Editor: Craig Shoemaker
ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis
Article first published online: 12 NOV 2010
DOI: 10.1111/j.1574-6968.2010.02132.x
© 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved
Additional Information
How to Cite
Marshall, S. H., Henríquez, V., Gómez, F. A. and Cárdenas, C. (2011), ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis. FEMS Microbiology Letters, 314: 18–24. doi: 10.1111/j.1574-6968.2010.02132.x
Publication History
- Issue published online: 3 DEC 2010
- Article first published online: 12 NOV 2010
- Accepted manuscript online: 13 OCT 2010 08:47AM EST
- Received 28 June 2010; revised 22 September 2010; accepted 27 September 2010.Final version published online 12 November 2010.
- Abstract
- Article
- References
- Cited By
Keywords:
- Piscirickettsia salmonis;
- insertion sequence;
- inverted repeats;
- transposase
Abstract
Piscirickettsia salmonis is a novel, aggressive, facultative Gram-negative bacterium that drastically affects salmon production at different latitudes, with particular impact in southern Chile. Initially, P. salmonis was described as a Rickettsia-like, obligate, intracellular Alphaproteobacteria, but it was reclassified recently as a facultative intracellular Gammaproteobacteria. This designation has prompted the independent growth of the bacterium to a pure state for detailed study of its biology, genetics and epidemiology, properties that are still relatively poorly characterized. The preliminary sequence analysis of a 992-bp fragment of pure P. salmonis DNA allowed us to characterize a novel and complete 863-bp insertion sequence in the bacterial genome (named ISPsa2), which has a novel 16/16 bp perfectly inverted terminal repeat flanking a 726-bp ORF that encodes a putative transposase (Tnp-Psa). The coding sequence of the enzyme shares similarities to that described in some Bacillus species and particularly to those of the IS6 family. ISPsa2 carries its own promoter with standard −10 and −35 sequences, suggesting an interesting potential for plasticity in this pathogenic bacterium. Additionally, the presence of ISPsa2 was confirmed from three isolates of P. salmonis collected from different epizootics in Chile in 2010.
Introduction
The sequencing of bacterial genomes from newly discovered species provides exciting opportunities to understand genome organization and evolution. In addition, it provides novel putative ORFs or potential coding sequences (CDSs) as well as signals for gene expression (Siguier et al., 2006). Most bacterial genomes are composed of a core minimal species backbone, but generally and for purposes of plasticity, they are complemented with other features such as mobile genetic elements (MGEs), which include bacteriophages, conjugative transposons, integrons, composite transposons and insertion sequences (ISs). These elements form part of an extensive gene pool that serves to promote gene exchange and reassortment (Craig et al., 2002). The IS elements are small, mobile, non-self-replicating DNA regions that specify only the gene(s) required for their transposition. In accordance with the features involved in the transposition process and the phylogenetic relationship between different transposases, they have been grouped into different families (Gartemann & Eichenlaub, 2001).
Among MGEs, bacterial ISs constitute the largest group, and they have been observed in most bacterial genomes and plasmids, where they may be present in large numbers (Mahillon & Chandler, 1998; Chandler & Mahillon, 2002). Indeed, in a large virulence plasmid of Shigella flexnery, an astonishing 153 (53%) ORFs are related to known and putative IS elements; no known bacterial plasmid has been described previously with such a high proportion of IS elements, and four new IS elements have been definitively identified (Venkatesan et al., 2001). Additionally, metagenomic sequencing has yielded a flood of bacterial genome data that confirm the presence of increasing numbers of mobile elements in all analyzed bacterial genomes. This has naturally led to the development of evolutionary studies where consistent IS annotation across many different genomes has become necessary, and several alternatives are now available for comparison and enhanced understanding of their evolutionary and functional roles (Siguier et al., 2006; Wagner et al., 2007).
