SEARCH

SEARCH BY CITATION

Keywords:

  • peptidoglycan hydrolase;
  • bacteriophage endolysin;
  • autolysin;
  • lysostaphin;
  • LysK;
  • coagulase-negative Staphylococcus

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

LysK is a staphylococcal bacteriophage endolysin composed of three domains: an N-terminal cysteine, histidine-dependent amidohydrolases/peptidases (CHAP) endopeptidase domain, a midprotein amidase 2 domain, and a C-terminal SH3b_5 (SH3b) cell wall-binding domain. Both catalytic domains are active on purified peptidoglycan by positive-ion electrospray ionization MS. The cut sites are identical to LytA (phi11 endolysin), with cleavage between d-alanine of the stem peptide and glycine of the cross-bridge peptide, and N-acetylmuramoyl-l-alanine amidase activity. Truncations of the LysK containing just the CHAP domain lyse Staphylococcus aureus cells in zymogram analysis, plate lysis, and turbidity reduction assays but have no detectable activity in a minimal inhibitory concentration (MIC) assay. In contrast, truncations harboring just the amidase lytic domain show faint activity in both the zymogram and turbidity reduction assays, but no detectable activity in either plate lysis or MIC assays. A fusion of the CHAP domain to the SH3b domain has near full-length LysK lytic activity, suggesting the need for a C-terminal binding domain. Both LysK and the CHAP-SH3b fusion were shown to lyse untreated S. aureus and the coagulase-negative strains. In the checkerboard assay, the CHAP-SH3b fusion achieves the same level of antimicrobial synergy with lysostaphin as the full-length LysK.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Staphylococci are Gram-positive pathogens that negatively impact both human and livestock health. Recent clinical estimates indicate that in 2005, multiple drug resistant forms of Staphylococcus aureus (methicillin-resistant S. aureus; MRSA) resulted in >94 000 serious infections and >18 000 deaths in the United States, a larger number than associated with deaths due to AIDS (Klevens et al., 2007). Multiple drug resistance is not unique to human pathogens. MRSA is also appearing in livestock outside the United States (bovine, porcine, and poultry) (Lee, 2003; Voss et al., 2005; Nunan & Price, 2007) as well as companion animals (dogs, cats, and horses) (Nunan & Price, 2007; Leonard & Markey, 2008). Regardless of antibiotic resistance phenotype, staphylococci are a persistent problem in the dairy industry resulting in an estimated loss of 2 billion dollars annually to US dairy producers (Sordillo & Streicher, 2002). In one animal study, S. aureus and coagulase-negative staphylococci (CoNS) were leading causes of bovine mastitis, accounting for >40% of all cases (Wilson et al., 1997). Conventional mastitis treatment (antibiotics), has been shown to be only marginally effective (Deluyker et al., 2005). Identifying novel antimicrobials to treat staphylococcal infections in both humans and animals, particularly antimicrobials that avoid resistance development, is essential to address this global problem.

Bacteriophage endolysins are a potential source of narrow-spectrum antimicrobials for treatment of antibiotic-resistant pathogens. Phage endolysins are normally produced at the end of the bacteriophage lytic cycle to degrade the host cell wall peptidoglycan, allowing turgor pressure to rupture the cell membrane and release nascent viral progeny (Loessner, 2005). When exposed exogenously to the target pathogen, endolysins can degrade the Gram-positive peptidoglycan and cause exolysis (or ‘lysis from without’). The peptidoglycan structure is highly conserved within any given genus, but can have species-specific changes (Schleifer & Kandler, 1972). As a result, peptidoglycan hydrolases are often genus specific, if not species specific (Loessner, 2005; Borysowski et al., 2006). Because of the near species specificity of these peptidoglycan hydrolases, phage endolysins represent a novel class of antimicrobials that might be useful in avoiding broad-range antibiotic use, often associated with resistance development (Spratt, 1994). Phage lysins have the further advantage that they may be refractory to resistance development, as no bacterial strains resistant to their phage endolysins have been identified despite repeated attempts to find them (Loeffler et al., 2001; reviewed in Fischetti, 2005).

