SEARCH

SEARCH BY CITATION

Keywords:

  • Azospirillum;
  • maize;
  • stress tolerance;
  • trehalose

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacteria of the genus Azospirillum increase the grain yield of several grass crops. In this work the effect of inoculating maize plants with genetically engineered Azospirillum brasilense for trehalose biosynthesis was determined. Transformed bacteria with a plasmid harboring a trehalose biosynthesis gene-fusion from Saccharomyces cerevisiae were able to grow up to 0.5 M NaCl and to accumulate trehalose, whereas wild-type A. brasilense did not tolerate osmotic stress or accumulate significant levels of the disaccharide. Moreover, 85% of maize plants inoculated with transformed A. brasilense survived drought stress, in contrast with only 55% of plants inoculated with the wild-type strain. A 73% increase in biomass of maize plants inoculated with transformed A. brasilense compared with inoculation with the wild-type strain was found. In addition, there was a significant increase of leaf and root length in maize plants inoculated with transformed A. brasilense. Therefore, inoculation of maize plants with A. brasilense containing higher levels of trehalose confers drought tolerance and a significant increase in leaf and root biomass. This work opens the possibility that A. brasilense modified with a chimeric trehalose biosynthetic gene from yeast could increase the biomass, grain yield and stress tolerance in other relevant crops.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Plant growth-promoting rhizobacteria stimulate growth by acting directly on plant metabolism, providing substances in short supply, fixing atmospheric nitrogen, solubilizing soil phosphorus and iron, or synthesizing phytoregulators (Bashan & de-Bashan, 2005). Azospirillum brasilense promotes growth of many economically important grass crops including wheat and maize (Heulin et al., 1989; Caballero-Mellado et al., 1992; Van de Broek et al., 1993; Dobbelaere et al., 2001), mainly due to the accumulation and transport of indole-3-acetic acid to the plant (Umali-García et al., 1980; Hartmann et al., 1983). This auxin promotes plant root elongation, which makes the uptake of mineral nutrients and water more efficient (Lin et al., 1983; Kapulnik et al., 1985; Dobbelaere et al., 2003).

Maize is among the most prominent crops for human consumption, and, together with rice and wheat, is the staple food in most countries. One of the major challenges for the 21st century will be sufficient food production, given estimates that the human population will reach 10 billion by 2050. This means that a strong technological effort must be conducted to increase crop yield, without increasing arable land area. On the other hand, intensive agriculture generates serious environmental problems by using chemical fertilizers, plaguicides and herbicides, salinity and water shortage (Morrissey et al., 2004). All these are aggravated by climate change that is severely affecting crop productivity, and therefore improving drought tolerance in maize is of great relevance.

Plants are intermittently exposed to a plethora of abiotic stress conditions such as low or high temperature, salinity and drought (Bray et al., 2000). It has been acknowledged for a long time that water availability is the stress condition that causes most losses to agriculture (Boyer, 1982). Abiotic stress triggers many common responses in plants. All of them involve cell dehydration, loss of turgor and accumulation of reactive oxygen species (ROS), which affect subcellular structures and enzyme activity. Under exposure to osmotic stress, plants exhibit a broad range of molecular and biochemical adaptive mechanisms (Bartels & Sunkar, 2005). These comprise changes in morphology and development such as root growth inhibition, and ion transport and metabolic adjustments, which involve the synthesis of compatible solutes (osmoprotectants) that counteract dehydration and ROS by lowering osmotic potential and protecting membranes, enzymes and other subcellular structures against irreversible damage, denaturation and protein aggregation without altering physiological performance.

Among the different osmoprotectants, trehalose is one of the most effective at counteracting several types of abiotic stress (Elbein et al., 2003). Trehalose (α-d-glucopyranosyl-1, 1-α-d-glucopyranoside) is a nonreducing disaccharide present in a wide variety of organisms known as anhydrobionts, which include certain species of plants, fungi, bacteria and invertebrates, and that are capable of reviving in the presence of water in a few hours after being completely dehydrated for months or years (Paul et al., 2008). There are five known trehalose biosynthetic pathways (Avonce et al., 2006), but the best characterized and the one present in many bacteria and plants consists of the condensation of UDP-glucose and glucose-6-phosphate by means of trehalose-6-phosphate synthase (TPS) to form trehalose-6-phosphate, which is subsequently dephosphorylated to trehalose by trehalose-6-phosphate phosphatase (TPP).

