Characterization of antimicrobial resistance in Salmonella enterica food and animal isolates from Colombia: identification of a qnrB19-mediated quinolone resistance marker in two novel serovars

Authors

  • Maria Karczmarczyk,

    1. Centres for Food Safety & Food-borne Zoonomics, UCD Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland
    Search for more papers by this author
  • Marta Martins,

    1. Centres for Food Safety & Food-borne Zoonomics, UCD Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland
    2. Unit of Mycobacteriology and UPMM, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa (IHMT/UNL), Lisbon, Portugal
    Search for more papers by this author
  • Matthew McCusker,

    1. Centres for Food Safety & Food-borne Zoonomics, UCD Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland
    2. Cost Action BM0701 (ATENS), Monteria, Colombia
    Search for more papers by this author
  • Salim Mattar,

    1. Faculty of Veterinary Medicine, Universidad de Cordoba, Monteria, Colombia
    Search for more papers by this author
  • Leonard Amaral,

    1. Unit of Mycobacteriology and UPMM, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa (IHMT/UNL), Lisbon, Portugal
    2. Cost Action BM0701 (ATENS), Monteria, Colombia
    Search for more papers by this author
  • Nola Leonard,

    1. Centres for Food Safety & Food-borne Zoonomics, UCD Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland
    Search for more papers by this author
  • Frank M. Aarestrup,

    1. Research Group for Antimicrobial Resistance and Molecular Epidemiology, National Food Institute, Technical University of Denmark, Copenhagen V, Denmark
    2. Department for Microbiology and Risk Assessment; National Food Institute, Technical University of Denmark; Copenhagen V, Denmark
    Search for more papers by this author
  • Séamus Fanning

    1. Centres for Food Safety & Food-borne Zoonomics, UCD Veterinary Sciences Centre, University College Dublin, Belfield, Dublin, Ireland
    2. Cost Action BM0701 (ATENS), Monteria, Colombia
    Search for more papers by this author

  • Editor: Stefan Schwarz

Correspondence: Séamus Fanning, Centres for Food Safety & Food-borne Zoonomics, UCD Veterinary Sciences Centre, University College Dublin, Belfield, Dublin 4, Ireland. Tel.: +353 1 716 6082; fax: +353 1 716 6091; e-mail: sfanning@ucd.ie

Abstract

Ninety-three Salmonella isolates recovered from commercial foods and exotic animals in Colombia were studied. The serotypes, resistance profiles and where applicable the quinolone resistance genes were determined. Salmonella Anatum (n=14), Uganda (19), Braenderup (10) and Newport (10) were the most prevalent serovars, and resistance to tetracycline (18.3%), ampicillin (17.2%) and nalidixic acid (14%) was most common. Nalidixic acid-resistant isolates displayed minimum inhibitory concentrations ranging from 32 to 1024 μg mL−1. A Thr57→Ser substitution in ParC was the most frequent (12 of the 13 isolates). Six isolates possessed an Asp87→Tyr substitution in GyrA. No alterations in GyrA in a further seven nalidixic acid-resistant isolates were observed. Of these, four serovars including two Uganda, one Infantis and a serovar designated 6,7:d:-, all carried qnrB19 genes associated with 2.7 kb plasmids, two of which were completely sequenced. These exhibited 97% (serovar 6,7:d:- isolate) and 100% (serovar Infantis isolate) nucleotide sequence identity with previously identified ColE-like plasmids. This study demonstrates the occurrence of the qnrB19 gene associated with small ColE plasmids hitherto unrecognized in various Salmonella serovars in Colombia. We also report unusual high-level quinolone resistance in the absence of any DNA gyrase mutations in serovars S. Carrau, Muenchen and Uganda.

Introduction

Salmonellosis is a classic food-borne infection that constitutes a major public health problem. Contaminated food of animal origin including eggs, meat, unpasteurized dairy products, seafood, fruits and vegetables are sources of infections with Salmonella spp. (Mead et al., 1999).

Antimicrobial-resistant salmonellae constitute a health hazard due to the increased risk of therapeutic failure in cases where chemotherapy is indicated. Fluoroquinolones are the drugs of choice to treat invasive, life-threatening salmonellosis. In these zoonotic pathogens, the emergence of fluoroquinolone resistance or reduced susceptibility is particularly challenging (Tollefson et al., 1997; Dimitrov et al., 2007).

