001, 2004; Beres et al., 2002, 2006; Smoot et al., 2002; Nakagawa et al., 2003; Banks et al., 2004; Green et al., 2005; Sumby et al., 2005; Holden et al., 2007; McShan et al., 2008; Scott et al., 2008). An important feature of all the GAS genomes sequenced to date is the presence of between two and eight complete and partial bacteriophage genomes integrated into the host chromosome and representing up to 12% of the total GAS genome (Ferretti et al., 2004). These phages also contain virulence-associated genes that are known to encode pyrogenic exotoxins and superantigen-stimulating products (McShan & Ferretti, 2007). Phage genomes are mobile genetic elements and as such, are the primary means of horizontal gene transfer in the GAS. While every GAS prophage identified by genome sequencing has unique features, certain genes such as integrases, hyaluronidases, some structural genes and virulence genes show considerable sequence identity or conservation as well as a specific integration site on the host genome. These conserved elements shared by different phages can enhance recombinational events and contribute significantly to phage diversity, overall genome plasticity and evolution.

Among the 13 different sequenced GAS genomes, 58 phage genomes have been identified as integrated into the chromosome. Each phage has a specific integration site sequence with integration sites at various locations on the GAS genome. So far, 18 different sites have been identified among the various genomes, with several phages targeting a common integration site (Beres & Musser, 2007). The recently sequenced M49 strain was shown to contain three phage genomes, with two of the integration sites being unique and the third occurring at a commonly used site for integration (dTDP-glucose-4,6-dehydratase) (McShan et al., 2008; Scott et al., 2008). To determine whether M49 strains were less likely to contain phage genomes as well as their associated virulence genes, we employed PCR analysis with 51 total GAS strains, including 38 type M49 strains for the presence of phage and phage-associated virulence genes. The M49 strains consisted of a group of strains obtained from six different countries during the 1960–1980 time periods and another group of strains obtained from a narrow geographical region collected in the early 2000s. The results show that all M49 strains of GAS contained bacteriophage genomes, and that the two collections under study showed considerable variation in phage and virulence-associated gene content.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains

Strains employed in these studies included GAS strains from the University of Oklahoma collection (Table 1, collection I), of which 16 strains were serotype M49 and obtained from six different countries during the time period of 1950–1980. A second group (collection II) of 22 different M49 GAS strains was kindly provided by Bernard Beale from the Centers for Disease Control, Atlanta, GA, and were strains collected in the USA during a 6-year period from 2000 to 2006. The M type of each GAS strain was confirmed by emm sequencing according to the recommendations of CDC (http://www.cdc.gov/ncidod/biotech/strep/M-ProteinGene_typing.htm). Three non-M49 GAS strains, M1 (SF370), M3 (MGA315) and M6 (MGA10394), were completely sequenced genomes and were used as templates for making DNA probes. All bacterial strains were grown in Todd–Hewitt broth supplemented with 2% yeast extract overnight at 37 °C.

Table 1.   GAS strains used for phage gene analysis (collection I and II)
Strain NM serotypeOriginYearCase
Noninvasive GAS M49 (collection I)
149New Zealand1965AGN
2 (NZ131)49New Zealand1965AGN
349New Zealand1966Scarlet fever
449New Zealand1965Scarlet fever
549England1956Scarlet fever
649England1957Scarlet fever
749England1954Scarlet fever
849New Zealand1964Scarlet fever
949New Zealand1966Scarlet fever
1049New Zealand1965Scarlet fever
1149New Zealand1965Pharyngitis
1249New Zealand1966Scarlet fever
1349Denmark1967Sore throat
1449Japan1976Sore throat
1549USSR1977Scarlet fever
1649Thailand1970Scarlet fever
Invasive GAS M49 (collection II)
149California2004Sepsis
249California2002Sepsis
349California2002Sepsis
449California2002Sepsis
549California2002Sepsis
649Minnesota2002Sepsis
749California2003Sepsis
849California2003Sepsis
949California2003Sepsis
1049California2003Sepsis
1149California2003Sepsis
1249California2004Sepsis
1349Minnesota2004Sepsis
1449California2004Sepsis
1549Oregon2000Sepsis
1649Minnesota2000Sepsis
1749California2005Surgical material
1849California2005Sepsis
1949California2005Sepsis
2049California2005Sepsis
2149California2005Sepsis
2249California2003Sepsis
  1. AGN, acute glomerulonephritis.