Previous work has shown that LysK, the recombinant endolysin from the staphylococcal phage K (O'Flaherty et al., 2004), when added exogenously, is able to lyse agriculturally relevant staphylococci as well as clinically relevant MRSA (O'Flaherty et al., 2005). LysK has also been shown to be synergistic with the bacteriocin lysostaphin to inhibit S. aureus growth (Becker et al., 2008). In this study, LysK cut sites in S. aureus peptidoglycan were determined via positive-ion electrospray ionization MS (EIMS) of LysK digestion products. In addition, three peptidoglycan hydrolase assays have been utilized to quantify the lytic activity levels of LysK and selected deletion constructs on live cells. LysK deletion constructs were created to systematically isolate the lytic domains of LysK to determine the contribution of each to exolysis. Finally, the lytic activity of LysK and a high-activity deletion construct were compared to determine their ability to lyse multiple species of CoNS.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Plasmids, constructs, and strains

The lysK cDNA was kindly provided by Paul Ross (O'Flaherty et al., 2005). Phage K genomic sequence has been published (AY176327) and the LysK protein sequence is also available (AA047477.2) through GenBank. The parental vector pSB0001 is the wild-type lysK cDNA subcloned between the NdeI and XhoI sites in the inducible expression vector pET21a (EMD Biosciences, San Diego, CA) described previously as LysK-pET21a (Becker et al., 2008). Plasmids and primers used in this study are described in Table 1.

Table 1.   Plasmids and primers
PlasmidsProteins producedForward primersReverse primersRecipient vectors
pSB0001LysK   
pSB0201LysK221pET21aXbaI-FlysKCHAP221XhoI-RpET21a
pSB1201LysK297pET21aBglII-FlysK300XhoI-RpET21a
PSB0301LysK390pET21aXbaI-FlysKCA390XhoI-RpET21a
pSB0701LysK149-495lysKAmid149XbaI-FlysKXhoI-RpET21a
pSB0105LysK325-495lysKAmid149XbaI-F*lysKXhoI-R*pET21a
pSB0801LysKΔ221-390lysKSH3bSalI-FpET21aStyI-RpSB0201
PrimersSequences
  • *

    Digestion with restriction enzymes NdeI and XhoI. Underlined and bold sequences indicate the restriction enzyme sites introduced and enzymes used with all nonasterisked engineered primers.

lysKXhoI-R5′-ATGGTGATGCTCGAGTTTGAATACTCC
pET21aXbaI-F5′-GGATAACAATTCCCCTCTAG(a)
lysKCHAP221XhoI-R5′-GTATTGCTCGAGTGAAGAACGACCTGC
pET21aBglII-F5′-CGTAGAGGATCGAGATCTCGATC
lysK300XhoI-R5′-GAATACTGCCTCGAGATTTTTAAGG
lysKCA390XhoI-R5′-GTGGTGCTCGAGACTTGCGCTACTTGTTTTACC
lysKAmid149XbaI-F5′-TCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAA
GGAGATATACATATGGTAGATAATTATTACGG
lysKSH3bSalI-F5′-CAAGTGTCGACAGTACACCGGC
pET21aStyI-R5′-CGTTTAGAGGCCCCAAGGGGTTATG

Truncations of the lysK gene were produced using standard PCR cloning methods with the lysK plasmid pSB0001 as template and engineered restriction sites introduced via primer design (as described previously) (Donovan et al., 2006b). Plasmid pSB0801 was generated by digesting the PCR product generated with template pSB0001 and primers LysKSH3bSalIF and pET21aStyIR with the restriction enzymes SalI and StyI and ligating the resulting DNA fragment into the XhoI- and StyI-digested pSB0201. This ligation introduces two amino acids (ld) at the fusion joint, destroying the original vector XhoI site. All pET21a-derived constructs have an additional eight amino acids at the C-terminus composed of LE introduced as an XhoI restriction site, and a 6xHis tag for nickel chromatography purification. All subcloning was performed in Escherichia coli DH5α (Invitrogen, Carlsbad, CA) for plasmid DNA isolation and sequence verification. pET21a constructs were expressed in E. coli BL21 (DE3) (EMD Biosciences).

Staphylococci were grown at 37 °C in either brain–heart infusion broth (BHI) (BD, Sparks, MD) for turbidity-reduction assays and zymograms or tryptic soy broth (TSB) (BD) for minimal inhibitory concentration (MIC) and plate lysis assays. All CoNS strains are mastitis isolates and gifts from Max Paape, except for Staphylococcus hyicus, a gift from David Kerr (University of Vermont). The S. aureus strain Newman was a gift from Jean Lee, Channing Lab, Brigham Young Women's Hospital, and Newbould 305 was purchased from American Type Culture Collection (ATCC) (29740). The identity of each strain was verified by the Animal Health Diagnostic Lab, Maryland Department of Agriculture, College Park, MD. All assays were performed with S. aureus strain Newman unless otherwise noted.