Quinolone resistance in Salmonella spp. is principally caused by mutations in the target enzymes, DNA gyrase and topoisomerase IV (Griggs et al., 1996; Piddock et al. 1998; Piddock, 2002; Eaves et al., 2004). Other mechanisms such as increased activity of efflux pumps, decreased permeability due to loss of porins and a variety of plasmid-mediated quinolone resistance (PMQR) mechanisms also contribute to resistance and/or decreased susceptibility, one of the latter being the qnr gene (Martínez-Martínez et al., 1998; Piddock, 2002; Robicsek et al., 2005; Giraud et al., 2006; Strahilevitz et al., 2009).

Rapid dissemination of plasmid-mediated qnr genes has been described in recent years (Robicsek et al., 2006; Cattoir et al., 2007; Hopkins et al., 2007; Minarini et al., 2008; Wu et al., 2008; Cerquetti et al., 2009; Cui et al., 2009; García-Fernández et al., 2009; Gunell et al., 2009). Qnr proteins share common structural properties and belong to a pentapeptide family of proteins. By virtue of their capacity to bind specifically to DNA gyrase, these proteins limit access of the fluoroquinolone drug to its target, thereby providing protection to the bacteria (Tran et al., 2005). Five different qnr genes have been described: qnrA, B, C, D and S with a number of variants exhibiting minor sequence differences (Martínez-Martínez et al., 1998; Hata et al., 2005; Jacoby et al., 2006; Cavaco et al., 2009; Wang et al., 2009). The first qnrB gene described was reported in a Klebsiella pneumoniae isolate from India and was located on a plasmid carrying the blaCTX−M−15-mediated ESL resistance marker (Jacoby et al., 2006). Qnr proteins have been identified in both clinically resistant and susceptible isolates. The minimum inhibitory concentrations (MICs) for nalidixic acid and ciprofloxacin reported in these isolates ranged from twofold to eightfold and 8–32-fold higher, respectively, when compared with the isogenic progenitor isolates (Jacoby et al., 2006; Minarini et al., 2008; Murray et al., 2008; Strahilevitz et al., 2009).

Recently, qnrB determinants were found ubiquitous in commensal microbial communities of healthy children in Peru and Bolivia and were subsequently found to be encoded by small ColE-type plasmids (Pallecchi et al., 2009, 2010).

In this paper, we report on a study of 93 Salmonella isolates recovered from foods and exotic animals in Colombia. Serotyping was used to initially characterize the isolates, and their resistance profiles were determined. A plasmid-mediated qnrB19 marker was detected in four isolates and this gene was completely characterized.

Materials and methods

Bacterial isolates

A collection of 93 Salmonella spp. isolates recovered between 2002 and 2009 from a variety of food products and animals in Colombia was obtained from the University of Cordoba (Colombia). Isolates were streaked on XLD medium (Oxoid, Basingstoke, UK) to check for purity, and were confirmed as Salmonella using a Salmonella latex test (Oxoid).

Drug susceptibility testing

Susceptibilities to 15 drugs were determined by disc diffusion and interpreted according to Clinical and Laboratory Standards Institute (CLSI) guidelines (2007). The following antimicrobial compounds were used: amoxicillin–clavulanic acid 20/10 μg (AMC), ampicillin 10 μg (AMP), cefpirome 30 μg (CFP), cefpodoxime 10 μg (CPD), ceftiofur 30 μg (CFR), cephalothin 30 μg (KF), chloramphenicol 30 μg (C), ciprofloxacin 5 μg (CIP), gentamicin 10 μg (GM), kanamycin 30 μg (KAN), nalidixic acid 30 μg (NA), neomycin 30 μg (NEO), streptomycin 10 μg (S), trimethoprim/sulfamethoxazole 25 μg (SXT), and tetracycline 30 μg (TE). Discs were purchased from Oxoid. Escherichia coli ATCC® 25922 was included as a control.

MIC determination

MICs for nalidixic acid (Sigma-Aldrich, Ireland) and ciprofloxacin (Sigma-Aldrich) were determined by the broth microdilution method (CLSI, 2007), in the absence and presence of 40 μg mL−1 phe-arg-β-naphthylamide (PAβN) (Sigma–Aldrich).

Nucleic acid purification and DNA sequencing

Genomic DNA extraction, PCR purification and sequencing were performed as described previously (O'Regan et al., 2009). Table 1 provides the details of all primer sequences, annealing temperatures and amplicon sizes. Positive controls for the detection of PMQR genes were included: E. coli Lo qnrA1+, K. pneumoniae B1 qnrB1+, E. coli S7 qnrS1+, E. coli TOP10+pCR2.1W qepA and E. coli 78-01 aac(6)-Ib-cr+.