Control GAS strains
MGAS103946 USAInvasive
SF3701 USAInvasive
MGA3153 USAInvasive

Molecular genetic studies

PCR primers (Table 2) were designed to the known sequences of GAS bacteriophage genes deposited in GenBank using the primer3 web server (Rozen & Skaletsky, 2000), including speA, speC, speC/J, speK, speL, speI, speH, ssa, sla, sdn, sdaD, mf2, mf3, mf4, majH and majT. Three GAS strains with completely determined sequences were used as source of phage gene templates. Primers corresponding to the paratoxin gene as well as lysin and holin genes, which flank many phage toxin genes in GAS (Aziz et al., 2005), were used for the search of novel phage-related virulence factors. All PCR results were performed in duplicate; DNA from the genome strains was used to provide positive or negative controls for each reaction, based upon prophage carriage. In addition, DNA primers for the chromosomally located C5a peptidase gene were used as a positive control. GAS multilocus sequence typing (MLST) was performed on eight randomly selected invasive strains NN 4, 5, 8, 12, 14, 17, 18 and 22 (Table 1, collection II) as described previously (Enright et al., 2001) using the online Streptococcus pyogenes database query tool for data analysis (http://spyogenes.mlst.net).

Table 2.   PCR primers used for the analysis of streptococcal bacteriophages
GeneGene productPrimer sequenceProduct sizeGenBank accession number
  • *

    sdaD1 primers were designed after sequencing of streptodornase gene from the strain SF268 (collection I). sdaD1 gene is homologous but slightly different from sdaD.

  • attB, bacteriophage attachment site.

Phage toxins and virulence genes
speAfToxin A3tcgcaagaggtatttgctca336SpyM3_1301
speAracccctccgtagatacatgc  
speCfEnterotoxin Ctgcagggtaaatttttcaacg200M6_Spy1196
speCrgcaggcgtaattcctccata  
speC/JfToxin C variant Jttgccattgatcgcaattt346SPy0436
speC/Jrttgattctgaggtcgagagc  
speK/LfToxin C variant L, Kgtgtgtctaatgccaccgtct565Spy0985
speK/Lrggaacatatatgctcctagat  
speL/MfToxin L/Mggaaaaagagggacgcaagt334SPY560764
speL/Mrcctggaaggtaacgggagat  
speIfEndotoxin Iccgccattttcaggtagttt400SPy1007
speIragcggccaaaatctttaaca  
speHfEnterotoxin Hgtgaatgtccagggaaaagg310SPy1008
speHrttaaagtctccattgccaaaa  
ssafSuperantigentgatcaaatattgctccaaggtg502SpyM3_0920
ssartccacaggtcagcttttacag  
speGfEndotoxin Gaccccatgcgattatgaaaa310Spy0212
speGrgaacaacctcagagggcaaa  
slafPhospholipase A2gtggttttggcaaccttgat310M6_Spy0983
slarggaaaatggcactgaaagtga  
Streptodornases
sdnfStreptodornaseaacgttcaacaggcgcttac489M6_Spy0067
sdnraccccatcggaagataaagc  
sdaDfStreptodornase Daaagctttgccctactgtcatc408SF268*
sdaDrcagtgtggcttgctattgattt  
sdaD1fStreptodornase D1agtatcgagcaacaccccaat228SF268*
sdaD1rgccagcagacatgtcaatcat  
mf2fMitogenic factor 2tatccgaatgtatcccatgcaa365Spy0712
mf2rttgctgtcatttgctcctgaat  
mf3fMitogenic factor 3cggcttaaatgacgagccta343Spy1436
mf3rtcctgtttggtaatccaattca  
mf4fMitogenic factor 4ggacattagaaacttccccaaa487SpyM3_1095
mf4rccttggtatattggcattgctt  
Other genes
majHfMajor capsid proteintcttggcagccttagcctta310Spy0688
majHrttaggtgctaccgaggttgg  
majTfMajor tail proteintttagtttcttcgccgttgg279M6_Spy1556
majTrgaagccatggaaaaaggtga  
Phage integrases
int-1fIntegrase 1atatgctcgattgggacacc419SpyM3_1354 (conserved hypothetical protein attB)
int-1ragcgaggtagctggcataaa 
int-2fIntegrase 2gtgtggcccagtgctttact435SpyM3_0681 (lepA attB)
int-2rtggtcttcgtagaggggaga 
Int-3fIntegrase 3cttttaaaggggcaccacaa413Spy0655 (dipeptidase attB)
Int-3raacaacggcttggaaaacac 
int-4fIntegrase 4tagatgaatggtgggcgttt435Spy1488 (conserved hypothetical SPy1487 attB)
Int-4rcagcttcaccgatacgacaa 
int-5fIntegrase 5ctgggcaacgtcttcaaagt420Spy0937 (dTDP-glucose-4,6-dehydratase attB)
int-5rgaaaaagacacgccacgaat 
int-6fIntegrase 6taaagcgttcaatccctgct468Spy2122 (mutL attB)
int-6ragcagccaaacgctaagaaa 
int-7fIntegrase 7gcaatagccattttcgtggt427M6_Spy1026 (tmRNA attB)
int-7raacaatccagctttgccaat 
int-8fIntegrase 8ccgcctcaaatagcaatgat343M6_Spy0020 (recO attB)
int-8ragaattggtgaggctgttgc 
int-49fIntegrase M49 specifictcagcttacggtaaagcctcag400Spy49_0370 (conserved hypothetical protein Spy49_1532 attB)
   