Protein purification

LysK truncated protein constructs were expressed and purified by Ni-NTA chromatography (Qiagen) as per the manufacturer's instructions, with the following modifications. After coincubation of His-tagged proteins and Ni-NTA, bound Ni-NTA resin was pelleted by centrifugation at 200 g for 10 min, the supernatant was removed, and the resin was resuspended in 5 mL wash buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0) with 10 mM imidazole. The wash and elution buffer profiles were empirically determined to be 20 mL of wash buffer with 10 mM imidazole, 10 mL with 20 mM imidazole, 10 mL with 60 mM imidazole, and elution with 1.8 mL wash buffer with 250 mM imidazole. Immediately after purification from the nickel column, all samples were made up to1% glycerol to reduce precipitation of the purified protein. All samples were then converted to a low-salt buffer (150 mM NaCl, 10 mM Tris-HCl, 1% glycerol, pH 7.5) via Zeba desalting column (Pierce) and 0.22 μ filter sterilized. Protein concentration determinations were made via BCA Protein kit (Pierce). Sterilized protein preparations were stored at 4 °C until the time of the assay.

LysK digestion of S. aureus cell wall preparations

Digestions were initiated by the addition of 20 μL of 2mg mL−1 LysK in buffer (400 mM NaCl, 20 mM Tris-HCl, 1% glycerol, 10 mM dithiothreitol) to 980 μL of a S. aureus cell wall suspension (OD600 nm=1.0) in 25 mM Tris-HCl, 400 mM NaCl, pH 7.4. Cell walls were prepared as described previously (Pritchard et al., 2004). After digestion at 37 °C for 2 h, the reaction mixture was clarified by centrifugation and the supernatant was ultrafiltered using a 5000-MW cutoff Vivaspin 500 (Sartorius North America Inc., NY). The filtrate was then applied to a Sep-Pak C18 cartridge (Water Corporation, Milford, MA) that had been activated by washing with 2 mL methanol and then rinsed with water. Unbound material was washed through the column with 5 mL water and bound peptide was eluted with 3 mL of 50% (v/v) methanol in water. The eluted sample was dried in a SpeedVac and redissolved in 100 μL water. A 1-μL aliquot was analyzed by positive-ion EIMS performed on a Micromass Q-TOF2 mass spectrometer (Micromass Ltd, Manchester, UK).

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and zymogram

The purified LysK protein, deletion constructs and Kaleidoscope protein standards (Bio-Rad) were analyzed with 15% SDS-PAGE, with or without a 300 mL equivalent of midlog phase (OD600 nm=0.4–0.6) S. aureus strain Newman cells embedded in the gel (zymogram). LysK protein constructs were boiled in Laemmli sample buffer (Bio-Rad) with β-mercaptoethanol, and electrophoresed simultaneously (identical conditions and times) in both the SDS-PAGE and the zymogram using the BioRad Mini-PROTEAN 3 dual gel apparatus, according to the manufacturer's instructions. SDS gels were Coomassie stained and zymograms were washed in excess water for 30 min and incubated at room temperature in water for up to 48 h. Areas of clearing in the turbid gel indicate a lytic protein in the gel.

Plate lysis assay

Purified proteins for each construct were diluted in saline Tris lysis buffer (STB; 150 mM NaCl, 10 mM Tris-HCl, pH 7.5), and 10 μL of 10-fold serial dilutions 1 μg μL−1 (10 μg), 0.1 μg μL−1 (1 μg), and 0.01 μg μL−1 (0.1 μg) were spotted onto a freshly spread lawn of log phase cells that had air dried for 30 min on tryptic soy agar plates. The spotted plates were air dried for 10 min in a laminar flow hood, and incubated overnight at 37 °C. Cleared spots were digitally photographed within 20 h of plating the cells.

Turbidity reduction assays

Freshly grown cell substrates for the turbidity reduction assay were prepared from midlog phase cultures (OD600 nm=0.4–0.6) grown in BHI at 37 °C, harvested by centrifugation at 4 °C, and stored on ice. Immediately before the assay, cells were resuspended in STB such that when added to 100 μL of lysis buffer±protein, the final solution has an OD600 nm of c. 1.0. Alternatively, for ease of assay preparation, and to reduce the variability of the assay (S. Becker, unpublished data), frozen cell substrate was prepared in large cultures of S. aureus strain Newman, harvested as above, pooled, resuspended in STB, supplemented with 25% glycerol, and frozen at −80 °C. As needed for turbidity assays, the frozen cells were thawed, washed three times with STB, and resuspended as with fresh cells. Although previously frozen, these cells are cryopreserved and will grow in culture after freezing.

The assays were performed in a Molecular Devices, Spectra Max 340 plate reader as described previously (Becker et al., 2008). All samples were performed in triplicate wells with a parallel triplicate ‘no enzyme’ buffer control. OD600 nm readings are taken automatically every 20 s for the duration of the assay. The readings for each well were analyzed in a sliding 40 s window over each group of three consecutive time points to identify the highest instantaneous change in OD600 nm for each well. The highest ΔOD600 nm value for each triplicate experimental sample was averaged and the highest cell-alone control value (calculated in the same manner) was then subtracted. The averaged values are multiplied by 1.5 to give a ΔOD600 nm min−1, then divided by micrograms of enzyme protein in the sample to yield a specific activity (ΔOD600 nm μg−1 min−1).