In previous reports we have shown that the overexpression of OtsA (bacterial TPS) gene in Rhizobium etli increases its osmotic stress tolerance, and using it to inoculate common bean plants improves drought tolerance and grain yield (Suárez et al., 2008). Also, we have demonstrated that transformation of Arabidopsis thaliana with a yeast bifunctional TPS–TPP enzyme confers multiple stress protection to plants, namely freeze, heat, drought and salt tolerance (Miranda et al., 2007).

Here, we analyzed the effect of inoculating maize plants with genetically engineered A. brasilense strains that overaccumulate trehalose.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Biological material

Azospirillum brasilense strain Cd (Eskew et al., 1977) and maize (Zea maize landrace Chalqueño, Mexico) plants were used. For gene construction and plasmid mobilization to A. brasilense, Escherichia coli S17-1 and DH5α strains were used, respectively.

Growth conditions

To inoculate plants, Azospirillum strains were grown on nickel fluoroborate (NFb) liquid medium (Döbereiner et al., 1976) supplemented with NH4Cl (0.2 g L−1) for 2 days at 30 °C at 250 r.p.m. Bacteria were harvested by centrifugation (7000 g for 10 min) and washed twice in 10 mM MgSO4·7H2O. The Congo red (Sigma Chemical Co., St. Louis, MO) agar medium (Rodríguez-Cáceres, 1982) for growing A. brasilense was routinely used to check culture purity and count bacteria. Maize plants were grown in 3-L plastic pots containing sterilized river sand for 2 weeks and watered five times with 200 mL of sterile distilled water. All incubations were performed in a greenhouse (24±4 °C, natural illumination).

Molecular techniques

The 1452-bp ReOtsA coding region (Suárez et al., 2008) was amplified with forward primer (5′CCGCTCGAGAAGGAAAACCCCATGAGCCGTCTTAT) containing XhoI restriction site (italics), Shine–Dalgarno sequence (underlined) and initiation codon (bold) and reverse primer (5′CCCAAGCTTAGCGCGCTAAAGAGCCTATCCGTG) containing HindIII restriction site (italics) and stop codon (bold). To construct a chimeric gene (BIF gene) encoding the TPS–TPP bifunctional enzyme from Saccharomyces cerevisiae, the full-length TPS1 gene was fused to the three-end part of TPS2 (Miranda et al., 2007). It is known that when the N-terminal 504 amino acids are removed from TPS2-encoded protein, the truncation allele is still fully active as the remaining 392-amino acid carboxy-terminus encompasses the homology blocks present in all TPP enzymes (Vogel et al., 1998). Therefore, we fused a TPS1 1526-bp fragment (encoding 493 amino acids plus two linker amino acids) to a 1353-bp fragment corresponding to the carboxy end of TPS2 (encoding 397 amino acid plus two linker amino acids) to yield a 2873-bp DNA fragment fused through the BamHI linker site, which showed a continuous ORF encoding the predicted 892-amino acid sequence after DNA sequencing (Miranda et al., 2007). The 2873-bp TPS1-TPS2 encoding the chimeric translational fusion, here designated BIF gene, was amplified with forward primer (5′CCGCTCGAGAAGGAAAACCCCATGACTACGGATAAC) containing XhoI restriction site (italics), Shine–Dalgarno sequence (underlined) and initiation codon (bold) and reverse primer (5′CGGGGTACCATGGTGGGTTCAGAC) containing KpnI restriction site (italics) and stop codon (bold). The PCR program used to amplify these sequences with High Expand DNA polymerase (Roche, Indianapolis, IN) was one cycle at 94 °C for 3 min; and 30 cycles of 94 °C for 1 min; 55 °C for 1 min; and 72 °C for 1.5 min. Both genes were checked by DNA sequencing before subcloning in the broad-host-range pBBR1MCS5 vector, which allows gene expression under the control of the lac promoter (Kovach et al., 1995). The pBBR1M∷ReOtsA construct containing ReOtsA (bacterial TPS from R. etli) was described previously (Suárez et al., 2008). In the present work, the BIF gene subcloned in pBBR1MCS5 vector was denominated pBBR1M∷BIF. Colonies from both plasmid constructs were selected on gentamycin (30 μg mL−1). Plasmids were mobilized to A. brasilense by conjugation with E. coli S17-1 harboring the corresponding construct. Wild-type A. brasilense was selected on ampicillin (100 μg mL−1) and selection of transformed A. brasilense with either of the described plasmids was selected on gentamycin as well. Standard molecular techniques for DNA digestion, plasmid isolation and bacterial transformation were used (Sambrook & Russell, 2001).