PCR hybridization control
scpAfC5a peptidasetttttgtttcgtctggaaggt677Spy2010
scpArctgaggaagcaccatcatcatc  
Tox–paratox region
holHolinaccatcaaacatcgcggatatt M6_Spy0063
ptxParatoxin geneaacataatcaaaaatctgtccgt M6_Spy1540
lys1Lysinttagataaggaggacagatgacct M6_Spy0065
lys2Lysin 2aggtcatctgtcctccttatctaa M6_Spy0065

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The results of PCR analysis of GAS M49 strains obtained from both collections I and II with gene probes from 10 novel phage-associated toxins, streptodornases and mitogenic factors, and unique regions of integration genes of nine different phages are presented in Figs 1 and 2. Between the two collections of M49 strains, there were no strains without bacteriophage genes. The most prevalent integrase genes found were int7 and int5 [tmRNA and dTDP-glucose-4,6-dehydratase attachment sites (attB), respectively] while the int2 gene was least likely to be present (lepA attB). Surprisingly, int1, int2, int3 and int4 were found in none of the collection II strains. The genes of toxins speA, speH, speG and speI [speA: 56% (I)–86% (II), speH: 45% (I)–64% (II), speG: 100% (I)–96% (II), speI: 31% (I)–86% (II); Fig. 2] were the most common in the two collections of M49 strains, whereas the presence of speK/L genes was quite low. Among the streptodornase and mitogenic factor genes, the most common finding in the noninvasive strains was mf3 (50%), whereas sdn and sla were rare or not present.

image

Figure 1.  Distribution of Bacteriophage Attachment Site Usage in M49 Strains. The use of previously observed attachment sites by prophages in the historic M49 strains (collection I) and the recent M49 strains (collection II) is presented. In general, the distribution of prophages is more diverse in collection I, and the narrow distribution in collection II argues for the appearance of a recent group of related strains.

Download figure to PowerPoint

image

Figure 2.  Percentage of M49 strains containing phage-associated virulence factor genes. The distributions of virulence-associated genes in the M49 historic noninvasive strains (collection I) and in the recent invasive M49 strains (collection II) are shown. Neither collection contained strains containing the sdn or sla genes. The circle show the most common virulence genes profile found in the invasive strains belonging to collection II.

Download figure to PowerPoint

PCR analysis employing primers against the paratoxin gene in pair with the phage holin and lysin genes was accomplished using long PCR conditions with completely various outcomes. DNA primers to the ptx gene were employed in different sets of PCR with the second primer corresponding to the lysin or holin genes and resulted in PCR products of different sizes, ranging from 1 to 4 kb (data not shown). Sequence analysis revealed that the prophage genomes contained the streptodornase gene sdaD (Podbielski et al., 1996). This gene sequence was further used for PCR analysis of the two strain collections, which revealed that four strains in the first collection and majority of the strains from the second collection contained sdaD (Fig. 2).