MIC and checkerboard assays

A microdilution broth method for determination of the MIC was used (Jones et al., 1985), with these modifications. All MICs were performed in TSB corrected for STB addition (50% lysis buffer±protein and 50% 2 × TSB). Modified checkerboard assays were performed as described previously, reducing the range of the assay to three 10-fold serial dilutions (Becker et al., 2008) to determine synergy between lysostaphin and the high-activity LysK constructs. Each MIC assay and checkerboard assay represents at least two determinations per experiment.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

The enzymatic domains of LysK are both active on purified peptidoglycan

To determine the LysK peptidoglycan cut sites, EIMS was performed on LysK-digested S. aureus cell wall preparations. The primary product of LysK digestion was A2QKG5, which in EIMS yields a peak with m/z=702 (Fig. 1a). To generate this fragment, two enzymatic activities must be present, an amidase that cleaves between the N-acetylmuramic acid and l-alanine of the stem peptide, and an endopeptidase that cleaves at the termini of the crossbridge, or at a consistent site within the pentaglycine crossbridge. MS/MS of the m/z=702 ion gave a prominent peak at m/z=286 due to a pentaglycine fragment, indicating that the endopeptidase cleavage occurred between the d-alanine and the first glycine in the cross-bridge (Fig. 1b). Other ions in the MS/MS spectrum including m/z=432 (KG5) and m/z=503 (AKG5) are also consistent with this interpretation. Additionally, codigestion with both the enzymatic activities of LysK and the known enzymatic activity of lysostaphin generated EIMS peaks at 702 (A2QKG5), 645 (A2QKG4), 588 (A2QKG3), and 531 (A2QKG2), confirming this interpretation (data not shown). Identical cleavage sites have been reported for the c. 40% identical phi11 endolysin LytA (Navarre et al., 1999).

image

Figure 1.  EIMS spectrum of purified Staphylococcus aureus peptidoglycan products of LysK digestion. (a). The LysK cleavage sites that result in the branched peptide A2QKG5 of m/z 702 are indicated (b). The peak at m/z 724 is believed to be the sodium adduct of the m/z 702 peak.

Download figure to PowerPoint

The LysK CHAP domain is sufficient for exolysis of S. aureus cells

LysK contains three domains: an N-terminal cysteine, histidine-dependent amidohydrolase/peptidase (CHAP) domain, a midprotein amidase-2 domain, and a C-terminal SH3b cell wall-binding domain (O'Flaherty et al., 2005). To determine if all three domains are necessary for exolysis, five truncation or deletion constructs were generated to isolate each domain on a separate construct or in pairwise combinations with the other domains. Schematics of each construct are presented in Fig. 2a. Lysostaphin, a potent anti-staphylococcal bacteriocin, glycyl-glycine endopeptidase peptidoglycan hydrolase, is included as a positive control and is composed of an N-terminal endopeptidase domain and a C-terminal SH3b domain. Eight micrograms of each protein was analyzed in both a 15% SDS-PAGE and an identical zymogram (Fig. 2c and b). All construct proteins are of the expected molecular weight and >95% pure, with the exception of the SH3b domain alone (LysK325-495) that has multiple contaminating bands.

image

Figure 2.  Schematic representation, SDS-PAGE and zymogram analysis of lysostaphin and LysK deletion constructs. (a) Schematic of LysK protein constructs. Wt LysK: CHAP endopeptidase (black), amidase domain (gray), SH3b domain (vertical stripes); lysostaphin: glycyl-glycine endopeptidase domain (diagonal stripes), SH3b domain (black and white checkerboard). (b) SDS-PAGE: 4 μg of each construct was loaded per lane. The carrot (◂) indicates the band for the LysK 325–495 truncation, per calculated molecular weight. (c) Zymogram: 4 μg of each construct and excess prestained Kaleidoscope protein standards (Bio-Rad), to allow visualization of the molecular weight markers, were added to the zymogram. The predicted molecular weights for each construct protein are Wt LysK, 55.8 kDa; LysK221, 25.7 kDa; LysK297, 33.9 kDa; LysK390, 44.4 kDa; LysK149-495, 39.3 kDa; LysK 325-495, 19.7 kDa; LysK221-390, 37.4 kDa; and lysostaphin, 27.9 kDa.

