SEARCH

SEARCH BY CITATION

Keywords:

  • Vibrio parahaemolyticus;
  • type III secretion system 1;
  • virulence regulation

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Vibrio parahaemolyticus, one of the human pathogenic vibrios, causes gastroenteritis, wound infections and septicemia. Genomic sequencing of this organism revealed that it has two distinct type III secretion systems (T3SS1 and T3SS2). T3SS1 plays a significant role in lethal activity in a murine infection model. It was reported that expression of the T3SS1 gene is controlled by a positive regulator, ExsA, and a negative regulator, ExsD, which share a degree of sequence similarity with Pseudomonas aeruginosa ExsA and ExsD, respectively. However, it is unknown whether T3SS1 is regulated by a mechanism similar to that demonstrated for P. aeruginosa, because functional analysis of VP1701, which is homologous to ExsC, is lacking and there is no ExsE homologue in the T3SS1 region. Here, we demonstrate that vp1701 and vp1702 are functional orthologues of exsC and exsE, respectively, of P. aeruginosa. VP1701 was required for the production of T3SS1-related proteins. VP1702 was a negative regulator for T3SS1-related protein production and was secreted by T3SS1. We also found that H-NS represses T3SS1-related gene expression by suppressing exsA gene expression. These findings indicate that the transcription of V. parahaemolyticus T3SS1 genes is regulated by a dual regulatory system consisting of the ExsACDE regulatory cascade and H-NS.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Vibrio parahaemolyticus, one of the human pathogenic vibrios, causes seafood-associated gastroenteritis (Honda & Iida, 1993). Although this microorganism is better known for causing gastroenteritis, it may also cause wound infection and septicemia (Ryan, 1976; Mertens et al., 1979; Daniels et al., 2000). It has been reported that clinical isolates of this organism have two sets of genes for separate type III secretion systems (T3SSs) on chromosomes 1 and 2 (T3SS1 and T3SS2, respectively) (Makino et al., 2003). A functional analysis of T3SS1 revealed that it predominantly contributes to V. parahaemolyticus-induced cytotoxicity in vitro and is involved in lethal activity in a murine infection model in vivo (Ono et al., 2006; Hiyoshi et al., 2010). These results implicate T3SS1 in V. parahaemolyticus-induced septicemia in humans.

The T3SS1 gene cluster of V. parahaemolyticus is composed of 42 genes, of which 30 genes are similar to those of the T3SS gene apparatus of Yersinia sp. and Pseudomonas aeruginosa (Makino et al., 2003; Park et al., 2004; Ono et al., 2006). In the middle region of the T3SS1 gene cluster, there are 12 coding sequences (CDSs), which may encode effector proteins and their chaperones (Ono et al., 2006; Casselli et al., 2008; Akeda et al., 2009). At the terminus region of the T3SS1 gene cluster, there are three genes, VP1698, VP1699 and VP1701, that share sequence similarities with P. aeruginosa T3SS regulatory proteins ExsD (22% identity, 40% similarity), ExsA (45% identity, 64% similarity) and ExsC (32% identity, 48% similarity), respectively (Fig. 1a).

image

Figure 1.  VP1701 and VP1702 are involved in the regulation of T3SS1-related protein production. (a) Comparison of the gene organization of exs genes in Vibrio parahaemolyticus and Pseudomonas aeruginosa. The genetic organization of the ExsA and ExsD loci in T3SS1 were compared with those in P. aeruginosa PAO1. Numbers represent amino acid sequence identities and similarities compared with P. aeruginosa PAO1. (b) Effects of exsA (vp1699), exsD (vp1698), vp1701 (putative exsC) and vp1702 gene deletion on the expression of T3SS1-related proteins (VscC1 and VepA). Immunoblot analysis of the bacterial pellets (ppt.) and supernatants (sup.) of isogenic V. parahaemolyticus mutant strains. Blots were probed with anti-VscC1 and anti-VepA antibodies. (c) Bacterial pellets (ppt.) and supernatants (sup.) of the indicated deletion mutant strains and their complemented strains were probed with anti-VepA antibody. (d) VP1702 is specifically secreted via T3SS1. Immunoblot analysis of bacterial supernatants (sup.) from the WT (lane 1), a T3SS1-deficient strain derived from the WT (ΔvscN1) (lane 2) and a T3SS2-deficient strain derived from the WT (ΔvscN2) (lane 3), which were probed with anti-VP1702, anti-VepA or anti-TDH.