Piscirickettsia salmonis is the etiologic agent of salmonid rickettsial septicemia, or piscirickettsiosis (Fryer et al., 1990), which is an aggressive infectious disease that has affected salmonid fish since the late 1980s (Bravo & Campos, 1989; Graggero et al., 1995; Marshall et al., 2007). Piscirickettsia salmonis is a facultative intracellular Gram-negative bacterium (Mauel et al., 2008; Mikalsen et al., 2008; Gómez et al., 2009) that was initially described as a Rickettsia-like obligate intracellular Alphaproteobacteria. Recently, it was reclassified as a Gammaproteobacteria that closely resembles Legionella and Francisella species (Fryer & Hedrick, 2003). This ambiguity misled researchers for more than a decade; therefore, its biology, epidemiology and genetics are almost totally unknown. Nevertheless, it is known that this bacterium persists in sea water (Olivares & Marshall, 2010), maintaining its infective potential under rough environmental conditions (Lannan & Fryer, 1994). This vitality suggests that its genetic background should be sufficiently versatile to adapt easily to changing stressful conditions. In fact, our laboratory has demonstrated that under limiting in vitro conditions, morphological and genetic changes are consistently observed (Rojas et al., 2008). Thus, the report of the first IS sequence in this genome strengthened the belief that the genome of P. salmonis might show a surprising degree of complexity and plasticity. As our laboratory can successfully grow this bacterium in liquid media (Gómez et al., 2009; E. González, F. Gómez, V. Henríquez, S. H. Marshall & C. Altamirano, unpublished data), based on increasing evidence of the adaptive potential of this bacterium (Rojas et al., 2008, 2009, 2010), we decided to evaluate the quality of the bacterial genome to determine whether the observed morphological changes and adaptability have a genetic background. This report constitutes the first evidence of a putatively larger complexity and potential for fluidity in the genome of P. salmonis.
Materials and methods
Growth conditions of P. salmonis
Piscirickettsia salmonis strain LF-89 (ATCC VR-1361) was maintained routinely on BCG agar plates (10 g L−1 tryptone, 5 g L−1 peptone, 5 g L−1 yeast extract, 5 g L−1 NaCl, 10 g L−1 glucose, 5% sheep blood and 1%l-cysteine) at 23 °C (modified from Mauel et al., 2008). A single bacterial colony was used to inoculate 25 mL of MC5 medium, and the inoculated medium was incubated at 23 °C and 100 r.p.m. of agitation. The composition of the MC5 culture medium will be published shortly (patent pending).
Three isolates of P. salmonis collected from Atlantic salmon (Salmo salar) during 2010 from different epizootics in Puerto Montt (Chile) were maintained on the CHSE-214 cell line (ATCC CRL-1681) as been described previously (Rojas et al., 2009). Monolayers of CHSE-214 cells were routinely propagated at 17 °C in 25 cm2 culture flasks containing minimal essential medium (MEM; Gibco), supplemented with 7.5% heat-inactivated fetal bovine serum and adjusted to pH 7.2 with 10 mM sodium bicarbonate and 15 mM HEPES.
DNA purification
Two-day-old P. salmonis LF-89 liquid cultures were centrifuged at 6000 g for 20 min, and genomic DNA was extracted using the AxyPrep™ Multisource Genomic DNA Miniprep Kit (AxyGen Bioscience) according to the manufacturer's instructions.
To obtain DNA from the three isolates of P. salmonis, 1 mL of 15-day-old supernatants from CHSE-214 infected cell line was centrifuged at 20 000 g for 15 min. The DNA from the resultant pellets was extracted using the Chelex-100 resin (BioRad) as described previously (Walsh et al., 1991).
The DNA concentration from all samples was determined by spectrophotometry using a Nanodrop-1000 and the DNA was kept at −20 °C until use.
