The yfeR gene of Salmonella enterica serovar Typhimurium encodes an osmoregulated LysR-type transcriptional regulator

Authors


  • Editor: Jeff Cole

Correspondence: Antonio Juárez, Departament de Microbiologia, Facultat de Biologia, Universitat de Barcelona, Avda. Diagonal 645, 08028 Barcelona, Spain. Tel.: +34 93 403 4624; fax: +34 93 403 4629; e-mail: ajuarez@ub.edu

Abstract

A genetic screening for osmoregulated genes allowed us to identify the yfeR gene of Salmonella enterica serovar Typhimurium. The yfeR gene product encodes a novel LysR-type transcriptional regulator (LTTR), the expression of which decreases when external osmolarity increases. Out of the adjacent gene yfeH, YfeR modulates expression of several genes that may be required for optimal growth under low osmolarity conditions.

Introduction

One of the features of bacterial cells is their ability to sense and adapt to changes in their external environment. Upon sensing specific stimuli, they respond by altering their gene expression pattern. One of the environmental parameters to which bacteria respond is the osmolarity of the external medium (Csonka & Epstein, 1996; Sleator & Hill, 2001). To date, several osmosensing mechanisms and signal transduction pathways have been characterized (Sleator & Hill, 2001; Heermann & Jung, 2004; Wood, 2006). Osmotic challenge leads to modifications of both transcription and enzyme activity. In Escherichia coli and other enteric bacteria, osmolarity modifies the expression of, among other genes, the proU operon (Cairney et al., 1985), different virulence factors (Mekalanos, 1992; Bajaj et al., 1996) and several other genes (Weber et al., 2006; Gunasekera et al., 2008). Hitherto, most of the well-characterized osmoregulated genes correspond to genes that are upregulated following an osmotic upshift (Cairney et al., 1985; Han et al., 2005; Weber et al., 2006; Gunasekera et al., 2008). Nevertheless, adaptation to low-osmolarity conditions must also result in regulation of genes that are specifically required to cope with these conditions. In this work we designed a genetic strategy focused on identifying genes that are optimally expressed at low osmolarity in Salmonella enterica serovar Typhimurium (S. Typhimurium). We report here the identification of a novel LysR-type transcriptional regulator (LTTR) that shows osmolarity-dependent expression.

Materials and methods

Bacteria, bacteriophages, plasmids and growth conditions

Bacterial strains, plasmids and phages used are listed in Table 1. Cells were routinely grown in Luria–Bertani (LB) medium. For some experiments, LB was modified by adding NaCl up to 0.5 M (LB 0.5 M NaCl) or by not including NaCl (LB 0 M NaCl). When required, X-Gal (40 μg mL−1) was added to the culture medium. Antibiotics were used at the following concentrations: kanamycin (Km) 50 μg mL−1; ampicillin (Ap) 25 and 50 μg mL−1; tetracycline (Tc) 15 μg mL−1. The growth temperature was 37 °C unless noted otherwise. To obtain phage-free isolates, transductants were purified by streaking on EBU plates (LB agar supplemented with 0.25% glucose, 0.25% KH2PO4, 12.5 mg L−1 Evans Blue and 25 mg L−1 fluorescein).