Stress tolerance tests in A. brasilense

Azospirillum brasilense precultures were grown at 30 °C for 1 day in Luria–Bertani liquid media supplemented with ampicillin (100 μg mL−1) for the wild-type strain, and 30 μg mL−1 gentamycin and ampicillin for strains harboring either pBBR1M∷BIF or pBBR1M∷ReOtsA plasmid. Cells were spun down and grown to mid-logarithmic phase (0.5 OD600 nm) in NFb liquid media with antibiotics. To determine survival following osmotic stress, serial dilutions were made and plated on Congo red agar medium with different NaCl concentrations (0.1–0.5 M) at 30 °C for 3 days. The surviving colonies were counted afterwards.

Plant inoculation and stress tolerance tests

Maize seeds were surface sterilized in 25% commercial bleach solution (Clorox®; 6% sodium hypochlorite) for 25 min, and then washed three times with distilled sterile water. Maize seeds were germinated on 0.7% water agar plates for 24 h at 29 °C; thereafter, the pregerminated seeds were sown and the seedlings were inoculated on the radicle with 1 mL bacterial suspension (1 × 108 CFU mL−1) in 10 mM MgSO4·7H2O. Inoculated seeds were set on previously watered pots with 200 mL of nutritive solution (1 mM K2HPO4, 1.5 mM KH2PO4, 3 mM NaCl, 1.5 mM CaCl2, 4.5 mM MgSO4, 5 mM KNO3, 40 μM C6H5FeO7, 40 μM H3BO4, 13 μM MnSO4·7H2O, 1.2 μM ZnSO4, 0.5 μM CuSO4 and 0.4 μM Na2MoO4, pH 6.3) and were allowed to grow for 2 weeks. Thereafter, irrigation was stopped for 10 days and was re-established afterwards. Plant recovery was observed 15 days after rewatering and the relative water content (RWC) was also determined.

Isolation of A. brasilense from maize roots

A detached section of maize root from each plant inoculated with the different bacterial strains was rinsed in sterile water and weighed (1–2 g), before adding 10 mM MgSO4 g−1 of tissue and shaking vigorously. Decimal dilutions were prepared from resuspended bacteria and plated in Congo red media with the corresponding antibiotic. After 3 days of incubation at 30 °C, the CFU were determined.

Biomass and water content analyses

To determine plant biomass, leaves were separated from roots and oven dried at 65 °C for 3 days and weighed (dry weight). RWC and soil gravimetric water content (SGWC) were determined as reported previously (Gaxiola et al., 2001). Briefly, leaves were excised, and their fresh weight was determined. After floating them in deionized water at 4 °C overnight, their rehydrated weight was determined. Plant RWC was calculated by measuring (fresh weight−dry weight)/(rehydrated weight−dry weight). SGWC was determined in fully watered soil and after 10 days without watering.

Trehalose determination

For trehalose determination, Azospirillum strains were grown on NFb liquid medium for 1 day at 30 °C. Cultures were centrifuged, washed with water and resuspended in 80% ethanol. After incubation at 85 °C during 15 min, the samples were centrifuged and the supernatant recovered. The ethanol excess was evaporated and samples were resuspended in ultrapure water before being analyzed by HPLC using a ZORBAX carbohydrate analysis column (Agilent Technologies, Santa Clara, CA) eluted with acetonitrile : water (65 : 35 v/v). Purified trehalose (Sigma Chemical Co.) was used as a standard to determine the concentration.