Download figure to PowerPoint

The expression of P. aeruginosa T3SS is highly regulated and is induced by contact with host cells and low Ca2+ concentrations (Iglewski et al., 1978; Frank, 1997; Vallis et al., 1999). Transcription of the genes in the P. aeruginosa T3SS gene cluster is controlled by a regulatory cascade involving three interacting proteins (ExsC, ExsD and ExsE) that regulate ExsA transcriptional activity (Yahr & Wolfgang, 2006). ExsA is a member of the AraC family of transcriptional activators, and is a positive transcription activator required for the expression of all T3SS genes (Frank et al., 1994; Yahr & Frank, 1994; Hovey & Frank, 1995). ExsD acts as an antiactivator by directly binding to ExsA (McCaw et al., 2002). Consequently, the exsD mutant expresses the type III secretion regulon constitutively, even in the presence of calcium. ExsC functions as an anti-anti-activator by binding directly to and inhibiting ExsD (Dasgupta et al., 2004). Consequently, overexpression of ExsC results in a constitutive expression of the T3SS regulon, and deletion of exsC renders the cell incapable of inducing type III secretion genes, even under low-calcium conditions. ExsE is a secreted substrate of T3SS and interacts with the anti-anti-activator, its cognate T3SS chaperone ExsC (Rietsch et al., 2005; Urbanowski et al., 2005). An exsE-null mutant constitutively expresses T3SS effector proteins such as exoU, exoS and exoT, whereas overexpression of ExsE prevents the induction of the regulon. Based on these studies, a simple model has been proposed for the association between transcription and secretory activity. Under high Ca2+ conditions, ExsE binding to anti-anti-activator ExsC disrupts the complex between ExsC and ExsD, thereby allowing free ExsD to bind ExsA. In contrast, ExsE is released extracellularly following the activation of the type III secretion machinery at low Ca2+ concentrations. A decreased level of intracellular ExsE allows ExsC to sequester ExsD, thus liberating ExsA, which then activates the transcription of the T3SS genes of P. aeruginosa (Yahr & Wolfgang, 2006).

In the case of V. parahaemolyticus T3SS1, the genes for three proteins, VP1698, VP1699 and VP1701, that share sequence similarities with the Pseudomonas ExsD, ExsA and ExsC, respectively, have been identified (Fig. 1a). A previous study suggested that VP1698 and VP1699 are functionally orthologous to ExsD and ExsA, respectively, of Pseudomonas (Zhou et al., 2008). However, experimental evidence showing that VP1701 is a functional homologue of ExsC is lacking. Moreover, sequence annotation of the T3SS1 gene cluster of V. parahaemolyticus did not identify any CDSs predicted to encode homologues of ExsE. Thus, it is unclear whether a regulatory mechanism similar to that in P. aeruginosa is used by the T3SS1 system of V. parahaemolyticus. In this study, we identified vp1701 and vp1702 as functionally orthologous genes of exsC and exsE from P. aeruginosa and showed that T3SS1 gene expression is regulated in a fashion similar to that of the ExsACDE regulatory cascade of P. aeruginosa. Moreover, we demonstrated a role for H-NS in the negative regulation of the expression of the exsA gene.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Bacterial strains and plasmids

The V. parahaemolyticus strain RIMD2210633 (Makino et al., 2003) was used as the wild type (WT) in this study. The deletion mutants were constructed using a suicide vector, pYAK1 (R6Kori, sacB, cat), as reported previously (Kodama et al., 2002, 2007, 2008). The strains and plasmids used in this study are listed in Table 1. The primers used for plasmid construction are listed in Table 2.