In addition to the genes studied for the analysis of the collection II strains, we included the DNA primers corresponding to int49 (integrase gene found in strain NZ131 and targeting gene+Spy49_1532) and mutL, the integration site for int6 (Canchaya et al., 2002). The int49 gene proved to be rare among these strains, suggesting that this phage may have a limited geographical distribution or indeed may have recently evolved. In the collection II strains, the int6 gene associated with phages targeting the mismatch repair protein MutL gene was found in 18% of the strains, which exactly mirrored the ability to detect the prophage-free attachment site in the remaining strains (82%). This percentage was very close to that seen in a previous survey of multiple M types (McShan et al., 2008; Scott et al., 2008), and these results suggest that 20% of these strains may have the phage-associated mutator phenotype found in GAS (McShan et al., 2008; Scott et al., 2008).

MLST typing of GAS M49 invasive strains

Eight GAS M49 strains from collection II (no. 4, 5, 8, 12, 14, 17, 18 and 22) were selected for MLST analysis. All these invasive GAS strains were isolated in California between 2002 and 2005. A majority of the invasive strains had similar phage gene profiles and carried int5, int7, speI, speH and speA genes. Seven strains with this phage gene profile (no. 4, 5, 12, 14, 17, 18 and 22) were selected for MLST analysis. Strain no. 8 had a different phage gene profile without int7, speA or speI genes, but with int6 associated with the mutator phenotype. Most of the strains were found to be of the same MLST type: strains NN 4, 5, 12, 14, 17, 18 and 22 belonged to ST type ST433 (allelic profile 4-6-2-54-21-7-69). Strain N8, by contrast, was MLST ST432 with profile 4-2-2-23-39-2-1. Both profiles are commonly associated with serotype M49 strains.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The major goal of this study was to assess the possible correlation between specific phage content and virulence-associated genes in the M49 serotype of GAS strains. Previous studies regarding GAS strains of serotypes 1 and 3 suggested a degree of correlation between specific phage gene profiles and pathogenic features of the strains (Beres et al., 2002; Aziz et al., 2005; Sumby et al., 2005). The M49 GAS serotype was chosen for the present analysis because strains belonging to the nephritogenic group of strains by organization of the mga regulon have been poorly studied. An epidemiological report on the M49GAS strains from Japan demonstrated a recent appearance of invasive strains of this serotypes (Ikebe et al., 2004). In this respect it was of interest to compare recently collected invasive M49 strains with M49 strains which were predominantly the cause of scarlet fever, sore throat or acute glomerulonephritis (AGN). Additionally, the recent availability of the complete genome sequence of strain NZ131, an M49 strain of GAS, showed that this strain contained only two complete and one partial bacteriophage genomes, a low phage burden compared with most of the other sequenced strains, with M12 strain MGAS2096 as the other strain with few phages (two). One of these prophages in NZ131 integrates into the 3′-end of the dTDP-glucose-4,6-dehydratase gene; a site occupied by a prophage in several of the GAS genome strains (SF370, Manfredo, MGAS10750, MGAS10270 and MGAS9429). The other complete prophage is integrated into the 5′-end of conserved hypothetical protein Spy49_1532, the first observation of this attachment site in the genomes (McShan et al., 2008; Scott et al., 2008).

Temperate phages integrate into specific DNA sequences on the bacterial chromosome (attB) by site-specific recombination. The importance of these sites is twofold: they provide a picture of the phage populations shared between strains of streptococci, and the integration of the prophage can lead to altered gene expression in the host bacteria, either through the addition of prophage-associated genes (toxins) or through the interruption of host genes following integration (McShan & Ferretti, 2007). The results of the present study indicate that phage presence is ubiquitous among the M49 strains analyzed, with between two and six phage genomes present in each strain. The most prevalent phage attB sites for integrase genes were int5 (dTDP-glucose-4,6-dehydratase), int6 (mutL) and int7 (tmRNA, the attachment site for phage 12 (McShan et al., 1997). By contrast, the least prevalent sites for prophage occupation were int1 (conserved hypothetical protein SpyM3_1355), int2 (lepA), int3 (dipeptidase gene) and int4 (conserved hypothetical SPy1487). The attB site for integrase gene int8 (recO) was not found in any of the M49 strains. Additionally, there did not appear to be any new specific correlation between phage and virulence-associated gene presence because speA, speH and speI were all commonly associated with the above-mentioned phage genomes.