Statistical analysis

All experiments were repeated at least two times independently unless otherwise stated in the figure legend. The data were processed by anova using Student's t-test followed by Duncan–Waller mean analysis.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Trehalose accumulation in A. brasilense confers stress tolerance

To overaccumulate trehalose in A. brasilense we used the broad-host-range pBBR1MCS5 vector that allows gene expression under the control of the lac promoter (Kovach et al., 1995). Two plasmids were constructed using this vector as a backbone: the first contained the ReOtsA gene reported previously (Suárez et al., 2008). The other construct consisted of a chimeric translational fusion of TPS and TPP from S. cerevisiae that we have tested before in yeast and plants (Miranda et al., 2007).

To determine the possible stress tolerance in A. brasilense transformed with trehalose biosynthesis genes, these strains together with A. brasilense wild type were grown with different NaCl concentrations. The bacteria with BIF construction or ReOtsA gene grew equally well up to 0.3 M NaCl, whereas the wild-type strain could not grow at this salt concentration. At higher NaCl concentrations reaching 0.5 M, the strain harboring BIF gene grew better than A. brasilense with ReOtsA gene (Fig. 1a). These results demonstrate that the trehalose biosynthesis genes expressed in A. brasilense confer tolerance to osmotic stress, and also shows that the BIF gene is more efficient than ReOtsA.

image

Figure 1.  Survival of recombinant Azospirillum brasilense upon osmotic stress. Wild type (rhombus), overexpressing OtsA (squares) or BIF gene (triangles), strains of A. brasilense were grown as indicated in Materials and methods (a). Wild type, overexpressing OtsA or BIF gene strains of A. brasilense were grown in NFb liquid without (white bars) or with 0.5 M NaCl (black bars), and aliquots were taken to measure intracellular trehalose content (b). Both figures represent the results of three independent experiments. *Means of the samples are different at the 0.05 level (P<0.05). WT, wild type.

Download figure to PowerPoint

To further substantiate that tolerance to osmotic stress of the A. brasilense recombinant strains is due to the presence of trehalose, the disaccharide concentration of bacteria grown in media with 0.5 M NaCl or without salt was measured. The trehalose levels detected in A. brasilense harboring ReOtsA or BIF constructions rose 1.5 and 2 times, respectively, when they were grown under osmotic stress (Fig. 1b), whereas without stress, the trehalose concentration was the same in both cases and increased 1.4 times in comparison with the wild type. This strain displayed basal levels of trehalose without osmotic stress and none was detected after subjecting it to stress because it was unable to grow at 0.5 M NaCl (Fig. 1b). Thus, the increase in trehalose concentration correlated with improved stress tolerance in A. brasilense cells.

Improvement of drought tolerance in maize inoculated with A. brasilense containing trehalose

With the aim to determine a possible effect of A. brasilense recombinant strains on enhancing maize drought tolerance, plants were inoculated with A. brasilense harboring ReOtsA or BIF gene. Plants inoculated with A. brasilense wild-type strain or noninoculated plants were used as controls. Watering was stopped for 10 days in well-irrigated 2-week-old maize plants. All plants were negatively affected, with the noninoculated plants displaying the most severe wilting symptoms (Fig. 2a). At the end of the drought episode, irrigation was reestablished and plants were allowed to recover for 2 weeks. Maize plants inoculated with either of the different A. brasilense strains recovered much better than noninoculated plants (Fig. 2b). Plant survival was higher with those inoculated with A. brasilense harboring the BIF gene, which displayed 85% recovery, twice that of noninoculated plants (Fig. 3a). No significant (P<0.05) survival difference in drought stress tolerance was found between noninoculated plants and those inoculated with either the wild-type strain or bacteria harboring ReOtsA.

image

Figure 2.  Analysis of maize plants subjected to drought stress. Well-watered 2-week-old maize plants were subjected to drought stress by withholding watering for 10 days (a). After stress, plants were rewatered for 2 weeks (b). Photographs from representative plants were taken in each condition. In each pot, two plants inoculated with Azospirillum brasilense WT, overexpressing ReOtsA or BIF gene strains were present. WT, wild type.