Download figure to PowerPoint

Zones of clearing in the zymogram correspond to the predicted molecular weights and positions of the purified proteins in the SDS-PAGE (Fig. 2c). All constructs containing a CHAP domain cleared the zymogram within 30 min after washing. As expected, the LysK325-495 protein, containing only the SH3b domain, did not show any detectable clearing in the zymogram. Additional incubation times showed slight clearing for the LysK149-495 construct, harboring just the amidase and SH3b domains. However, the clearing was barely visible to the naked eye, even after 48 h, and is not readily discernable in Fig. 2. LysK297, harboring the intact CHAP domain and part of the amidase domain, does not show as robust clearing in the zymogram as the LysK 221, harboring just the CHAP domain. Lysostaphin shows a cleared zone of similar intensity as the wild-type LysK, LysK221, LysK390, and LysKΔ221-390.

The LysK SH3b domain increases the CHAP domain activity in plate lysis, turbidity reduction, and MIC assays

LysK deletion constructs were tested in three antimicrobial assays: plate lysis, turbidity reduction, and MIC. Constructs lacking the SH3b domain (LysK211 and LysK390), show at least a 10-fold reduced activity compared with wild-type LysK. The SH3b domain alone, LysK325-495, again had no discernable activity on the plate lysis assay. In contrast to the zymogram, 10 μL spots containing either 10 μg of LysK297 (29 μM) or LysK149-495 (25 μM) had no discernable activity in the plate lysis assay (Fig. 3a). Fusion of the SH3b domain to the CHAP domain (LysK221-390) increased the activity of the CHAP domain (1 μg/39 μM–0.1 μg/1.8 μM) to approximately the wild type LysK levels (0.1 μg/2.7 μM). Lysostaphin showed demonstrable clearing at a lower dosage, lysing when 0.01 μg was spotted in 10 μL (36 nM).

image

Figure 3.  Comparison of LysK deletion construct antimicrobial activity in plate lysis and turbidity reduction assays. (a) Representative plate lysis assay with Staphylococcus aureus strain Newman on tryptic soy agar plates, incubated overnight at 37°C. The lowest concentration at which cleared zones were detected for each 10-μL spot of protein are Wt LysK, 1 μg (1.8 μM); LysK 221, 10 μg (39 μM); LysK390, 10 μg (23 μM); LysK221-390, 1 μg (2.7 μM); and lysostaphin, 0.1 μg (36 nM). (b) Turbidity reduction assay specific activities for each protein are reported as a maximum rate derived from a 5-min assay previously frozen S. aureus strain Newman cells. (c) Turbidity reduction assay specific activities when corrected for molarity. Error bars represent the SE of the mean for triplicate samples in four independent experiments.

Download figure to PowerPoint

Turbidity reduction assays with each deletion construct were performed on frozen S. aureus strain Newman cells. The turbidity reduction assays were performed with physiological saline (0.15 M NaCl) to better approximate those conditions where an antimicrobial might be used. LysK, LysK221-390 and lysostaphin (high-activity proteins) were assayed with 5 μg of lysin (final concentrations of 450, 670, and 900 nM, respectively) to remain in the linear range of LysK in the assay (Becker et al., 2008). Because of the weak activity (near background) for the remaining constructs, 10 μg (2 ×), of each construct, was used to generate a measureable signal. For these constructs, LysK221, Lysk297, LysK 390, and LysK149-495, their final concentrations were 1.9, 1.5, 1.1, and 1.3 μM. When compared on a mass level, the specific activity of wild-type LysK and the amidase deletion construct, LysK221-390, are nearly identical (Fig. 3b). When corrected for molarity, the mean difference was also found not to be statistically significant (t-test for independent samples, two tailed, α=0.05; d.f.=6), although it appears to be greater (Fig. 3c).

Although it is known that different assays for peptidoglycan hydrolase activity do not always agree quantitatively (Kusuma & Kokai-Kun, 2005), the turbidity reduction and plate lysis assay results are very consistent. Deletion of the SH3b domain yeilds at least a 10-fold reduction in specific activity for all lytic domains in both assays. Deletion of the amidase domain appears to have no significant effect (LysK221-390 vs. LysK) when compared on either a mass or molar ratio (t-test for independent samples, two tailed, d.f.=6, α=0.05), and might even slightly enhance the activity of some constructs in these lytic assays (LysK221 relative to LysK390). As in the plate lysis assay, LysK 297 and LysK 325-495 show no activity in turbidity reduction assays. Unlike the plate lysis assay, the amidase+SH3b domain construct (LysK149-495) showed significantly greater activity relative to the other low-activity truncations, suggesting that while the amidase domain is insufficient to prevent plate growth, it has some activity on S. aureus cells in solution.