Table 1.   Target genes, amplification primers and PCR reaction conditions used for characterization of the collection
TargetPrimerSequence (5′-3′)Annealing
temperature
(°C)
Product
size (bp)
Reference
Sequencing primers
 gyrAGyrA_For
GyrA_Rev
TGT CCG AGA TGG CCT GAA GC
CGT TGA TGC TTC CGT CAG
55470Modified from Carrique-Mas et al. (2008)
 gyrBGyrB_For
GyrB_Rev
GAA ATG ACC CGT CGT AAA GG
TAC AGT CTG CTC ATC AGA AAG
54710O'Regan et al. (2009)
 parCParC_For
ParC_Rev
ATG AGC GAT ATG GCA GAG CG
TGA CCG AGT TCG CTT AAC AG
52413Carrique-Mas et al. (2008)
 parEParE_For
ParE_Rev
GAC CGA GCT GTT CCT TGT GG
GCG TAA CTG CAT CGG GTT CA
52493Carrique-Mas et al. (2008)
 qnrBqnrB-CS-2A
qnrB-CS-3B
GTT GGC GAA AAA ATT GAC AGA A
ACTCCGAATTGGTCAGATCG
52500Wu et al. (2008)
 qnrB19+
plasmid
qnrB19_FW
qnrB19_RV
TGG ATG GGG ACT CAG GTA CT
CGG CAC CTG AAA AAT CGC AG
552700Pallecchi et al. (2010)
Detection primers
 qnrA1 to qnrA6QnrAm-F
QnrAm-R
AGA GGA TTT CTC ACG CCA GG
TGC CAG GCA CAG ATC TTG AC
54580Cattoir et al. (2007)
 qnrB1 to qnrB6QnrBm-F
QnrBm-R
GGM ATH GAA ATT CGC CAC TG
TTT GCY GYY CGC CAG TCG AA
54264Cattoir et al. (2007)
 qnrS1 to qnrS2QnrSm-F
QnrSm-R
GCA AGT TCA TTG AAC AGG GT
TCT AAA CCG TCG AGT TCG GCG
54428Cattoir et al. (2007)
 qepAQEPfor
QEPrev
TGG TCT ACG CCA TGG ACC TCA
TGA ATT CGG ACA CCG TCT CCG
561137M. Galimand, pers. commun.
 aac(6)-Ibaac(6′)-Ib_For
aac(6′)-Ib_Rev
TTG CGA TGC TCT ATG AGT GGC TA
CTC GAA TGC CTG GCG TGT TT
55482Park et al. (2006)
 ColE-like plasmid backboneColEPB_FW qnrB19ColEPB_RVCTG ACA CTC AGT TCC GCG A
CGG CAC CTG AAA AAT CGC AG
55900Pallecchi et al. (2010)

Nalidixic acid-resistant isolates were assessed for all known PMQR markers using previously published primers (Table 1). Plasmids were purified from nalidixic acid-resistant isolates using the PureYield Plasmid Midiprep System (Promega, Madison, WI) and their profiles were determined in a 0.9% agarose gel SeaKem®LE Agarose (Lonza, Wokingham, UK) after electrophoresis in 1 × Tris-HCl (pH 8)–boric acid–EDTA buffer containing 0.1 μg mL−1 ethidium bromide (Sigma-Aldrich). Using a PCR-based method developed previously by Pallecchi et al. (2010), the ColE-like plasmid carrying qnrB19 genetic determinant was amplified and the sequence was determined (Qiagen, Hilden, Germany). Complete amplified plasmid products were subjected to restriction fragment length polymorphism (RFLP) analysis with MboII enzyme (New England Biolabs, Ipswich, MA) to identify any sequence-based polymorphisms.

The complete sequence of these plasmids was determined (Qiagen) and analysed using blast (http://www.ncbi.nlm.nih.gov/BLAST/), clustalw (http://www.ebi.ac.uk/clustalw/) and dnastar (DNAStar Inc., Madison, WI) programs.

Nucleotide sequence accession numbers

Nucleotide sequences determined were deposited in GenBank under accession numbers HM070379 and HM070380.