Genomic library construction
A genomic DNA library of P. salmonis was constructed in the plasmid pBluescript SK (+) (Fermentas). Bacterial genomic DNA (3 μg) was partially digested with Sau3AI (New England Biolabs) for 30 min at 37 °C. The digestion reaction was stopped at 65 °C for 10 min. Following phenol : chloroform extraction and ethanol precipitation, the DNA was resuspended in 15 μL of nuclease-free water (IDT DNA Technologies). The pBluescript SK (+) vector was completely digested with the BamHI restriction enzyme (New England Biolabs) for 12 h at 37 °C and treated for 1 h with alkaline phosphatase (Promega) according to the protocol supplied by the manufacturer. Both digested DNAs were visualized by 1% agarose gel electrophoresis and stained with GelRed™ (Biotium). Finally, 600 ng of digested bacterial DNA and 300 ng of linearized pBluescript SK (+) vector DNA were ligated with T4 DNA ligase (Promega). The ligation mixture was used to transform Escherichia coli TOP10 cells by electroporation. The selection of transformants was performed on Luria–Bertani (LB) agar containing 50 μg mL of kanamycin (Sigma-Aldrich) in the presence of X-Gal (Promega). In total, 200 white colonies were analyzed by PCR using the M13-forward and M13-reverse primers. Colonies with an insert size greater than 500 bp were selected and grown in 5 mL of LB broth. They were purified using a Plasmid Mini Kit (Qiagen) and submitted to sequencing by Macrogen Inc. (Korea).
Sequence analysis
The DNA sequence data were analyzed with softberry server software (http://linux1.softberry.com/berry.phtml) using the FgenesB and Bprom algorithms. FgenesB is a suite of bacterial operon and gene prediction programs and is based on Markov chain models of coding regions and translation and termination sites (Tyson et al., 2004). Bprom is an algorithm that recognizes possible promoters in bacterial DNA sequences. The clc main workbench 5 is a versatile software for analyzing DNA, RNA and proteins with a graphical user interface (http://clcbio.com/); the software was used to complement the sequence analysis, specifically for alignments and to locate the different elements [ORF, promoters, inverted repeat sequences (IRs)].
The ORFs predicted by FgenesB were used in blastp, with the search limited to bacterial sequences (http://blast.ncbi.nlm.nih.gov), to determine their possible identities. A comparison with the most similar ISs from the IS6 family found in the ISFinder database (http://www-is.biotoul.fr/) was performed.
Determination of the presence of IS from fish isolates of P. salmonis
In order to determine the prevalence of the IS sequence in natural isolates, oligonucleotide primers were designed to amplify the putative IS already predicted by the sequence analysis. All PCR primers were designed as shown in Table 3, using the Oligo Calc tool (http://www.basic.northwestern.edu/bio-tools/oligocalc.html).
| Primer name | Sequence | Location |
|---|---|---|
| ||
| IR1-F | 5′-GGC ACT GTT GCG AAA AAT TTA GAT-3′ | IR right |
| Tnp-PsaF | 5′-GTG GCT AGA CGT AAA CGA TTT AAG-3′ | Tnp-Psa nt 1–24 |
| Tnp-PsaR2 | 5′-GCT CAG TCG TCA GCA AAA TGC TAA-3′ | Tnp-Psa nt 682–704 |
| IR2-R | 5′-GGC ACT GTT GCG AAA AGT TAT CGT-3′ | IR left |
The PCR reaction for the three fish isolates was performed using the following primer set: (1) IR1-F and Tnp-PsaR2 yielded a PCR product of 427 bp and (2) Tnp-PsaF and IR2-R yielded a PCR product of 704 bp. The PCR conditions used were: 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 45 s, and a final extension of 72 °C for 5 min. The PCR products were visualized on a 1% agarose gel stained with GelRed™.
Results
Genomic library construction
Piscirickettsia salmonis DNA was partially digested with Sau3AI endonuclease. Because this enzyme has a 4-bp recognition site, excision occurs, on average, every 250 bp, thus generating DNA fragments smaller than 2000 bp (Fig. 1). Fragmented DNA was cloned into the vector pBluescript KS (+) and electroporated into E. coli, resulting in 4750 recombinant clones. PCR analysis of the cloned P. salmonis inserts yielded 200 clones with inserts larger than 500 bp, which were subsequently sequenced (data not shown).