Table 1.   Bacteria, plasmids, bacteriophages and oligonucleotides used
Bacterial strainRelevant characteristicsSource or reference
Salmonella enterica serovar Typhimurium
 TT1704Δhis-9533Torreblanca & Casadesús (1996)
 TT0288hisD9953∷MudJ, hisA9544∷MudIHughes & Roth (1988)
 TT1704-OSyfeR∷MudJThis study
 TT1704YΔyfeR, KmrThis study
Escherichia coli
 HB101supE44, supF58, hsdS3(rBmB), recA13, ara-14, proA2, lacY1, galK2, rpsL20, xyl-5, mtl-1Sambrook et al. (1989)
 BL21(DE3)hsdS, gal, lcIts857, ind1, Sam7, Nin5, lacUV5-T7gene1Studier & Moffatt (1986)
Bacteriophage
 P22HTint4 Schmieger (1972)
Plasmids
 pET3boriPMB1, Apr, promotor T7Novagen
 pET22boriPMB1, Apr, promotor T7, His.tagNovagen
 pLA2917Tcr, KmrAllen & Hanson (1985)
 pMC931lacZCasadaban et al. (1980)
 pLG338-30OripSC101, AprCunningham et al. (1993)
 pLACPpLA2917+yfeR, Tcr, KmrThis work
 pLGYFERpLG338-30+yfeR, AprThis work
 pKD46oriR101, repA101 (ts), araBp-gam-bet-exo (Red helper plasmid, Ts; Apr)Datsenko & Wanner (2000)
 pKD4oriRγ; Kmr, AprDatsenko & Wanner (2000)
 pETYFERHISpET22b+yfeR-His, AprThis work
 pETYFERrpET3b+complementary strand to mRNA yfeR, AprThis work
 pLGYFEHLACpLG338-30+yfeHlacZ, AprThis work
NameSequence
  • *

    In primers YFERP1 and YFERP2 homology to regions P1 and P2 of plasmid pKD4 are in bold.

Oligonucleotides
 KMR65′AATCCAATGTCCTCCCGG3′
 OSMTE5′TGCGCGCCATGAATTCTCATTACCAGACCAGACCGACC3′
 OSMTB5′GTTTGACCGCCGATGGATCCTACGCTGCTCGGGC3′
 CITB5′GGATAGGATCCAGTTTCATAAAAAC3′
 YFERP1*5′GATGAATTATTCACTGCGTCAACTGCGTATTTTTATTACCG
GTGTAGGCTGGAGCTGCTTC3′
 YFERP2*5′GAAGACCGCACCTCACACACGGACAGATAGATATTTATAG
CATATGAATATCCTCCTTAGT3′
 YFERNDE5′GGAATTCCATATGAACTATTCACTGCGTC3′
 YFERXHO5′CCGCTCGAGCTGATACAGCGGATCTTT3′
 CTXIR5′TGGCTGCCGCCAGCGATGATC3′
 OSMTIR5′TACGCAGTTGACGCAGTG3′
 MUTUP5′TCTCAAAGCGAAAAACGCAAAATAGCTGGCACCGACTTTC3′
 MUTDOWN5′TTGCGTTTTTCGCTTTGAGAGCATCTATATATGAATCTA3′
 YFERGSP15′GATATCCGCCTCAATAG3′
 YFERGSP25′GTCGACTGCCGGAAGCATAA3′
 YFERGSP35′GGCTTCACACTGTAAATCCA3′
 YFEHGSP15′CGAGTGAAGTAAACGCAAT3′
 YFEHGSP25′AGAGCATAGGGTCGACATTG3′
 YFEHGSP35′TACGCCGAGGACAGGAAAGA3′

DNA manipulations

Restriction digestion, ligation, transformation, agarose gel electrophoresis and DNA manipulations were performed using standard procedures. For plasmid DNA preparations, the Wizard® Plus SV Minipreps kit (Promega) was used. DNA was recovered from agarose gels by electroelution or Qiaquick® gel extraction kit (Qiagen). The Wizard® Clean-Up System (Promega) was used for purification of DNA fragments. PCR experiments were performed in the Perkin Elmer GeneAmp PCR System 2400 according to standard protocols, using DynaZyme (Finnzyme). Oligonucleotides used are listed in Table 1. DNA sequencing reactions were carried out according to the instructions of the BigDye® Terminator v3.1 Cycle Sequencing Kit from Applied Biosystems.

Random formation of transcriptional lac fusions

A lysate of P22HTint4 phage grown on S. Typhimurium strain TT10288 (hisD9953∷MudJ) was used to transduce strain TT1704, selecting Km resistance (Kmr). The recipient strain carried the nontransducible deletion his-9953, which avoids homologous recombination with MudJ from donor lysate.