Download figure to PowerPoint

image

Figure 3.  Survival of plants subjected to drought stress. Well-watered 2-week-old maize plants were subjected to drought stress by withholding watering for 10 days. In each pot, two plants inoculated with Azospirillum brasilense WT; overexpressing ReOtsA or BIF gene strains were present. Survival to imposed drought stress on plants inoculated with either strain was determined considering 20 plants in each condition and two independent experiments were conducted. (a) Survival of plants upon continual watering was taken as 100%. (b) RWC and (c) SGWC were determined before (14 days postinoculation) and after (24 days postinoculation) water stress. In (b) and (c) noninoculated plants (white bars), or plants inoculated with A. brasilense WT (gray bars), overexpressing ReOtsA (black bars) or BIF gene (hatched bars), were used. *Means of the samples are different at the 0.05 level (P<0.05). WT, wild type.

Download figure to PowerPoint

RWC content before drought stress shows that all plants had a very similar water status at the beginning of the experiment, whereas 10 days after the stress episode, plants inoculated with A. brasilense containing the BIF gene construct retained more than twice as much water as plants inoculated with ReOtsA strain, or wild-type plants. After stress, practically no water was found in noninoculated maize plants (Fig. 3b). The SGWC was similar for all treatments before stress, and it dropped to 60% after the drought episode in all soil samples (Fig. 3c), indicating that the difference in plant RWC was not due to the soil water status.

Biomass increase in maize inoculated with A. brasilense containing trehalose

The root and aerial parts of plants inoculated with the different A. brasilense strains or without inoculation were weighed (Fig. 4a). Plants inoculated with A. brasilense harboring the BIF gene had a significantly increased biomass, 1.7 times greater than that of the noninoculated plants and 1.2 times (nonsignificant) greater than that of plants inoculated with A. brasilense wild type or harboring ReOtsA construct (Fig. 4a). There was no substantial increase in biomass in plants inoculated with the wild-type strain compared with noninoculated controls. These results show that there is a greater increase in maize biomass in both root and foliage of A. brasilense expressing the BIF gene (Fig. 4a). Additionally, plants inoculated with A. brasilense containing the BIF gene exhibited a significantly higher plant height and root length compared with noninoculated plants or plants inoculated with the wild-type strain, or A. brasilense carrying the ReOtsA gene (Fig. 4b). These results correlate with the previously described increase in biomass using the same bacterial strain. An interesting observation is the remarkable bulky aspect of maize roots inoculated with A. brasilense containing the BIF gene compared with plants inoculated with the other strains (Fig. 5a).

image

Figure 4.  Maize biomass and size determination. The foliage (white bars) and root (black bars) dry weight (DW) of maize plants after drought and recovery, at 38 days noninoculation with Azospirillum brasilense WT, overexpressing ReOtsA or BIF gene strains was determined (a). The aerial (white bars) and root (black bars) size in maize plants after drought and recovery, at 38 days postinoculation with A. brasilense WT, overexpressing ReOtsA or BIF gene strains was determined (b). Both figures represent the results of two independent experiments. *Means of the samples are different at the 0.05 level (P<0.05). WT, wild type.

Download figure to PowerPoint

image

Figure 5.  Root morphology and bacterial persistence. Photographs from representative maize roots after drought and recovery, at 38 days postinoculation with Azospirillum brasilense WT, overexpressing ReOtsA or BIF gene strains (a). Azospirillum brasilense WT, overexpressing ReOtsA or BIF gene strains, was isolated from maize roots and counted. (b) Both figures represent the results of two independent experiments. *Means of the samples are different at the 0.05 level (P<0.05). WT, wild type.

Download figure to PowerPoint

To determine if trehalose was translocating from A. brasilense to the maize tissues, the trehalose content in maize roots and leaves was determined. No significant levels of the disaccharide could be detected in any of the analyzed tissues from plants inoculated with the different A. brasilense strains (data not shown).