The MIC of each protein was determined in TSB. As in both the plate lysis assays and the turbidity-reduction assays, deletion of the SH3b domain significantly reduces the activity of the LysK truncations. LysK221, LysK297, LysK390, and LysK149-495 were unable to inhibit cell growth when used at the maximum concentrations achievable [600 μg mL−1 (23 μM), 180 μg mL−1 (5 μM), 650 μg mL−1 (15 μM), and 1.2mg mL−1 (31 μM), respectively]. Proteins that could inhibit cell growth in the MIC assay at concentrations <100 μg mL−1 were studied further (Fig. 4). Both the wild-type LysK protein and the amidase-deleted protein, LysKΔ221-390, have similar MICs (78±20 and 63±8 μg mL−1, and MIC molar concentrations 1.4±0.34 and 1.8±0.23 μm, respectively), indicating that the presence of the amidase domain is not required for wild-type levels of growth inhibition. When tested in the checkerboard assay (Fig. 4), the internal amidase deletion, LysKΔ221-390, shows the same level of synergistic antimicrobial activity with lysostaphin as does the full-length LysK. LysK enhanced the activity of lysostaphin 16-fold at 12.5 μg mL−1 (220 nM) and fourfold at 1.25 μg mL−1 (22 nM). The amidase-deletion enhanced the activity of lysostaphin 16-fold at 7.5 μg mL−1 (220 nM) and fourfold at 0.75 μg mL−1 (20 nM) (Fig. 4; Becker et al., 2008). These results again suggest the CHAP domain accounts for nearly all of the antimicrobial properties of LysK. The fractional inhibitory concentration (FIC) determination between LysK and lysostaphin is highly significant with FIC<0.5 (Becker et al., 2008).

image

Figure 4.  MIC of purified LysK and LysK221-390 (above) and synergistic interaction with lysostaphin (below). Error indications represent the SE of the mean.

Download figure to PowerPoint

CoN are sensitive to the exolytic activity of LysK and LysKΔ221-390

LysK and the highly active deletion construct (LysKΔ221-390) were tested in turbidity-reduction assays against multiple live staphylococcal strains (Fig. 5). The strains tested include the human pathogen S. aureus strain Newman, the mastitis S. aureus strain Newbould 305, and the CoNS mastitis-causing strains Staphylococcus chronogenes, Staphylococcus epidermis, S. hyicus, Staphylococcus simulans, Staphylococcus warneri and Staphylococcus xylocus. Staphylococcus hyicus (Paape) and S. xylocus were the only strains with significantly different mean values between treatments when analyzed by anova using the t-test, for independent samples for post hoc analysis (two tailed, d.f.=6, α=0.05).

image

Figure 5.  Staphylococcal species specificity of LysK deletion constructs in turbidity-reduction assays. Five micrograms of LysK (black bars; final concentration 0.45 μM) or LysKΔ221-390 (white bars; final concentration 0.67 μM) were exposed to midlog phase staphylococcal cells resuspended to an OD600 nm in a volume of 200 μL. Maximum rate of turbidity reduction over the 5-min assay are reported as specific activity with error bars representing the SE of the mean of four independent experiments with triplicate samples.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

The LysK peptidoglycan cut sites have been determined and are identical to the phi11 endolysin cut sites (Navarre et al., 1999). Analysis of LysK deletion construct activity measurements indicate that the CHAP domain plays a crucial role in exolysis, with the amidase domain contributing very little, if any, lytic activity. The activity of the CHAP domain is greatly enhanced, to near wild-type levels, by the presence of the LysK SH3b domain. This CHAP domain lytic activity is synergistic with lysostaphin, consistent with previous findings with LysK (Becker et al., 2008). The LysK-susceptibility profile of staphylococcal strains obtained via turbidity reduction assays is consistent with previous LysK plate lysis data from multiple strains (O'Flaherty et al., 2005), and also resembles the turbidity-reduction sensitivities described for LytA (Donovan et al., 2006b), again consistent with the two enzymes sharing identical peptidoglycan cut sites.