The most prominent difference of results found in this study was between the two M49 collection of strains; collection I obtained from six different countries during the 1960–1980 time period and representing a broad range of diseases, and collection II obtained from a narrow geographical region in the United States (California) in 2000–2006 and all from cases of sepsis. Many of these strains had the same MLST type (ST433), suggesting that they had descended from a successful recent clone of GAS M49 strains. Whereas collection I strains contained representative phage integrase genes from most phages, collection II strains lacked any representatives from int1, int2, int3 and int4 genes. Further, notable changes in the carriage of toxin genes exist between the two collections [speA: 56% (I) vs. 86% (II); speC: 38% (I) vs. 0% (II); ssa: 19% (I) vs. 0% (II); and speI: 31% (I) vs. 86% (II)], emphasizing the differences in the M49 collections. The exotoxins speH and speI are sometimes clustered together on a single prophage genome (e.g. SF370). All the strains in collection II with the speH gene also carried speI in close proximity, a feature confirmed by PCR and DNA sequencing (data not shown). Of the toxins surveyed, speG was the most universally found in M49 strains, as is true of all of the sequenced GAS genome strains. However, the appearance of occasional strains lacking speG is not without precedence, because a previous survey also has observed such atypical strains (Luca-Harari et al., 2008). Attachment sites dTDP-glucose-4,6-dehydratase and tmRNA (int5 and int7, respectively) were the most frequently used in the strains from collection II (Fig. 1). The streptodornase gene, originally described in M49 strains by Podbielski et al. (1996) was also prevalent among all of the M49 strains. Taken together, the molecular genetic studies of phage related virulence genes suggests the possibility that the invasive phenotype of the M49 strains in collection II might reflect the occurrence of two phages carrying integrases (int5 and int7) together with toxin genes speA, speG, speH and speI.