To corroborate the presence of the different A. brasilense strains in the maize plants after drought stress treatment, a root sample from each plant inoculated with the different strains was taken and grown in Congo red plates with their appropriate antibiotic. Azospirillum brasilense (WT, ReOtsA or BIF) was recovered in comparable concentrations in all cases, except for noninoculated plants, which had no bacteria attached to their roots (Fig. 5c). This clearly shows that the strains used to inoculate maize plants remained present throughout the experiment.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Decades of breeding have had limited success in improving drought tolerance in crops due to the multigenic nature of the trait. A more promising strategy is the overexpression of genes conferring tolerance to abiotic stress. Trehalose biosynthesis has been successfully engineered in animal cells and plants to improve stress tolerance (Elbein et al., 2003; Avonce et al., 2004; Paul et al., 2008). In the present work, we developed a novel approach to engineer stress tolerance, namely the overexpression of trehalose biosynthesis genes in A. brasilense, which were then used to inoculate maize plants. We used a yeast TPS–TPP bifunctional enzyme for several reasons: this chimeric construct works in distantly related species such as plants (Miranda et al., 2007), and it has a strong TPP activity, thus avoiding the accumulation of free trehalose-6-phosphate in the cytosol, which is known to provoke pleiotropic effects (De Virgilio et al., 1994; Schluepmann et al., 2004). Secondly, among the five trehalose biosynthetic routes, the TPS–TPP pathway is widely distributed in bacteria, fungi, invertebrates and plants, and the corresponding genes display significant identity. Thirdly, at present, there are no homolog genes available in databases from A. brasilense or closely related species.

First of all, we showed that A. brasilense has an increased tolerance to osmotic stress when it overexpressed either ReOtsA or BIF gene; however, the latter was most efficient (Fig. 1). This might be due to the fact that a bifunctional enzyme, although from a distant phylogenetically related organism such as yeast, works much better in A. brasilense than TPS alone to make trehalose, probably because there is a higher trehalose-6-phosphate accumulation in A. brasilense expressing OtsA compared with cells expressing the BIF gene. Also, higher trehalose levels in A. brasilense correlated with increased stress tolerance. Similarly, the overexpression of ReOtsA in free-living R. etli increased its tolerance to osmotic stress (Suárez et al., 2008). In contrast, mutation of ReOtsA in R. etli impaired stress tolerance. Addition of exogenous trehalose to Bradyrhizobium japonicum confers tolerance to dehydration stress (Streeter, 2003). Interestingly, in other Alphaproteobacteria also capable of fixing atmospheric nitrogen, Sinorhizobium meliloti and B. japonicum, three different trehalose biosynthetic routes have been found (Domínguez-Ferreras et al., 2006; Cytryn et al., 2007). Transcription induction of their corresponding genes correlates with an increased level of trehalose, supporting an important role of this disaccharide in desiccation tolerance. A striking result is the overaccumulation of trehalose when the A. brasilense strains harboring ReOtsA or BIF genes were subjected to osmotic stress (Fig. 1). We have observed the same effect in R. etli overexpressing trehalose with the same construct harboring ReOtsA gene and lacZ promoter (Suárez et al., 2008). This might be due either to the stress induction of the other trehalose biosynthetic pathways or to repression of the trehalose catabolic enzyme, or alternatively it is possible that the lacZ promoter used to overexpress the BIF gene in R. etli and A. brasilense might be stress induced.

We also examined the effects of inoculating maize plants with A. brasilense overexpressing either the ReOtsA or the BIF gene. Our results clearly show that the overexpression of the BIF gene in A. brasilense interacting with maize plants caused an increased drought tolerance (Figs 2 and 3). As far as we know, this is the first report of engineering drought tolerance in a grass crop by a different method than plant breeding or plant transformation. An intriguing question is whether trehalose is being transported from the bacteria to the plant, as we could not detect the disaccharide in plant tissues. We hypothesized that very small amounts of trehalose translocate to the maize roots and signal stress tolerance pathways in the plant. It is well established that trehalose plays a role as a signaling molecule (Paul et al., 2008). Sugars signal growth, development and stress responses in plants and are considered to be hormone-like molecules (Rolland et al., 2006). Alterations of trehalose-6-phosphate levels have demonstrated that this metabolic intermediate is indispensable for carbohydrate utilization for plant growth (Schluepmann et al., 2003). Arabidopsis plants overexpressing AtTPS1 are drought tolerant, insensitive to glucose and abscisic acid, and have shown an altered expression of HXK1 and ABI4 genes (Avonce et al., 2004).