Identification of lacZ insertions in strain TT1704-OS

To identify the gene in which MudJ was inserted, Sau3A-partially digested TT1704-OS chromosomal DNA was ligated with BglII-digested cosmid pLA2917. The ligation was packed following instructions from Gigapack III (Stratagene) and used to infect E. coli HB101. Transductants were selected on LB plates supplemented with tetracycline and kanamycin. Plasmid pLACP was recovered from one of the transductants and used to sequence the cloned fragment. A 1000-bp DNA fragment starting from primer KMR6 corresponding to the 3′ end of MudJ was subsequently sequenced.

Cloning of yfeR gene in plasmid pLG338-30

To monitor the effect of YfeR on yfeR gene transcription, the complete yfeR gene, including the promoter region, was amplified using primers OSMTE and OSMTB, which introduce EcoRI and BamHI restriction sites, respectively. Then this fragment was cleaved with EcoRI–BamHI and ligated to plasmid pLG338-30 digested with the same enzymes, yielding plasmid pLGYFER.

RNase protection assay

Total cellular RNA was isolated from mid-exponential phase (OD600 nm=0.5) using the acid phenol method. Plasmid pETYFERr, containing nucleotides +373 to +704 of the yfeR coding sequence under the control of the T7 RNA polymerase promoter, was used to generate the yfeR probe. Linearized pETYFERr was used as a template for the retention of antisense radiolabeled probes to the yfeR gene by in vitro transcription with T7 RNA polymerase (Roche) in the presence of [α-32P]UTP. The purity of the probe was checked by 6 M urea-polyacrylamide gel electrophoresis (PAGE). For the RNase protection assay, 25 μg of total RNA were hybridized to an excess of radiolabeled probe. The nonhybridized RNA and probe were degraded with RNase-ONE (Promega). The protected probe was separated in 6 M urea-PAGE and visualized by autoradiography.

Construction of an yfeHlacZ fusion in plasmid pLG338-30

To study the influence of yfeR gene product in yfeH expression we constructed an yfeH translational fusion. A PCR fragment including the yfeR gene, the intergenic region between yfeH and yfeR and 14 bp from the start of yfeH was generated with primers CITB and OSMTB. This fragment contained a SalI restriction site in the yfeR gene and primer CITB introduced a BamHI site at the start of the yfeH gene. The PCR fragment was SalI and BamHI digested and ligated to SalI-BamHI-digested pLG338-30 and to a Bam HI-lacZ cartridge obtained from plasmid pMC931. The resulting plasmid was termed pLGYFEEHLAC.

Construction of an yfeR mutant

To obtain a yfeR deletion mutant from strain TT1704 we used the method described by Datsenko & Wanner (2000). The FRT-flanked kanamycin resistance of plasmid pKD4 was amplified by PCR with primers YFERP1 and YFERP2. Nucleotides +40 to +921 of yfeR coding sequence were deleted and replaced by a Kmr cassette.

Preparation of His-YfeR protein

To overexpress His-YfeR, plasmid pETYFERHIS was constructed. The yfeR gene of S. Typhimurium was amplified using primers YFERNDE, which introduces an NdeI target just at the translation start site, and YFERXHO which eliminates the stop codon of the yfeR gene by introducing an XhoI restriction site. Then, the PCR fragment was NdeI–XhoI cleaved and cloned into pET22b, resulting in plasmid pETYFERHIS, which contains the complete coding sequence of yfeR gene, being fused to a His-Tag at C-terminal end. The plasmid was transformed into E. coli BL21 (DE3) and YfeR expression was induced at OD600 nm 0.9 by adding 0.5 mM isopropyl-β-d-thiogalactopyranoside and incubated for 2 h at 18 °C. Cells were pelleted by centrifugation and resuspended in 20 mL of buffer A (20 mM HEPES pH 7.9, 10% glycerol, 100 mM KCl, 5 mM MgCl2, 20 mM imidazole). Cells were lysed by three passages through a French Press at 1000 psi. His-tagged protein was purified by nickel chelate affinity chromatography using Ni-NTA resin (Qiagen) under batch conditions. A fragment containing the intergenic region between yfeR and yfeH (89 bp) and 221 bp of the yfeH gene, generated by PCR using primers CITXR and OSMTIR, was used as target DNA for band shift assays. To eliminate the T-N11-A binding motif, a crossover PCR deletion was done with oligos MUTUP and MUTDOWN, which contain a 20-bp-long overlapping region. Binding reactions were carried out in 20 μL of DNA-binding buffer (40 mM Tris-HCl, pH 8, 100 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, 2 mM MgCl2, 5% glycerol) with 50 fmol of the corresponding 32P-labeled DNA fragment and various amounts of the purified YfeRHis protein. The mixture was incubated at 25 °C for 15 min and loaded onto a 5% polyacrylamide gel in Tris-Borate-EDTA buffer. The gels were electrophoresed at 100 V for 1 h and dried.