The presence of prophages occupying the mutL attachment site, which can result in a mutator phenotype, was found in 18% of the strains from collection II. The frequency of these prophages may reflect the general trend in bacteria from natural populations (both pathogenic and nonpathogenic) to become mutators and possibly enhance their survival during sudden challenges such as antimicrobial therapy (Matic et al., 1997; Radman et al., 2000).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported in part by grant of RFFI 06-04-48949. The authors would like to thank Dr A. Totolian for helpful discussion on these results. We acknowledge the use of the S. pyogenes MLST database that is located at Imperial College London, and is also funded by the Wellcome Trust.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Aziz RK, Edwards RA, Taylor WW, Low DE, McGeer A & Kotb M (2005) Mosaic prophages with horizontally acquired genes account for the emergence and diversification of the globally disseminated M1T1 clone of Streptococcus pyogenes. J Bacteriol 187: 33113318.
  • Banks DJ, Porcella SF, Barbian KD, Beres SB, Philips LE, Voyich JM, DeLeo FR, Martin JM, Somerville GA & Musser JM (2004) Progress toward characterization of the group A Streptococcus metagenome: complete genome sequence of a macrolide-resistant serotype M6 strain. J Infect Dis 190: 727738.
  • Beres SB & Musser JM (2007) Contribution of exogenous genetic elements to the group A Streptococcus metagenome. PLoS ONE 2: e800.
  • Beres SB, Sylva GL, Barbian KD et al. (2002) Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype, and clone emergence. P Natl Acad Sci USA 99: 1007810083.
  • Beres SB, Richter EW, Nagiec MJ, Sumby P, Porcella SF, Deleo FR & Musser JM (2006) Molecular genetic anatomy of inter- and intraserotype variation in the human bacterial pathogen group A Streptococcus. P Natl Acad Sci USA 103: 70597064.
  • Canchaya C, Desiere F, McShan WM, Ferretti JJ, Parkhill J & Brussow H (2002) Genome analysis of an inducible prophage and prophage remnants integrated in the Streptococcus pyogenes strain SF370. Virology 302: 245258.
  • Enright MC, Spratt BG, Kalia A, Cross JH & Bessen DE (2001) Multilocus sequence typing of Streptococcus pyogenes and the relationships between emm type and clone. Infect Immun 69: 24162427.
  • Ferretti JJ, McShan WM, Ajdic D et al. (2001) Complete Genome Sequence of an M1 Strain of Streptococcus pyogenes. P Natl Acad Sci USA 98: 46584663.
  • Ferretti JJ, Ajdic D & McShan WM (2004) Comparative genomics of streptococcal species. Indian J Med Res 119 (suppl): 16.
  • Green NM, Zhang S, Porcella SF, Nagiec MJ, Barbian KD, Beres SB, Lefebvre RB & Musser JM (2005) Genome sequence of a serotype M28 strain of Group A Streptococcus: potential new insights into puerperal sepsis and bacterial disease specificity. J Infect Dis 192: 760770.
  • Holden MT, Scott A, Cherevach I et al. (2007) Complete genome of acute rheumatic fever-associated serotype M5 Streptococcus pyogenes strain manfredo. J Bacteriol 189: 14731487.
  • Ikebe T, Endo M, Ueda Y et al. (2004) The genetic properties of Streptococcus pyogenes emm49 genotype strains recently emerged among severe invasive infections in Japan. Jpn J Infect Dis 4: 187188.
  • Luca-Harari B, Ekelund K, Van Der Linden M, Staum-Kaltoft M, Hammerum AM & Jasir A (2008) Clinical and epidemiological aspects of invasive Streptococcus pyogenes infections in Denmark during 2003 and 2004. J Clin Microbiol 46: 7986.
  • Matic I, Radman M, Taddei F, Picard B, Doit C, Bingen E, Denamur E & Elion J (1997) Highly variable mutation rates in commensal and pathogenic Escherichia coli. Science 277: 18331834.
  • McShan WM & Ferretti JJ (2007) Bacteriophages and their contribution in the host cell phenotype. Bacteriophages: Genetics and Molecular Biology (McGrathS & Douwe vanSinderen, eds), 343 pp. Caister Academic Press, Norwich, UK.
  • McShan WM, Tang Y-F & Ferretti JJ (1997) Bacteriophage T12 of Streptococcus pyogenes integrates into the gene for a serine tRNA. Mol Microbiol 23: 719728.
  • McShan WM, Ferretti JJ, Karasawa T et al. (2008) Analysis of the complete genome sequence of NZ131, a highly transformable nephritogenic M49 strain of Streptococcus pyogenes. J Bacteriol 190: 77737785.
  • Nakagawa I, Kurokawa K, Yamashita A et al. (2003) Genome sequence of an M3 strain of Streptococcus pyogenes reveals a large-scale genomic rearrangement in invasive strains and new insights into phage evolution. Genome Res 13: 10421055.
  • Podbielski A, Zarges I, Flosdorff A & Weber-Heynemann J (1996) Molecular characterization of a major serotype M49 group A streptococcal DNase gene (sdaD). Infect Immun 64: 53495356.
  • Radman M, Taddei F & Matic I (2000) DNA repair systems and bacterial evolution. Cold Spring Harb Sym 65: 1119.
  • Rozen S & Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology (KrawetzS & MisenerS, eds), pp. 365386. Humana Press, Totowa, NJ.
  • Scott J, Thompson-Mayberry P, Lahmamsi S, King CJ & McShan WM (2008) Phage-associated mutator phenotype in group A Streptococcus. J Bacteriol 190: 62906301.
  • Smoot JC, Barbian KD, Van Gompel JJ et al. (2002) Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associated with acute rheumatic fever outbreaks. P Natl Acad Sci USA 99: 46684673.
  • Sumby P, Porcella SF, Madrigal AG et al. (2005) Evolutionary origin and emergence of a highly successful clone of serotype M1 group A Streptococcus involved multiple horizontal gene transfer events. J Infect Dis 192: 771782.