Another set of interesting results in the present study is a link between trehalose accumulation in A. brasilense and a significant increase in plant biomass. Remarkably, larger and bulky maize roots were found in plants inoculated with A. brasilense containing the BIF gene, suggesting that trehalose plays a role in root growth (Figs 4 and 5). Recently, we reported that inoculation of common bean plants with R. etli overexpressing trehalose caused a significant increase in biomass and grain yield (Suárez et al., 2008). A transcriptomics analysis of plant nodules in symbiosis with R. etli overexpressing trehalose, revealed induction of several genes involved in stress tolerance, carbon and nitrogen metabolism. However, so far there is no clear evidence as to how bacterial trehalose could regulate these plant genes. Although inoculation with A. brasilense Cd increased grain yield through improved utilization of soil moisture (Sarig et al., 1988), our present results show that the overexpression of the BIF gene in A. brasilense Cd led to an enhancement in aerial and root biomass over the wild-type Cd strain, suggesting that it might also lead to a greater increase in maize crop yield. Therefore, A. brasilense engineered with the BIF gene is a potential tool to improve drought tolerance, biomass and possibly yield in economically important grass crops.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported by CYTED-Spain (grant 107PIC0312 to G.I). We are indebted to Lourdes Martínez-Aguilar (Centro de Ciencias Genómicas-UNAM, Cuernavaca, Mexico) for her kind technical assistance.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Avonce N, Leyman B, Mascorro-Gallardo JO, Van Dijck P, Thevelein JM & Iturriaga G (2004) The Arabidopsis trehalose-6-P synthase AtTPS1 gene is a regulator of glucose, abscisic acid, and stress signaling. Plant Physiol 136: 36493659.
  • Avonce N, Mendoza-Vargas A, Morett E & Iturriaga G (2006) Insights on the evolution of trehalose biosynthesis. BMC Evol Biol 6: 109.
  • Bartels D & Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev Plant Sci 24: 2358.
  • Bashan Y & De-Bashan L (2005) Bacteria/plant growth-promotion. Encyclopedia of Soils in the Environment, Vol. 1 (HillelD, ed), pp. 103115. Elsevier, Oxford, UK.
  • Boyer JS (1982) Plant productivity and environment. Science 218: 443448.
  • Bray EA, Bailey-Serres J & Weretilnyk E (2000) Responses to abiotic stresses. Biochemistry and Molecular Biology of Plants (GruissemW, BuchananB & JonesR, eds), pp. 11581203. American Society of Plant Physiologists, Rockville, MD.
  • Caballero-Mellado J, Carcaño-Montiel MG & Mascarúa-Esparza MA (1992) Field inoculation of wheat (Triticum aestivum) with Azospirillum brasilense under temperate climate. Symbiosis 13: 243253.
  • Cytryn EJ, Sangurdekar DP, Streeter JG, Franck WL, Chang WK, Satcey G, Emerich DW, Joshi T, Xu D & Sadowsky MJ (2007) Transcriptional and physiological responses of Bradyrhizobium japonicum to desiccation-induced stress. J Bacteriol 189: 67516762.
  • De Virgilio C, Hottiger T, Domínguez J, Boller T & Wiemken A (1994) The role of trehalose synthesis for the acquisition of thermotolerance in yeast. I. Genetic evidence that trehalose is a thermoprotectant. Eur J Biochem 219: 179186.
  • Dobbelaere S, Croonenborghs A, Thys A et al. (2001) Responses of agronomically important crops to inoculation with Azospirillum. Aust J Plant Physiol 28: 871879.
  • Dobbelaere S, Vanderleyden J & Okon Y (2003) Plant growth-promoting effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci 22: 107149.
  • Döbereiner J, Marriel IE & Nery M (1976) Ecological distribution of Spirillum lipoferum Beijerinck. Can J Microbiol 22: 14641472.
  • Domínguez-Ferreras A, Pérez-Arnedo R, Becker A, Olivares J, Soto MJ & Sanjuán J (2006) Transcriptome profiling reveals the importance of plasmid pSymB for osmoadaptation of Sinorhizobium meliloti. J Bacteriol 188: 76177625.