Mapping of yfeR and yfeH transcription start site

The transcription start points were located with the 5′RACE system for rapid amplification of cDNA ends, version 2.0 (Invitrogen). Five micrograms of total RNA were reverse transcribed with GSP1 primers to copy mRNA into cDNA. After a dC- tailing reaction of cDNA a PCR amplification was carried out using a deoxyinosine-containing anchor primer, provided with the kit, and a GSP2 primer. To reduce the high background of nonspecific amplification, a second PCR was performed, using a nested anchor primer of the 5′RACE kit and GSP3 primers. The single DNA bands for each gene resulting from this second PCR reaction were purified and sequenced.

RNA isolation, microarray procedure and data analysis

Transcriptomic analyses was performed on a DNA microarray engineered by the Salgenomics consortium of research groups. The Salgenomics microarray contained 6119 probes (including ORFs, RNA genes and intergenic regions) from the genome sequence of S. enterica serovar Typhimurium SL1344 and was developed using sequences from the Welcome Trust Sanger Institute. RNA was isolated from cultures of TT1704 and TT1704Y strains grown in LB 0 M NaCl until mid-exponential phase (OD600 nm=0.5). RNA extraction, retrotranscription, labeling, hybridization, microarray scanning and data analysis were performed as described elsewhere (Mariscotti & García-del Portillo, 2009).

Results

Construction of random osmoregulated lacZ fusions in S. Typhimurium TT1704 and characterization of MudJ insertion into the yfeR gene

To search for osmoregulated genes, we first obtained a collection of 3000 random MudJ insertion mutants of strain TT1704. Clones exhibiting low osmolarity-dependent Lac+ phenotype conditions on indicator LB-X-Gal plates were selected. Evaluation of β-galactosidase activity in cell extracts confirmed lacZ osmoregulation. To show that osmoregulated lacZ expression was linked to the gene where MudJ was inserted, each MudJ insertion was backcrossed into a clean background. One of the transductants showing the same osmoregulated Lac phenotype as the original MudJ insertion mutant (clone TT1704-OS) was selected for further characterization.

A library from strain TT1704-OS was constructed in cosmid pLA2917 (see Materials and methods for details). Analysis of the flanking sequences to MudJ revealed a large ORF. We searched for homologies against the S. Typhimurim LT2 genome annotation, and it matched to the yfeR gene, reported as a putative LysR transcriptional regulator (McClelland et al., 2001). Its gene product, the YfeR protein, shows features that are shared by members of the LTTRs. It exhibits high similarity to other described LTTRs, contains the consensus helix–turn–helix DNA-binding domain (amino acids 5–64, pfam 00126), and shows the anomalous Lys/Arg ratio (0.19).

Regulation of yfeR expression

Strain TT1704-OS was grown in LB medium containing variable concentrations of NaCl, and its β-galactosidase activity was evaluated. In all conditions tested, the growth rate was similar to that of the parental strain (data not shown). When compared with high osmolarity conditions, growth under low osmolarity conditions resulted in a fourfold increase in the β-galactosidase activity (Fig. 1a). Growth in LB medium rendered intermediate β-galactosidase values (data not shown). An osmotic challenge was also used to provide further evidence of yfeR osmoregulation. Strain TT1704-OS was grown in LB medium at low and high osmolarity conditions to the mid-exponential growth phase, and then a shift of LB medium was done: β-galactosidase activity was evaluated before and after the medium shift (Fig. 1b). As expected, cultures switched to high and low osmolarity conditions decreased and increased its β-galactosidase activity, respectively. Lastly, to confirm osmoregulation of the yfeR gene, we detected yfeR mRNA by RNase-ONE protection assay. As predicted (Fig. 1c), yfeR-specific mRNA increases when cells grow under low osmolarity conditions.