Table 1.   Bacterial strains and plasmids used in this study
Strains or plasmidsDescriptionSources or references
Vibrio parahaemolyticus
 WT (KXV237)RIMD2210633 (KP positive, serotype O3:K6)Makino et al. (2003)
 Δhnshns (vp1133) deletion mutant derived from the WTThis study
 ΔexsAexsA (vp1699) deletion mutant derived from the WTThis study
 ΔexsCexsC (vp1701) deletion mutant derived from the WTThis study
 ΔexsDexsD (vp1698) deletion mutant derived from the WTThis study
 Δvp1702vp1702 deletion mutant derived from the WTThis study
 ΔhnsΔexsAhns (vp1133) and exsA (vp1699) deletion mutant derived from the WTThis study
 ΔvscN1T3SS1-deficient strain; vscN1 (vp1668) deletion mutant derived from the WTThis study
 ΔvscN2T3SS2-deficient strain; vscN2 (vpa1338) deletion mutant derived from the WTThis study
Plasmids
 pHRP309lacZ transcriptional fusion vector, GmrParales & Harwood (1993)
 p309-pro-exsADerivative of pHRP309, containing the exsA promoter (from −620 to +150 bp)This study
 pSA19CP-MCSComplement vector for V. parahaemolyticus, CprNomura et al. (2000)
 pSA-hnsDerivative of pSA19CP-MCS, containing the hns (vp1133) geneThis study
 pexsADerivative of pSA19CP-MCS, containing the exsA (vp1699) geneThis study
 pexsDDerivative of pSA19CP-MCS, containing the exsD (vp1698) geneThis study
 Pvp1701Derivative of pSA19CP-MCS, containing the exsC (vp1701) geneThis study
 Pvp1702Derivative of pSA19CP-MCS, containing the vp1702 geneThis study
 pYAK1R6Kori suicide vector containing the sacB geneKodama et al. (2002, 2007, 2008)
 pYAK1-ΔhnsDerivative of suicide vector pYAK1 for generating hns (vp1133) deletion mutantsThis study
 pYAK1-ΔexsADerivative of suicide vector pYAK1 for generating exsA (vp1699) deletion mutantsThis study
 pYAK1-Δvp1701Derivative of suicide vector pYAK1 for generating exsC (vp1701) deletion mutantsThis study
 pYAK1-ΔexsDDerivative of suicide vector pYAK1 for generating exsD (vp1698) deletion mutantsThis study
 pYAK1-Δvp1702Derivative of suicide vector pYAK1 for generating vp1702 deletion mutantsThis study
Table 2.   Sequence of the primers used in this study
PrimersSequence (5′–3′)
For gene deletion
 delhns-1ATATCATGGATCCTCTAATAT
 delhns-2AATTGCAGAAGGTGTTTTAATCGTTACGAT
 delhns-3ATCGTAACGATTAAAACACCTTCTGCAATT
 delhns-4TGTGCCTAACTGCAGCAAGCA
 del1698-1TCGAAAGGGATCCGGAGAAGA
 del1698-2ATGCATCCCAGACTTAGACGCATGGCAAAA
 del1698-3TTTTGCCATGCGTCTAAGTCTGGGATGCAT
 del1698-4AAGTGGTACTGCAGTTTCCCA
 del1699-1AATGGCGGATCCTAAGCTATT
 del1699-1AAGCTCTTGGAGAGAATTGACCATTGTGAA
 del1699-1TTCACAATGGTCAATTCTCTCCAAGAGCTT
 del1699-1TTTCGAACACTGCAGAATGAA
 del1701-1TATTTATTCTGCAGATGGACA
 del1701-2TTGCGTCAACAATTCGCGTGCTGACATAGA
 del1701-3TCTATGTCAGCACGCGAATTGTTGACGCAA
 del1701-4TTTTCAGGATCCAAGACTTGA
 del1702-1ACGCTGCAACTGCAGGCGGAA
 del1702-2TATCTTTCGCTCAAAGTGAATGGGTTGGCT
 del1702-3AGCCAACCCATTCACTTTGAGCGAAAGATA
 del1702-4CGAATTTGGATCCACTGTTAC
For complementation
 HNSCompl1GGATCCCGTAAAACTTGAATT
 HNSCompl2GTCGACAAATAAAAAAGGCTC
 vec1698FCCATGGAGGGATCCATTCTGGAGTGTTCGAAAGGGATGCG
 vec1698RCTCGAGTTAAATCTGGCTGAGATGGTTACAAGCC
 vec1699FCCATGGAGGGATCCAAAAATTATGAAGGGTTGAAAATGGATGTGTCAG
 vec1699RCTCGAGTCAATTCGCGATGGCGACTTGC
 vec1701FCCATGGAGGGATCCATTCTCAAAAGGACTGTTTCTATGTCAGCACGC
 vec1701RCTCGAGCTAAACTCTCAGATCTAAACTTTGAGGC
 vec1702FCCATGGAGGGATCCATCGGAGAGTTTAGGTGTCTTATGTCTAATGAC
 vec1702RAGAGATGAGTTTCTGCTCCCTTTCGCTTCGAGCAATCACATC