  • Elbein AD, Pan YT, Pastuszak I & Carroll D (2003) New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17R27R.
  • Eskew DL, Focht DD & Ting IP (1977) Nitrogen fixation, denitrification, and pleomorphic growth in a highly pigmented Spirillum lipoferum. Appl Environ Microb 34: 582585.
  • Gaxiola RA, Li J, Undurraga S, Dang LM, Allen GJ, Alper SL & Fink GR (2001) Drought- and salt-tolerant plants result from overexpression of the AVP1 H+ -pump. P Natl Acad Sci USA 98: 1144411449.
  • Hartmann A, Singh M & Klingmuller W (1983) Isolation and characterization of Azospirillum mutants excreting high amounts of indoleacetic acid. Can J Microbiol 29: 916923.
  • Heulin T, Rahman M, Omar AMN, Rafidison Z, Pierrat JC & Balandreau J (1989) Experimental and mathematical procedures for comparing N2-fixing efficiencies of rhizosphere diazotrophs. J Microbiol Meth 9: 163173.
  • Kapulnik Y, Gafni R & Okon Y (1985) Effect of Azospirillum spp. inoculation on root development and NO3-uptake in wheat (Triticum aestivum cv. Miriam) in hydroponic systems. Can J Bot 63: 627631.
  • Kovach ME, Phillips RW, Elzer PH, Roop RM & Peterson KM (1995) Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175176.
  • Lin W, Okon Y & Hardy RWF (1983) Enhanced mineral uptake by Zea mays and Sorghum bicolor roots inoculated with Azospirillum brasilense. Appl Environ Microb 45: 17751779.
  • Miranda J, Avonce N, Suárez R, Thevelein J, Van Dijck P & Iturriaga G (2007) A bifunctional TPS–TPP enzyme from yeast confers tolerance to multiple and extreme abiotic-stress conditions in transgenic Arabidopsis. Planta 226: 14111421.
  • Morrissey J, Dow J, Mark L & O'Gara F (2004) Are the microbes at the root solution to the world food production? EMBO Rep 5: 922926.
  • Paul MJ, Primavesi LF, Jhurreea D & Zhang Y (2008) Trehalose metabolism and signaling. Annu Rev Plant Biol 59: 417441.
  • Rodríguez-Cáceres EA (1982) Improved medium for isolation of Azospirillum spp. Appl Environ Microb 44: 990991.
  • Rolland F, Baena-Gonzalez E & Sheen J (2006) Sugar sensing and signaling in plants: conserved and novel mechanisms. Annu Rev Plant Biol 57: 675709.
  • Sambrook J & Russell DW (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • Sarig S, Blum A & Okon Y (1988) Improvement of the water status and yield of field-grown grain sorghum (Sorghum bicolor) by inoculation with Azospirillum brasilense. J Agr Sci Camb 110: 271277.
  • Schluepmann H, Pellny T, Van Dijken A, Smeekens S & Matthew P (2003) Trehalose 6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. P Natl Acad Sci USA 100: 68496854.
  • Schluepmann H, Van Dijken A, Aghdasi M, Wobbes B, Paul M & Smeekens S (2004) Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. Plant Physiol 135: 879890.
  • Streeter JG (2003) Effect of trehalose on survival of Bradyrhizobium japonicum during desiccation. J Appl Microbiol 95: 484491.
  • Suárez R, Wong A, Ramírez M, Barraza A, Orozco MC, Cevallos MA, Lara M, Hernández G & Iturriaga G (2008) Improvement of drought tolerance and grain yield in common bean by overexpressing trehalose-6-phosphate synthase in rhizobia. Mol Plant Microbe In 21: 958966.
  • Umali-García M, Hubbell DH, Gaskins MH & Dazzo FB (1980) Association of Azospirillum with grass roots. Appl Environ Microb 39: 219226.
  • Van de Broek A, Michiels J, Van Gool A & Vanderleyden J (1993) Spatial temporal colonization patterns of Azospirillum brasilense on the wheat root surface and expression of the bacterial nifH gene during association. Mol Plant Microbe In 6: 592600.
  • Vogel G, Aeschbacher RA, Müller J, Boller T & Wiemken A (1998) Trehalose-6-phosphate phosphatase from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant. Plant J 13: 673683.