Figure 1. Nucleotide and predicted amino acid sequences of ISPsa2 Tnp-Psa. (a) CLC workbench scheme of ISPsa2 showing the location of the predicted −10 and −35 regions in frame with Tnp-Psa. (b) DNA sequence and the 242 amino acid ORF of Tnp-Psa. The −10 and −35 promoter signals are indicated with asterisks, and the inverted repeats are italicized and underlined.
Sequence analysis
Sequence analysis of the 992-bp insert resulted in a unique 726-bp ORF with a putative in-frame protein of 242 amino acids, an upstream putative promoter containing the expected −10 and −35 regions, and two identical 16-bp IRs flanking the 726-bp ORF (Fig. 1).
According to Blastp analysis, the new ORF encodes a putative transposase (Tnp-Psa) with high similarity to Bacillus thuringiensis IS240 protein. The alignment with IS240 and other transposases showed a high percentage of identity (almost all >45%) (Table 1) and also indicated the presence of amino acids involved in the DDE motif (Fig. 2), an acidic aminoacid triad present in many phosphoryltransferases, important in catalysis reactions possibly involved in metal coordination; these residues are conserved in ISs of the IS3 and IS6 families (Mahillon & Chandler, 1998) (Table 1 and Fig. 2).
| Name | Organism | GenBank accession no. | % ID |
|---|---|---|---|
| |||
| ISBth6 | Bacillus thuringiensis | ZP_00744324 | 47.28 |
| IS240C | Bacillus cereus CER484 | Unavailable | 47.46 |
| ISBwe3 | Bacillus weihenstephanensis | YP_001642595 | 47.46 |
| IS240B | Bacillus thuringiensis ssp. israelensis (p112 kb) | YP_001573829 | 50.0 |
| IS240A | Bacillus thuringiensis ssp. israelensis (p112 kb) | YP_001573834 | 50.0 |
| IS257-1 | Staphylococcus aureus (pSH6) | NP_115303 | 36.5 |
Figure 2. Tnp-Psa aligned with similar transposases according to the ISFinder server. Asterisks indicate the amino acids involved in the DDE motif. The figure was created using Jalview.
A comparison with similar ISs, such as those of the IS6 family reported in ISFinder, showed a close relationship with some insertion elements from the genera Bacillus and Staphylococcus, even at the nucleotide alignment level (data not shown). Our new IS, ISPsa2 (GenBank accession number: HM563000), shares key features with these sequences (Table 2).
| Name | Organism | GenBank accession no. | Length | IR | END | DR | IRL IRR |
|---|---|---|---|---|---|---|---|
| ISPsa2 | Piscirickettsia salmonis | HM563000 | 863 | 16/16 | GG | 0 | GGCACTGTTGCGAAAA |
| GGCACTGTTGCGAAAA | |||||||
| ISBth6 | Bacillus thuringiensis | Unavailable | 864 | 17/18 | GG | 0 | GGTTCTGGTGCAAAAAAT |
| GGTTCTGGTGCAAATAAA | |||||||
| IS240C | Bacillus cereus CER484 | Unavailable | 817 | 16/17 | GG | ND | GGTTCTGGTGCAAAAAAT |
| GGTTCTGGTGCAAATAAA | |||||||
| ISBwe3 | Bacillus weihenstephanensis | NC_010180 | 843 | 15/16 | GG | 0 | GGTTCTGGTGCAAAAA |
| GGTTCTGGTGCAAAGA | |||||||
| IS240B | Bacillus thuringiensis ssp. israelensis (p112 kb) | M23741 | 861 | 16/17 | GG | ND | GGTTCTGGTGCAAAAAA |
| GGTTCTGGTGCAAATAA | |||||||
| IS240A | Bacillus thuringiensis ssp. israelensis (p112 kb) | M24740 | 861 | 16/17 | GG | ND | GGTTCTGGTGCAAAAAA |
| GGTTCTGGTGCAAATAA | |||||||
| IS257-1 | Staphylococcus aureus (pSH6) | X53952 | 791 | 21/26 | GG | ND | GGTTCTGTTGCAAAGTTGAAT |
| GGTTCTGTTGCAAAGTTAGAA |
Prevalence of ISPsa2 from fish isolates
In order to determine the prevalence of the ISPsa2 sequence in fish isolates, we tested its presence in three fresh isolates, amplifying the IS by PCR using two sets of ISPsa2-specific primers (Table 3). The ISPsa2 sequence was found in the genome of all three isolates from fish (Fig. 3).