Results and discussion

Serotypes

Table 2 shows the serovars recovered, along with their source and geographical origin, date of isolation and corresponding susceptibility patterns. In all, 19 serovars were identified, with S. Uganda (n=19), Anatum (n=14), Braenderup (n=10) and Newport (n=10) predominating, followed by serovars Carrau (n=8), Infantis (n=7), Saintpaul (n=5), Muenchen (n=4) and Rubislaw (n=3). Fresno, Javiana and Senftenberg serovars were represented by two isolates each. Single isolates belonging to serovars Adelaide, Bredeney, Derby, Gaminara, Salmonella enterica ssp. enterica 6,7:d:-, Minnesota, and Typhimurium, were also identified in this collection. No Enteritidis serovars were recovered. The most common serovars implicated in human salmonellosis in Colombia are Enteritidis and Typhimurium (Munoz et al., 2006; Wiesner et al., 2006). However, serovars identified in this study have occasionally been implicated in salmonellosis outbreaks worldwide (Lehmacher et al., 1995; Jones et al., 2004; Gupta et al., 2007; Lang, 2008).

Table 2.   Characterization of 93 Salmonella enterica isolates from Colombia
Isolate no.Date of isolationSourceGeographical areaSerovarResistance profile
  • *

    All meat belonged to bovines.

  • –, No resistances detected; AMP, ampicillin; AMC, amoxicillin–clavulanic acid; C, chloramphenicol; GM, gentamicin; KAN, kanamycin; KF, cephalothin; NA, nalidixic acid; NEO, neomycin; S, streptomycin; TE, tetracycline.

S123/11/2002HamBarranquillaCarrau
S214/03/2003HamBarranquillaCarrau
S320/10/2004CheeseSincelejoAnatumAMP, AMC, KF, TE
S420/10/2004Retail chickenSincelejoInfantis
S520/10/2004CheeseSincelejoInfantis
S628/05/2004Meat*SincelejoNewport
S728/05/2004Retail chickenSincelejoNewport
S828/05/2004SausagesSincelejoNewport
S928/05/2004CheeseSincelejoInfantisS
S1022/09/2004Retail chickenCartagenaUgandaS
S1122/09/2004Retail chickenCartagenaUganda
S1222/09/2004MeatCartagenaUganda
S1322/09/2004Retail chickenCartagenaUganda
S1422/09/2004MeatCartagenaUganda
S1527/10/2004Ground meatSincelejoNewport
S1606/12/2004HamMonteríaNewport
S1706/12/2004HamMonteríaNewport
S1806/12/2004Retail chickenMonteríaNewport
S1906/12/2004Retail chickenMonteríaBraenderupTE
S2007/12/2004Retail chickenSincelejoInfantisKAN, NEO, NA, S, TE
S2103/01/2005HamBarranquillaMinnesota
S2203/01/2005Intestine bovineBarranquillaAdelaide
S2303/01/2005Salty meatBarranquillaNewport
S2401/02/2005SausagesMonteriaUgandaKAN, NEO, NA, S, TE
S2501/02/2005PigMonteriaNewport
S2601/02/2005Retail chickenMonteriaInfantis
S2701/02/2005HamMonteriaAnatum
S2828/03/2005CheeseCartagenaAnatumS, TE
S2928/03/2005MeatCartagenaUganda
S3028/03/2005Intestine bovineCartagenaBraenderup
S3128/03/2005MeatCartagenaSaintpaul
S3228/03/2005Bovine spleenCartagenaSaintpaul
S3312/04/2005SausagesMonteriaAnatum
S3412/04/2005Ground meatMonteriaRubislaw
S3512/04/2005Ground meatMonteriaRubislaw
S3612/04/2005Corn and egg mixtureMonteriaRubislaw
S3707/06/2005PotatoCartagenaMuenchenNA
S3807/06/2005Ground meatCartagenaUgandaKAN, NEO, NA, S, TE
S3907/06/2005Ground meatCartagenaUgandaKAN, NEO, TE
S4007/06/2005MeatCartagenaUganda
S4107/06/2005SausagesCartagenaCarrau
S4222/07/2005Amazona spp. (parrot)MonteriaAnatum
S4316/08/2005CheeseCartagenaAnatum
S4416/08/2005Ground meatCartagenaAnatumNA
S4516/08/2005MeatCartagenaCarrauNA
S4616/08/2005CheeseCartagenaCarrauNA
S4716/08/2005Ground meatCartagenaUgandaNA, TE
S4810/10/2007SausagesSincelejoAnatumTE
S4910/10/2007SausagesSincelejoSaintpaul
S5010/10/2007CheeseSincelejoAnatum
S5110/10/2007CheeseSincelejoCarrauNA
S5218/10/2005Ground meatCartagenaCarrauNA, TE,
S5318/10/2005HamCartagenaAnatumNA
S5418/10/2005CheeseCartagenaAnatum
S5518/10/2005SausagesCartagenaAnatumGM, S, TE
S5618/10/2005Ground meatCartagenaAnatum
S5718/10/2005HamCartagenaAnatum
S5818/10/2005CheeseCartagenaMuenchenTE
S5918/10/2005SausagesCartagenaUgandaTE
S6018/10/2005MeatCartagenaSaintpaulAMP
S6118/10/2005CheeseCartagenaMuenchenAMP
S6204/09/2006HamMonteriaBraenderupAMP
S6304/09/2006Ground meatMonteriaBraenderupAMP
S6414/10/2006CheeseMonteriaMuenchenNA, TE
S6525/02/2007Salty meatMonteriaUganda
S6625/02/2007Salty meatMonteriaUganda
S6725/02/2007HamMonteriaDerbyTE
S6825/02/2007SausagesMonteriaUganda
S6925/02/2007SausagesMonteriaBraenderupTE
S7025/02/2007SausagesMonteriaUganda
S7110/04/2007Flour mandioka powderMonteriaBraenderup
S7210/04/2007Flour mandioka powderMonteriaUganda
S7316/04/2007Ground meatMonteriaUgandaAMP
S7416/04/2007MeatMonteriaBredeneyAMP
S7516/04/2007Ground meatMonteria6,7:d:-AMP, NA
S7616/04/2007CheeseMonteriaSenftenberg
S7716/04/2007CheeseMonteriaBraenderup
S7816/04/2007Ground meatMonteriaSaintpaul
S7924/04/2007MeatMonteriaBraenderupKF
S8024/04/2007Ground meatMonteriaUganda
S8124/04/2007Ground meatMonteriaSenftenbergAMP
S8224/04/2007SausagesMonteriaBraenderupAMP
S8324/04/2007SausagesMonteriaJavianaAMP
S8424/04/2007SausagesMonteriaFresnoAMP
S8504/05/2007SausagesMonteriaInfantisAMP
S8604/05/2007Ground meatMonteriaGaminaraAMP
S8704/05/2007Potato and meatMonteriaInfantisAMP
S8804/06/2007Iguana iguanaMonteriaBraenderupAMP
S9126/05/2009Hydrochoerus hydrochaeris (capybara)MonteriaFresnoC, KF, TE
S9226/05/2009Hydrochoerus hydrochaerisMonteriaTyphimuriumAMC, KF
S9328/05/2009Trachemys scripta callirostris (hicotea)MonteriaJaviana
S9528/05/2009Trachemys scripta callirostrisMonteriaNewport
S9823/11/2002HamBarranquillaCarrau