Figure 1.

 Osmoregulation of yfeR expression. (a) Evaluation of β-galactosidase activity in exponential and early stationary phase cultures of strain TT1704-OS grown either in LB 0 M NaCl or LB 0.5 M NaCl. Values are presented as means±SD of three independent experiments. (b) Osmotic challenge: evaluation of β-galactosidase activity of cultures grown in LB 0 M NaCl and LB 0.5 M NaCl to an OD600 nm=0.5 and switched to LB 0.5 M NaCl and LB 0 M NaCl, respectively. β-Galactosidase activity was evaluated before, 30 min and 1 h after the medium shift. Values are presented as means±SD of three independent experiments. (c) RNase protection assay. Autoradiography of the electrophoretic analysis of yfeR mRNA protected against the RNase ONE. In each lane the RNA analyzed was isolated from exponential cultures of strain TT1704 growing either in LB 0 M NaCl (lanes 1 and 2) or in LB 0.5 M NaCl (lanes 3 and 4). Lanes 5 and 6 correspond, respectively, to 1/100 and 1/10 dilutions of radioactive probe.

Many members of the LTTR family autorepress their transcription. To test this, we cloned the yfeR sequence in the low copy number plasmid pLG338-30. The resulting plasmid (pLGYFER) was introduced into strain TT1704-OS. β-Galactosidase values obtained (Fig. 2) confirmed that the YfeR protein represses its expression both at low and at high osmolarity.

Figure 2.

 YfeR regulates its own expression. β-Galactosidase activity of strains TT1704-OS, TT1704-OS (pLG338-30) and TT1704-OS (pLGYFER) was determined in cultures growing in LB at different osmolarities. Samples were taken at exponential phase of growth (OD600 nm=0.5). Values are presented as means±SD of three independent experiments.

Determination of transcription start points of yfeR and yfeH genes and binding of YfeR protein to the yfeR-yfeH intergenic region

A common property of members of the LysR family is that they regulate the adjacent gene, located in inverted orientation. An ORF (yfeH) is located upstream of yfeR and in inverted orientation (Fig. 3a). The yfeH gene is predicted to encode a putative Na+-dependent transporter. To map the 5′ end of transcription of both genes a 5′RACE experiment was carried out. The nucleotide sequence of the 5′RACE products showed that transcription of yfeR and yfeH genes started at the adenosines located, respectively, 26 and 20 bp upstream of yfeR and yfeH genes translation start points (Fig. 3a). The −35 and −10 boxes for each promoter were bioinformatically determined.

Figure 3.

 (a) Intergenic region between yfeR and yfeH. Partial nucleotide sequence (yfeH complementary strand) and the deduced amino acid sequence of each gene are shown. Solid short and dashed arrows indicate translation startpoints for yfeR and yfeH, respectively. The yfeR and yfeH transcription initiation sites (A nucleotides, shown on a grey background) were determined by 5′RACE. Putative −10 and −35 are boxed and shown in white and black background (complementary strand) for yfeR and yfeH genes, respectively. The proposed LTTR family consensus binding site is in bold, with the inverted repeats marked with long arrows. Amino acids 5–64 of YfeR protein that constitute a conserved LTTR helix–turn–helix (HTH) motif are bold. (b and c) Binding of His-YfeR to the 32P-DNA probes containing the yfeR-yfeH intergenic region with (b) and without (c) the T-N11-A binding motif. Lane 1, free probe; lanes 2–4, increasing amounts of His-YfeR protein.

The 89-bp yfeR-yfeH intergenic region (Fig. 3a) contains the motif 5′AATAA-N7-TTATT3′. This motif, named T-N11-A, with the T and A being part of a short inverted repeat, has been proposed and supported by numerous studies as the regulatory binding site sequence to which LysR-type proteins primary bind and recognized as the autoregulatory site (Maddocks & Oyston, 2008). To confirm that YfeR binds to the intergenic region, we performed band shift assays with His-YfeR protein and a 310-bp fragment which includes the yfeH-yfeR promoter region. Slow migrating protein–DNA complexes could be evidenced (Fig. 3b). These complexes were not formed when the T-N11-A binding motif was deleted (Fig. 3c).