Figure 3. Presence of ISPsa2 in isolates of Piscirickettsia salmonis obtained from diseased fish. (a) PCR amplification of ISPsa2 using the primer set IR1-F and Tnp-PsaR. (b) PCR amplification of ISPsa2 using the primer set Tnp-PsaF and IR2-R. MK, 100 bp DNA ladder; 1, fish isolate 1; 2, fish isolate 2; 3, fish isolate 3; 4, PCR-negative control.
Discussion
The genomes of a large number of bacterial species have been sequenced in the last decade, generating important data for comparative analyses. Comparisons of the sequences and organization of these different genomes reveal interesting biological and evolutionary information. The recent development of an open-source software package called iscan has enabled the identification of a wide array of bacterial ISs and their sequence elements (Wagner et al., 2007) as well as their systematic classification (Siguier et al., 2006). Such analyses substantially expand upon previously available information and suggest that most ISs have entered bacterial genomes recently. By implication, the persistence of their populations may depend on horizontal transfer, a highly important issue in salmon rearing, where fish confinement and stress are commonplace situations at critical times before harvesting. Under such conditions, ISs and other MGEs associated with pathogenesis could become particularly active as part of a bacterial strategy to maintain its virulence. Additionally, the presence of ISs might also very well be the starting point to generate more complex mobile units, such as transposons, which undoubtedly provide advantageous conditions for survival to pathogenic bacteria. Indeed, as supportive evidence, bacterial genomes are known to be remarkably fluid (Boucher et al., 2003). A fluid genome represents a huge advantage for all prokaryotes, more so for pathogens, enabling quick adaptation to harsh ecological niches and to diverse environmental selective pressures. Most of these sudden changes are generally mediated by lateral gene transfer strategies in which MGEs play a pivotal role, reinforcing the notion that a substantial portion of the bacterial genome is not inherited from the parental cells, but is instead acquired horizontally by lateral gene transfer (Doolittle, 1999; Boucher et al., 2003). The presence of ISs should favor the acquisition of new traits through this mechanism as a way to allow bacteria to rapidly adapt to new environmental conditions, a proinfective behavior that fits perfectly with the rough natural environment faced routinely by P. salmonis. In this context, and considering that key virulence genes that distinguish pathogenic bacteria are generally carried on transmissible genetic elements (Hacker et al., 1997), it would not be surprising if the genomic complexity of P. salmonis included other types of MGEs, a feasible alternative that our laboratory is currently investigating.
In summary, this is the first description of a putatively functional IS in the genome of P. salmonis. Our results reveal that ISPsa2 shares high similarity to previously described ISs – specifically to IS240 elements, which are members of the IS6 family. As shown in Table 2, our new IS shares the key features that distinguish the IS6 family elements, such as length, IR size and END sequence. The putative transposase encoded within ISPsa2 (Tnp-Psa) carries conserved motifs that are also found in other transposases (Fig. 2). The presence of a putative promoter region in frame with Tnp-Psa in ISPsa2 strongly suggests a regulated self-expression for the IS and may represent a preliminary indication of the high genomic plasticity of this fish bacterial pathogen. Additionally, the ISPsa2 sequence appears to be in other strains of the pathogen, or at least in three isolates obtained from epizootics in 2010 (Fig. 3).