Antimicrobial susceptibility profiles

A summary of the resistance profiles obtained for each isolate against a panel of 15 antimicrobial compounds is shown in Table 3. Forty-six percent (n=40) were resistant to at least one antimicrobial agent. Tetracycline resistance was the most common resistance property encountered (18.3%, n=17), followed by ampicillin resistance (17.2%; n=16), and nalidixic acid resistance (14%; n=13). Multidrug-resistant isolates (defined as resistant to three or more different drug classes) constituted 4.3% of the collection (n=4).

Table 3.   Prevalence of antibiotic resistance in the strain collection
Antibiotic% Resistance (n)
  1. n, number of resistant isolates.

Amoxicillin–clavulanic acid2.15% (2)
Ampicillin17.2% (16)
Cefpirome0
Cefpodoxime0
Ceftiofur0
Cephalothin4.3% (4)
Chloramphenicol1.1% (1)
Ciprofloxacin0
Gentamicin1.1% (1)
Kanamycin4.3% (4)
Nalidixic acid14% (13)
Neomycin4.3% (4)
Streptomycin7.5% (7)
Tetracycline18.3% (17)
Trimethoprim/sulfamethoxazole0

The emergence of quinolone resistance together with reduced ciprofloxacin susceptibility in S. enterica is increasingly observed and constitutes a major concern because infections with such isolates may cause ciprofloxacin treatment failure (Dimitrov et al., 2007). While the frequency of quinolone resistance in Salmonella is growing worldwide, in this study, 14% of the isolates were resistant to nalidixic acid, a figure that could be considered high (Marimón et al., 2004; Stevenson et al., 2007). This corresponded to the data in the SENTRY Antimicrobial Surveillance program, which reported nalidixic acid resistance of 14% in Salmonella spp. isolates from Latin America during the years 1997–2004, a figure more than twofold higher than that recorded in North America (Biedenbach et al., 2006).