Immunoblot analysis

Vibrio parahaemolyticus strains were grown overnight in Luria–Bertani (LB) broth containing 3% NaCl. Cultures were then diluted 1 : 100 with LB broth containing 1.0% NaCl with or without 5 mM CaCl2 and grown with shaking at 37 °C for 3 h. After incubation, bacterial cultures were centrifuged and the bacterial pellets were solubilized with SDS sample buffer [50 mM Tris (pH 6.8), 2% SDS, 0.6% 2-mercaptoethanol, 10% glycerol, 1% bromophenol blue]. Secreted proteins were harvested by precipitation with cold trichloroacetic acid to a final concentration of 10% v/v on ice for 1 h, followed by centrifugation at 48 000 g for 1 h. The pellets were rinsed in cold acetone and then solubilized in the SDS sample buffer.

Samples for Western blot analysis were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The transferred membrane was blocked with 5% skimmed milk in Tris-buffered saline [20 mM Tris, 137 mM NaCl (pH 7.6)] containing 0.05% Tween 20 and probed with anti-VscC1, anti-VopD1 (Park et al., 2004), anti-VepA (VP1680) (Akeda et al., 2009), anti-ExsE and anti-TDH polyclonal antibodies diluted 1 : 10 000 in Can Get Signal Solution 1 (Toyobo) (Hiyoshi et al., 2010) and were then probed with horseradish peroxidase-conjugated goat anti-rabbit antibody (Zymed) diluted 1 : 10 000 in Can Get Signal Solution 2 (Toyobo). The blots were developed using an ECL Western blotting kit (Amersham).

Reporter gene assay

Vibrio parahaemolyticus strains harboring a reporter plasmid containing the V. parahaemolyticus exsA promoter region (from −620 to +150 bp) were grown for 1 h at 37 °C in LB broth containing 1.0% NaCl. β-Galactosidase activity was assayed in cell lysates by the method of Miller (1972) using o-nitrophenyl-β-d-galactopyranoside as a substrate.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Identification of functionally orthologous genes of P. aeruginosa exsC and exsE in V. parahaemolyticus

As mentioned above, there were no predicted CDS in the V. parahaemolyticus genome that corresponded to P. aeruginosa exsE. However, we observed that a hypothetical CDS (VP1702) was encoded at the terminus region of the T3SS1 gene cluster, which contains several CDSs homologous to P. aeruginosa ExsA, ExsD and ExsC proteins (Fig. 1a). Therefore, we first constructed gene deletion mutant strains Δvp1701exsC) and Δvp1702 in addition to ΔexsAvp1699) and ΔexsDvp1698) and determined the effect of gene deletion on the production of the T3SS1-related proteins (VscC1; an outer-membrane component of the type III protein secretion machinery and VepA; a T3SS1-specific effector protein involved in T3SS1-dependent cytotoxicity) (Akeda et al., 2009; Kodama et al., 2010). As reported previously, deletion of exsA (vp1699) reduced the level of VscC1 in bacterial pellets and the level of VepA in both bacterial pellets and the supernatant, whereas production of these proteins was clearly induced in the exsD (vp1698) mutant (Fig. 1b). As expected, the Δvp1701 mutant did not produce VscC1 or VepA. Interestingly, although VP1702 had no significant homology to any other protein in a blast search, a vp1702-null mutant (Δvp1702) produced T3SS1-related proteins, suggesting that vp1702 is also involved in the production of T3SS1-related proteins (Fig. 1b). Analysis of the production and secretion profile of the VepA protein in each complement strain revealed that complementation with exsA or vp1701 increased the amount of VepA protein, whereas complementation with exsD or vp1702 suppressed VepA protein production (Fig. 1c). The production and secretion profiles of the VepA protein in the vp1701 gene deletion and complementation strains were similar to those of the exsC deletion mutant of P. aeruginosa, indicating that VP1701 is orthologous to ExsC. That there was no homologue of the P. aeruginosa exsE gene in the V. parahaemolyticus T3SS1 region and VP1702 exerted a negative regulatory effect on the production of T3SS1-related proteins prompted us to examine the possibility that VP1702 is a functional equivalent of P. aeruginosa ExsE. As T3SS-dependent secretion is characteristic of ExsE, we then determined whether VP1702 is a specific substrate for T3SS1 using immunoblotting (Fig. 1d). As expected, VP1702 was not detected in the supernatants of the nonfunctional T3SS1 mutant strain (ΔvscN1). In contrast, the nonfunctional T3SS2 mutant strain (ΔvscN2) secreted VP1702 protein in the supernatants, indicating that VP1702 is specifically secreted by T3SS1. These results indicate that VP1702 is a functional equivalent of ExsE and T3SS1 gene expression is regulated by the ExsACDE regulatory cascade, similar to the regulation in P. aeruginosa.