Dependence on C-terminal cell wall-binding sequences for maximal lytic activity has been shown with several peptidoglycan hydrolase enzymes: LytA (Donovan et al., 2006b; Sass & Bierbaum, 2007), lysostaphin (Baba & Schneewind, 1996), ALE-1 (Lu et al., 2006), Ply118, and Ply500 (Loessner et al., 2002). More recently, midprotein Cpl-7 cell wall-binding domains of the streptococcal λSA2 prophage endolysin (Donovan & Foster-Frey, 2008) were shown also to be essential for high activity. However, cell wall-binding domains are not essential for high activity of all peptidoglycan hydrolases for example B30 (Donovan et al., 2006a), PlyGBS (Cheng & Fischetti, 2007), the bacillus endolysin ply L (Low et al., 2005), and the staphylococcal endolysin plyTW (Loessner et al., 1998). In fact, our results indicating that the LysK CHAP domain requires the SH3b domain for maximal activity are in conflict with the findings of Paul Ross and colleagues who first isolated the lysK gene (O'Flaherty et al., 2005). They report that the CHAP domain alone, 165 N-terminal amino acids, has equivalent activity to the full-length LysK protein (Horgan et al., 2009). However, these results may not be contradictory due to the fact that both results arise from non-native constructs, any one of which might alter normal domain function or extinguish regulatory functions inherent to the full-length protein. Additionally, the assay conditions are different between the two labs, 50 mM sodium acetate buffer, pH 6.5 (Horgan et al., 2009), vs. 150 mM NaCL, 10 mM Tris pH 7 (our work). As shown previously, LysK is more active at higher salt, dropping precipitously as the salt concentration approaches zero (Becker et al., 2008). Conversely, when the truncations LysK221 or LysK390 are tested over a salt gradient, higher activities are observed at lower salt concentrations (data not shown) and thus the observed dependence on the SH3b domain may result from differing assay conditions. Alternatively, Low et al. (2005) postulated a regulatory model to explain how the absence of the SH3b domain might enhance activity, suggesting that the SH3b domain functions to fold back on and inhibit the lytic domain in the absence of peptidoglycan substrate.