MIC testing

In the case of the isolates showing resistance to quinolone-based antimicrobial compounds, an MIC for nalidixic acid of 32 μg mL−1 was recorded for two isolates, 256 μg mL−1 for three, and 1024 μg mL−1 for eight isolates. Reduced susceptibility to ciprofloxacin was noted for all 13 isolates (ranging from 0.5 to 1 μg mL−1). A summary of the MIC data is presented in Table 4.

Table 4.   MIC values and PCR analysis of target genes associated with resistance in 13 Salmonella isolates displaying (fluoro)quinolone resistance
Isolate no./source/serovarPMQR genesMIC values (μg mL−1)Target gene mutations
NAL – NAL+PAβNCIPGyrAGyrBParCParE
  1. NAL, nalidixic acid; CIP, ciprofloxacin; WT, wild type.

  2. Values in parentheses indicate fold MIC reduction in the presence of 40 μg mL−1 PAβN (Phe-Arg-β-napthylamide).

S20/chicken/InfantisqnrB1932 – 4 (8 ×)1WTWTThr57→SerWT
S24/sausages/UgandaqnrB1932 – 4 (8 ×)1WTWTThr57→SerWT
S37/potato/Muenchen1024 – 128 (8 ×)1WTWTThr57→SerWT
S38/ground meat/UgandaqnrB19256 – 64 (4 ×)1WTWTThr57→SerWT
S44/ground meat/Anatum1024 – 64 (16 ×)0.5Asp87→TyrWTThr57→SerWT
S45/meat/Carrau256 – 64 (2 ×)0.5Asp87→TyrWTThr57→SerWT
S46/cheese/Carrau1024 – 512 (2 ×)0.5Asp87→TyrWTThr57→SerAsn446→Pro
S47/ground meat/Uganda1024 – 256 (4 ×)0.5WTWTGly25→Ala
Thr57→Ser
WT
S51/cheese/Carrau1024 – 512 (2 ×)0.5Asp87→TyrWTThr57→SerWT
S52/ground meat/Carrau1024 – 512 (2 ×)1WTWTThr57→SerArg508→Lys
S53/ham/Anatum1024 – 512 (2 ×)0.5Asp87→TyrWTThr57→SerArg508→Lys
S64/cheese/Muenchen1024 – 512 (2 ×)0.5Asp87→TyrWTThr57→SerWT
S75/ground meat/6,7:d:-,qnrB19256 – 128 (2 ×)1WTWTWTWT

A 2–16-fold decrease in the MIC of nalidixic acid was observed In the presence of PAβN, a known efflux pump inhibitor (Table 4) with six isolates showing a 4–16-fold decrease. These results indicate that efflux pump activity may be contributing to the resistant phenotype and will be investigated in a separate follow-up study.

Target gene mutations

Target gene mutations associated with resistance to fluoroquinolones/quinolones (F)Q are shown in Table 4. One of the isolates did not possess any target gene mutations. Others possessed up to three mutations in the corresponding target genes. Six of 13 nalidixic acid-resistant isolates had mutations in the QRDR region of gyrA; in all these cases the Asp87→Tyr substitution was noted. No amino acid sequence changes were identified in GyrB. Substitutions in ParC (Thr57→Ser) were noted in 12 isolates. One had a Gly25→Ala along with a second substitution within ParC (isolate S47, Table 4). Two different ParE mutations were identified: Asn446→Pro in one isolate (S46) and Arg508→Lys in another two isolates (S52 and S53, Table 4).

High-level resistance to nalidixic acid and decreased susceptibility to ciprofloxacin was observed in isolates S44, S45, S46, S51, S53 and S64, which could be attributed to the single substitution in the GyrA previously found to correlate with this phenotype (Walker et al., 2001; Eaves et al., 2002; Ling et al., 2003; Stevenson et al., 2007). In isolates S20, S24, S38 and S75, nalidixic acid resistance could be attributed to the presence of PMQR. Characteristically, nalidixic acid MICs in these latter isolates were lower (ranging from 32 to 256 μg mL−1) compared with isolates with the more common gyrA mutation. However, three remaining isolates of serovars Muenchen (denoted as S37), Uganda (S47) and Carrau (S52) did not possess GyrA substitutions, but were highly resistant to nalidixic acid (MIC=1.024 μg mL−1) and displayed reduced susceptibility to ciprofloxacin (MIC=0.5–1 μg mL−1). All three possessed the Thr57→Ser ParC substitution. Salmonella Uganda (S47) also contained a second ParC amino acid change (Gly25→Ala), and the Carrau isolate (S52) had an additional Arg508→Lys substitution in ParE. Because these isolates possessed different mutations, it was difficult to conclude as to which mechanism was primarily responsible for the phenotype observed. Contribution of increased efflux activity is likely in the S. Muenchen and Uganda isolates as demonstrated by the MIC assay in the presence of PAβN. Nonetheless, MICs decreased to 128 and 256 μg mL−1 in these two isolates, respectively, values that are indicative of clinical resistance, strongly suggesting the presence of (an) additional undefined mechanism(s).