Characterization of T3SS1 secretion in exsA, exsD, exsC and exsE deletion mutants under low or high Ca2+ concentrations

It is well known that extracellular calcium concentration is a potent signal for the induction of T3SS expression in P. aeruginosa. This type of transcriptional regulation is intimately coupled with type III secretory activity: transcription is repressed when the secretion channel is closed (high Ca2+ level) and is derepressed when the secretion channel is open (low Ca2+ level). Therefore, the effect of extracellular calcium concentration on the production of T3SS1-related proteins (VscC1 and VepA) was examined using immunoblotting. These proteins were detected in the bacterial pellet and the supernatant in the absence of calcium (inducing conditions), whereas the production of these proteins was repressed by the addition of CaCl2 (noninducing conditions) (Fig. 2a). We next determined the effect of the exs gene deletions on low-calcium-dependent production of VepA using immunoblotting (Fig. 2b). The ΔexsA and the ΔexsC strains did not express or secrete VepA, even under inducing conditions. In contrast, deletion of exsD or vp1702 resulted in derepression of VepA in the bacterial pellet. Although the production of VepA in the bacterial pellet was clearly induced in the ΔexsD and Δvp1702 strains, even under noninducing conditions, secretion still depended on the removal of extracellular calcium. These results suggest that VP1701 (ExsC of V. parahaemolyticus) functions as an anti-anti-activator for T3SS1 and that vp1702 is a functionally equivalent protein of P. aeruginosa ExsE. Taken together, V. parahaemolyticus possesses a full set of the exsACDE regulatory system, which is similar to that of P. aeruginosa and which regulates T3SS1-related gene expression.

image

Figure 2.  Characterization of T3SS1 secretion in exsA, exsD, exsC and vp1702 deletion mutants under low or high Ca2+ conditions. (a) Wild-type (WT) Vibrio parahaemolyticus was grown in the presence or absence of calcium. Bacterial pellets (ppt.) and culture supernatants (sup.) were subjected to immunoblotting using antibodies against VscC1 and VepA. (b) The indicated strains were grown in the presence (+) or absence (−) of calcium. Bacterial pellets (ppt.) and culture supernatants (sup.) were subjected to immunoblotting using antibodies against VepA.

Download figure to PowerPoint

Repression of T3SS1-related protein expression by H-NS

H-NS is a major component of the bacterial nucleoid and plays a crucial role in global gene regulation in enteric bacteria (Varshavsky et al., 1977; Hulton et al., 1990). H-NS affects the expression of many unrelated genes and several virulence genes in Salmonella enterica serovar Typhimurium, Shigella sp. and Vibrio cholerae (Maurelli & Sansonetti, 1988; Hulton et al., 1990; Tobe et al., 1993; Harrison et al., 1994; O'Byrne & Dorman, 1994; Nye et al., 2000). Therefore, we examined the possibility that T3SS1 genes are part of the H-NS regulon. As shown in Fig. 3a, the production of VscC1 and VepA proteins in a Δhns strain was considerably increased in both the bacterial pellet and the supernatant compared with that of the WT. A ΔhnsΔexsA mutant strain did not exhibit increased production of these proteins (Fig. 3b), suggesting that exsA is necessary for overproduction of T3SS1-related proteins via hns gene deletion. We next examined the possibility that H-NS represses exsA expression using an exsA–lacZ transcriptional fusion reporter (Fig. 3c). Transcription of exsA–lacZ was dramatically increased in the hns deletion strain compared with that in the WT. The increase in exsA–lacZ transcription in the hns deletion strain was suppressed by in trans complementation with the hns gene. These results indicate that H-NS represses T3SS1-related gene expression by suppressing exsA gene expression.