Acknowledgements
This work was supported by Innova Corfo grant 05CT6IPD-22 to S.M., C.C. and V.H. and by Conicyt (Beca Nacional de Doctorado) to F.G.
References
- , , , , , , & (2003) Lateral gene transfer and the origins of prokaryotic groups. Annu Rev Genet 37: 283–328.
- & (1989) Síndrome del salmón Coho. Chile Pesquero 54: 47–48.
- & (2002) Insertion sequences revisited. Mobile DNA II (CraigNL, CraigieR, GellertM & LambowitzAM, eds), pp. 305–366. ASM Press, Washington, DC.
- , , & (2004) The Jalview java alignment editor. Bioinformatics 20: 426–427.
- , , & (2002) Mobile DNA II. ASM Press, Washington, DC.
- (1999) Lateral genomics. Trends Cell Biol 9: M5–M8.
- & (2003) Piscirickettsia salmonis: a gram-negative intracellular bacterial pathogen of fish. J Fish Dis 26: 251–262.
- , , , & (1990) Isolation of a rickettsiales-like organism from diseased coho salmon (Oncorhynchus) in Chile. Fish Pathol 25: 107–114.
- & (2001) Isolation and characterization of IS1409, an insertion element of 4-chlorobenzoate-degrading Arthrobacter sp. strain TM1, and development of a system for transposon mutagenesis. J Bacteriol 183: 3729–3736.
- , & (1995) Fish isolation of Piscirickettsia salmonis from coho salmon, Oncorhynchus kisutch (Walbaum), and rainbow trout, Oncorhynchus mykiss (Walbaum), during the freshwater stage on their life cycle. J Fish Dis 18: 277–279.
- , & (2009) Additional evidence of the facultative intracellular nature of the fish bacterial pathogen Piscirickettsia salmonis. Arch Med Vet 41: 261–267.
- , , & (1997) Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol Microbiol 23: 1089–1097.
- & (1994) Extracellular survival of Piscirickettsia salmonis. J Fish Dis 17: 545–548.
- & (1998) Insertion sequences. Microbiol Mol Biol R 62: 725–774.
- , , , , , & (2007) Immunological characterization of a bacterial protein isolated from salmonid fish naturally infected with Piscirickettsia salmonis. Vaccine 25: 2095–2102.
- , & (2008) Culture of Piscirickettsia salmonis on enriched blood agar. J Vet Diagn Invest 20: 213–214.
- , , , & (2008) Agar culture of Piscirickettsia salmonis, a serious pathogen of farmed salmonid and marine fish. FEMS Microbiol Lett 278: 43–47.
- & (2010) Determination of minimal concentration of Piscirickettsia salmonis in water columns to establish a fallowing period in salmon farms. J Fish Dis 33: 261–266.
- , , & (2008) Characterization of a novel and genetically different small infective variant of Piscirickettsia salmonis. Microb Pathogenesis 44: 370–378.
- , , & (2009) Productive infection of Piscirickettsia salmonis in macrophages and monocyte-like cells from rainbow trout, a possible survival strategy. J Cell Biochem 108: 631–637.
- , , , , & (2010) Piscirickettsia salmonis induces apoptosis in macrophages and monocyte-like cells from rainbow trout. J Cell Biochem 110: 468–476.
- , , , & (2006) ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acid Re 34: D32–D36.
- , , , , , , , , & (2004) Community structure and metabolism through reconstruction of microbial genomes from the environment. Nature 428: 37–43.
- , , , , & (2001) Complete DNA sequence and analysis of the large virulence plasmid of Shigella flexneri. Infect Immun 69: 3271–3285.
- , & (2007) A survey of bacterial insertion sequences using IScan. Nucleic Acid Res 35: 5284–5293.
- , & (1991) Chelex-100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10: 506–513.

1574-6968/asset/FML_left.gif?v=1&s=d9ad90a5f75253894fe5059aa2f75bf910ebf83a)
1574-6968/asset/FML_right.gif?v=1&s=48d5e33deef512c09651020f71074ad93d3351e7)