Some reports suggest that the distribution of specific substitutions within target genes might differ depending on the serovar. Furthermore, the frequency with which these mutations are observed may reflect the impact of exposure to different fluoroquinolone drugs (Giraud et al., 1999; Levy et al., 2004). Nonetheless, mutation patterns in the isolates studied could not be correlated with specific serovars. The spectrum of mutations observed was narrow and only one polymorphism occurred in gyrA, suggesting that conditions under which the mutations developed might have been a common factor leading to this particular alteration.

The lack of gyrA mutations in some isolates together with the presence of parC mutations in six other isolates is a unique finding. Although the Thr57→Ser substitution in ParC has been reported previously in Salmonella, it is detected less frequently compared with the more common gyrA mutations and typically occurs concomitantly with double gyrA mutations (Piddock et al. 1998; Baucheron et al., 2005; Hopkins et al., 2005). The Thr57→Ser mutation in parC was first reported by Ling et al. (2003) in Salmonella isolates with a wild-type DNA gyrase and others possessing single gyrA mutations, wherein the first were susceptible to ciprofloxacin (MIC=0.06 μg mL−1), and the latter demonstrated a twofold increased resistance. More recently, Baucheron et al. (2005) reported that the Thr→57Ser ParC substitution was not involved in quinolone resistance in their isolates. Also, Cui et al. (2009) reported an identical ParC substitution in a ciprofloxacin-resistant S. Rissen isolate that did not carry any other target gene mutation, qnr alleles nor an aac-(6)-Ib-cr gene. In addition, the same polymorphism was recently encountered in a number of non-Typhimurium isolates and the resistant phenotype could not be linked with this alteration because susceptible isolates harboured identical mutations (Gunell et al., 2009). Thus, we also sequenced the parC gene of 10 randomly selected quinolone-susceptible isolates from this collection representing five serotypes. Thr→57Ser substitution was identified in nine of 10 of these isolates (data not shown), supporting the view that this is a common polymorphism in serotypes other than Typhimurium. In view of current knowledge regarding quinolone resistance mechanisms, it is unclear whether secondary target mutations alone can lead to the development of high-level quinolone resistance (Ling et al., 2003; Baucheron et al., 2005; Cui et al., 2009; Gunell et al., 2009).

Detection of PMQR

PCR analysis of the fluoroquinolone-resistant isolates did not detect aac(6′)-Ib-cr, qepA, qnrA nor qnrS genes. Four isolates were positive for qnrB (Table 4): one Infantis (S20), two Uganda isolates (S24, S38) and one serovar 6,7:d:- isolate (S75). The MICs of nalidixic acid in these isolates varied from 32 to 256 μg mL−1. DNA sequencing revealed the presence of the qnrB19 allele in all cases. Multiple plasmids were present in nine isolates (data not shown) while four other isolates (denoted as S37, S45, S47 and S51) lacked detectable plasmids. In the plasmid-positive qnrB19 isolates S20, S24, S38 and S75, several other low-molecular-weight plasmids ranging in size between 1 and 3 kb were also noted (data not shown). When analysed by PCR designed to amplify ColE-like plasmids, amplicons of 2.7 kb were recovered. Among these, two distinct MboII RFLP profiles were observed, which were identical for three isolates (S20, S24, and S38), and different for isolate S75 (data not shown). The plasmids from isolates S20 and S75 were purified and completely sequenced.