image

Figure 3.  Expression of exsA is repressed by H-NS. (a) Deletion of the hns gene results in a high level of T3SS1-related protein (VscC1 and VepA) expression. (b) Increased T3SS1-related protein (VscC1 and VepA) production induced by deletion of the hns gene is mediated by exsA. Bacterial pellets (ppt.) and culture supernatants (sup.) from isogenic V. parahaemolyticus mutant strains were subjected to Western blotting using antibodies against VscC1 and VepA. (c) H-NS-mediated repression of the exsA promoter. The V. parahaemolyticus WT strain and an hns gene-deficient strain (Δhns) harboring the exsA–lacZ fusion plasmid (p309-pro-exsA) were transformed with the hns gene complement vector, pSA-hns. β-Galactosidase activity is expressed in Miller units. The values are the average of three separate experiments with SDs.

Download figure to PowerPoint

In summary, we identified VP1701 and VP1702 of V. parahaemolyticus as functional orthologues of P. aeruginosa ExsC and ExsE, respectively. As VP1701 has sequence similarity with its counterpart, it was not difficult to predict its function. Indeed, the production of T3SS1-related proteins was repressed in a Δvp1701 mutant and derepressed by complementation of the vp1701 gene (Fig. 1b and c). Unlike ExsA (VP1699), ExsD (VP1698) and ExsC (VP1701), sequence annotation of the T3SS1 region on the genome of V. parahaemolyticus did not reveal any CDSs predicted to encode the homologue of P. aeruginosa ExsE. However, we found that one hypothetical CDS (VP1702) was encoded next to the vp1701 (exsC) gene. Deletion of the vp1702 gene deregulated the production of T3SS1-related proteins. Furthermore, VP1702 itself was a substrate for the T3SS1 secretion system. These properties of VP1702 of V. parahaemolyticus conform with those of its counterpart in P. aeruginosa. In P. aeruginosa, the coupling of transcription to secretion is mediated by three interacting proteins (ExsC, ExsE and ExsD) that regulate ExsA transcription activity (Yahr & Wolfgang, 2006). Although it is still unknown whether ExsC, ExsE and ExsD of V. parahaemolyticus constitute a regulatory complex that depends on extracellular calcium concentration, it is likely that VP1701 (ExsC) could be a cognate chaperone of VP1702 (ExsE), and a complete ExsACDE regulatory system is active in T3SS1 gene expression. We also demonstrated that H-NS is involved in the expression of T3SS1 genes as a suppressive factor. This suppressive effect of H-NS on the production of T3SS1 proteins was mediated by repression of ExsA expression, suggesting that ExsA is a master regulator of T3SS1 gene expression. As far as we are aware, this is the first report of an association between the H-NS and ExsACDE regulatory systems.

The ExsACDE regulatory system is a highly sophisticated transcriptional regulatory system that induces T3SS gene expression when a bacterium establishes contact with host cells (Yahr & Wolfgang, 2006). Expression of genes affected by H-NS is typically induced by environmental stimuli such as temperature (Falconi et al., 1998; Prosseda et al., 1998). Therefore, the combination of these two regulatory mechanisms appears to constitute the gene expression system that exerts lethality in the murine infection model that we recently used as an in vivo phenotype characteristic of T3SS1 (Hiyoshi et al., 2010). Taken together, our findings contribute to the knowledge on how V. parahaemolyticus causes wound septicemia.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

This work was supported by Grants-in-Aid for Young Scientists and Scientific Research on Priority Areas Applied Genomics and Matrix of Infection Phenomena from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References