Although the amidase domain appears to be active on purified peptidoglycan in the context of the full-length LysK protein, (consistent with the EIMS results; Fig. 1) and shows limited activity in the absence of the CHAP domain in turbidity-reduction assays and SDS-treated cells in the zymogram (Fig. 2), it is unable to inhibit the growth of cells in either the plate lysis or MIC assays. Interestingly, the staphylococcal phage phi11 endolysin (LytA) amidase domain shares many properties with the LysK amidase domain for example the same peptidoglycan target bond (Navarre et al., 1999), same midprotein location (Wang et al., 1991) and can similarly lyse SDS-treated cells, but is unable to lyse intact cells (heat killed) (Sass & Bierbaum, 2007). Consistent with this minor role in exolysis is the fact that for the majority of staphylococcal strains we tested, deletion of the amidase domain (LysKΔ221-390) did not significantly change the exolytic activity of the protein compared with the wild-type LysK protein. Although the LysK amidase domain is highly conserved among the staphylococcal phage endolysins (D.M. Donovan, unpublished data), our data do not support a role for it in lysis from without, but it may be necessary for its native role in phage particle release from a host cell. It is possible that the amidase domain requires peptidoglycan digestion products that result from CHAP digestion, or cofactors resulting from the phage lytic cycle to achieve maximal activity.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the US Department of Agriculture.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  • Baba T & Schneewind O (1996) Target cell specificity of a bacteriocin molecule: a C-terminal signal directs lysostaphin to the cell wall of Staphylococcus aureus. EMBO J 15: 47894797.
  • Becker SC, Foster-Frey J & Donovan DM (2008) The phage K lytic enzyme LysK and lysostaphin act synergistically to kill MRSA. FEMS Microbiol Lett 287: 185191.
  • Borysowski J, Weber-Dabrowska B & Gorski A (2006) Bacteriophage endolysins as a novel class of antibacterial agents. Exp Biol Med 231: 366377.
  • Cheng Q & Fischetti VA (2007) Mutagenesis of a bacteriophage lytic enzyme PlyGBS significantly increases its antibacterial activity against group B streptococci. Appl Microbiol Biotechnol 74: 12841291.
  • Deluyker HA, Van Oye SN & Boucher JF (2005) Factors affecting cure and somatic cell count after pirlimycin treatment of subclinical mastitis in lactating cows. J Dairy Sci 88: 604614.
  • Donovan DM & Foster-Frey J (2008) LambdaSa2 prophage endolysin requires Cpl-7-binding domains and amidase-5 domain for antimicrobial lysis of streptococci. FEMS Microbiol Lett 287: 2233.
  • Donovan DM, Foster-Frey J, Dong S, Rousseau GM, Moineau S & Pritchard DG (2006a) The cell lysis activity of the Streptococcus agalactiae bacteriophage B30 endolysin relies on the cysteine, histidine-dependent amidohydrolase/peptidase domain. Appl Environ Microbiol 72: 51085112.
  • Donovan DM, Lardeo M & Foster-Frey J (2006b) Lysis of staphylococcal mastitis pathogens by bacteriophage phi11 endolysin. FEMS Microbiol Lett 265: 133139.
  • Fischetti VA (2005) Bacteriophage lytic enzymes: novel anti-infectives. Trends Microbiol 13: 491496.
  • Horgan M, O'Flynn G, Garry J, Cooney J, Coffey A, Fitzgerald GF, Ross RP & McAuliffe O (2009) Phage lysin, LysK, can be truncated to its CHAP domain and retain lytic activity against live antibiotic-resistant staphylococci. Appl Environ Microbiol 75: 872874.
  • Jones RN, Barry AL, Gavan TL & Washington JA II (1985) Susceptibility tests: microdilution and macrodilution broth procedures. Manual of Clinical Microbiology (BalowsA, HauslerJWJ & ShadomyHJ, eds), pp. 972977. American Society for Microbiology, Washington, DC.
  • Klevens RM, Morrison MA, Nadle J et al. (2007) Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA 298: 17631771.
  • Kusuma C & Kokai-Kun J (2005) Comparison of four methods for determining lysostaphin susceptibility of various strains of Staphylococcus aureus. Antimicrob Agents Ch 49: 32563263.
  • Lee JH (2003) Methicillin (oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Appl Environ Microbiol 69: 64896494.
  • Leonard F & Markey B (2008) Meticillin-resistant Staphylococcus aureus in animals: a review. Vet J 175: 2736.
  • Loeffler JM, Nelson D & Fischetti VA (2001) Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase. Science 294: 21702172.
  • Loessner MJ (2005) Bacteriophage endolysins – current state of research and applications. Curr Opin Microbiol 8: 480487.
  • Loessner MJ, Gaeng S, Wendlinger G, Maier SK & Scherer S (1998) The two-component lysis system of Staphylococcus aureus bacteriophage Twort: a large TTG-start holin and an associated amidase endolysin. FEMS Microbiol Lett 162: 265274.
  • Loessner MJ, Kramer K, Ebel F & Scherer S (2002) C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates. Mol Microbiol 44: 335349.
  • Low LY, Yang C, Perego M, Osterman A & Liddington RC (2005) Structure and lytic activity of a Bacillus anthracis prophage endolysin. J Biol Chem 280: 3543335439.
  • Lu JZ, Fujiwara T, Komatsuzawa H, Sugai M & Sakon J (2006) Cell wall-targeting domain of glycylglycine endopeptidase distinguishes among peptidoglycan cross-bridges. J Biol Chem 281: 549558.
  • Navarre WW, Ton-That H, Faull KF & Schneewind O (1999) Multiple enzymatic activities of the murein hydrolase from staphylococcal phage phi11. Identification of a d-alanyl-glycine endopeptidase activity. J Biol Chem 274: 1584715856.
  • Nunan C & Price R (2007) MRSA in Farm Animals and Meat, a New Threat to Human Health. Soil Association, Bristol.
  • O'Flaherty S, Coffey A, Edwards R, Meaney W, Fitzgerald GF & Ross RP (2004) Genome of staphylococcal phage K: a new lineage of Myoviridae infecting gram-positive bacteria with a low G+C content. J Bacteriol 186: 28622871.
  • O'Flaherty S, Coffey A, Meaney W, Fitzgerald GF & Ross RP (2005) The recombinant phage lysin LysK has a broad spectrum of lytic activity against clinically relevant staphylococci, including methicillin-resistant Staphylococcus aureus. J Bacteriol 187: 71617164.
  • Pritchard DG, Dong S, Baker JR & Engler JA (2004) The bifunctional peptidoglycan lysin of Streptococcus agalactieae bacteriophage B30. Microbiology 150: 20792087.
  • Sass P & Bierbaum G (2007) Lytic activity of recombinant bacteriophage φ11 and φ12 endolysins on whole cells and biofilms of Staphylococcus aureus. Appl Environ Microbiol 73: 347352.
  • Schleifer KH & Kandler O (1972) Peptidoglycan types of bacterial cell walls and their taxonomic implications. Bacteriol Rev 36: 407477.
  • Sordillo LM & Streicher KL (2002) Mammary gland immunity and mastitis susceptibility. J Mammary Gland Biol 7: 135146.
  • Spratt BG (1994) Resistance to antibiotics mediated by target alterations. Science 264: 388393.
  • Voss A, Loeffen F, Bakker J, Klaassen C & Wulf M (2005) Methicillin-resistant Staphylococcus aureus in pig farming. Emerg Infect Dis 11: 19651966.
  • Wang X, Wilkinson BJ & Jayaswal RK (1991) Sequence analysis of a Staphylococcus aureus gene encoding a peptidoglycan hydrolase activity. Gene 102: 105109.
  • Wilson DJ, Gonzalez RN & Das HH (1997) Bovine mastitis pathogens in New York and Pennsylvania: prevalence and effects on somatic cell count and milk production. J Dairy Sci 80: 25922598.