Homology searches revealed that the plasmid (designated pMK100) found in S. Infantis (S20) exhibited 100% homology with qnrB19-carrying plasmids including pSGI15, a small ColE plasmid identified recently in S. enterica serovar Typhimurium isolated in Germany (Hammerl et al., 2010), and a qnrB19-containing plasmid pPAB19 from an S. Infantis clinical isolate recovered in Argentina (GenBank accession number GQ412195). The plasmid purified from isolate S75 (designated pMK101) was found to be 97% similar to these latter plasmids. The dissimilarity noted was mapped to an insertion located between nucleotide positions 896 and 957. Remarkably, the latter DNA sequence was identical to one found in a pBC633 from a K. pneumoniae strain KN633 (accession number EU176012), a urinary isolate from Colombia displaying carbapenem resistance and reported in 2005. This plasmid of approximately 15.5 kb carried a blaKPC−2 gene encoding a class A carbapenemase (Villegas et al., 2006). The additional DNA sequence contained in the plasmid from the isolate S75 was located between the qnrB19 gene and orf2, and was found to be homologous with a region of pBC633. Furthermore, nucleotide sequence similarity was observed in the region upstream of the inserted fragment, possibly facilitating the incorporation of the new DNA fragment. The fact that pBC633 was found only in Colombia indicates that the homology found here may not be coincidental. It is interesting to speculate that pMK101 (the plasmid from isolate S75) is chimeric and may have emerged as a result of a recombination event that led to the horizontal acquisition of a fragment from another plasmid containing blaKPC−2. The process is likely to have occurred in a bacterium simultaneously hosting a plasmid similar to or identical to pBC633, as well as a small ColE-like plasmid such as pMK100. While blaKPC−2 genes are frequent in K. pneumoniae and only sporadic in other Enterobacteriaceae, there are insufficient data to conclude what species was the primary host of the new plasmid structure (Villegas et al., 2006; Pournaras et al., 2009). In addition, it is noteworthy that pBC633 containing a blaKPC−2 gene was found on a transposon Tn4401 with multiple insertion sequence (IS) elements that have likely contributed to its emergence (Naas et al., 2008). Of particular concern is the possibility of the emergence of chimeric plasmids carrying both qnr genes and blaKPC−2 that could compromise the clinical value of fluoroquinolones and virtually all β-lactams. In view of this, monitoring of phenotypic resistance as well as associated mechanisms and mobility is essential. Furthermore, the occurrence of both blaKPC−2 and qnr in Colombia and their associated plasmids is likely to be under-reported as a result of poor surveillance as well as diagnostic challenges associated with the low-level resistance conferred (Villegas et al., 2006). The present study documented the emergence of a plasmid carrying a sequence previously identified in another plasmid and suggests that reservoirs of both types of plasmids may exist in Colombia.

In Colombia, epidemiological data relating to PMQR is limited. A single case reporting PMQR in Colombia described the qnrB19 gene in E. coli isolates recovered from blood cultures of a hospital patient in Monteria (Cattoir et al., 2008). The gene was linked with ISEcp1-like insertion element responsible for its mobilization and was carried by a novel transposon designated Tn2012 identified on pR4525 (Cattoir et al., 2008). No linkage of qnrB19 with transposon or integron structures was observed in our isolates (data not shown). A high prevalence of qnrB determinants was reported recently in commensal microbial communities cultured from healthy children in Peru and Bolivia (Pallecchi et al., 2009). In a follow-up study, the involvement of ColE-type plasmids and their role in dissemination in these two countries was described (Palecchi et al., 2010). The most prevalent plasmid, designated pECY6-7, was investigated in detail, and was found to be identical to the plasmid characterized by Hammerl et al. (2010). Both plasmids are indistinguishable from those characterized in the S. Infantis isolate (denoted as S20).

Concluding remarks

These data extend our understanding of the molecular epidemiology of the qnrB19 determinant. In this study, the marker was identified for the first time in Salmonella spp. in Colombia. The fact that the isolates include different serovars, and that they were recovered in different areas of the country from a variety of food samples and over the years (2002–2009), suggests that the reservoir may not be restricted to a specific ecological niche. Further epidemiological studies are required to determine the full extent of the dissemination of PMQR in Colombia and its implications for public health.

Acknowledgements

The authors acknowledge financial support from the Research Stimulus Fund of the Department of Agriculture, Fisheries and Food of Ireland (RSF) (06/TNI-UCD10) and COST (ATENS) grant COST-STSM-BM0701-05056. Bacterial isolates E. coli Lo qnrA1+, K. pneumoniae B1 qnrB1+ and E. coli S7 qnrS1+ were a kind gift from Professor Patrice Nordmann, E. coli TOP10+pCR2.1WqepA was kindly provided by Dr Marc Galimand and E. coli 78-01 aac(6)-Ib-cr+ by Professor Johann Pitout.

Ancillary