Regulation of yfeH expression

The location of yfeH adjacent to yfeR and divergently transcribed makes yfeH a likely candidate to be regulated by YfeR. To confirm this we cloned a yfeHlacZ fusion rendering plasmid pLGYFEHLAC. In addition, the yfeR gene from strain TT1704 was deleted and replaced by a FRT-flanked Kmr cassette (kam), rendering strain TT1704Y. Plasmid pLGYFEHLAC was then transformed into strains TT1704 and TT1704Y and β-galactosidase activity was evaluated at different osmolarity conditions. The results obtained (Fig. 4) showed that growth at high osmolarity results in yfeH upregulation. In addition, it is also apparent that, independently of the osmolarity of the culture medium, yfeH expression increases when cells enter the stationary phase.

Figure 4.

 Regulation of yfeH expression. β-Galactosidase activity of strains TT1704 (pLGYFEHLAC) and TT1704Y (pLGYFEHLAC) was measured in cultures growing in LB at low and high osmolarity. Samples were taken at different points of growth phase. Values are presented as means±SD of three independent experiments.

Global transcriptomic analysis of an yfeR mutant

To further search for additional YfeR-regulated genes we performed a transcriptomic analysis in LB at low osmolarity, which are the conditions rendering higher yfeR expression levels. When compared to the wild-type strain, the yfeR mutant presented several deregulated genes, both up- and downregulated (Table 2). Remarkably, a significant proportion of them belong to functional categories of amino acid transport and metabolism, or cell envelope proteins.

Table 2.   Genes repressed or induced more than twofold (M≤−1 or M≥1, respectively) in TT1704Y with respect to TT1704 with a P-value <0.05
Probe IDFold changeP-valueDescriptionGroup
STM0360−2.010.024STM0360 | cytochrome BD2 subunitEnergy production and conversion | Islands
STM0367−2.020.029prpR | prp operon regulatorSignal transduction
STM3305−2.020.005ispB | octaprenyl diphosphate synthaseCoenzyme metabolism
STM1570−2.030.005fdnG | formate dehydorgenase-Nα subunit INo data
STM3871−2.030.012atpB | ATP synthase subunit AEnergy production and conversion
STM2934−2.050.011cysN | sulfate adenylyltransferase subunit 1Inorganic ion transport and metabolism
STM1596−2.060.048ydcX | putative inner membrane proteinNo data
STM3903−2.080.026ilvE | branched-chain amino acid aminotransferaseAmino acid transport and metabolism
STM3859−2.150.007aroE | shikimate 5-dehydrogenaseAmino acid transport and metabolism
STM1160−2.250.004solA | putative sarcosine oxidaseAmino acid transport and metabolism
STM4121−3.330.025argC | N-acetyl-γ-glutamyl-phosphate reductaseAmino acid transport and metabolism
STM43732.030.014yjfK | putative cytoplasmic proteinNo data
STM18512.040.021STM1851 | putative cytoplasmic proteinNo data
STM08352.090.018STM0835 | putative Mn-dependent transcriptional regulatorTranscription
STM02222.090.004cdsA | CDP-diglyceride synthaseLipid metabolism
STM28572.110.010hypD | putative hydrogenase formation proteinNo data
STM3079-S2.190.019STM3079-S | putative hydrolase/acyltransferaseNo data
STM19322.190.015ftnB | ferritin-like proteinInorganic ion transport and metabolism
STM12062.220.019ycfL | putative outer membrane lipoproteinNo data
STM14902.220.004STM1490 | putative voltage-gated ClC-type chloride channel ClcBInorganic ion transport and metabolism
STM17522.220.034galU | glucose-1-phosphate uridylyltransferaseCell envelope biogenesis and OM
STM21542.220.018mrp | putative ATP-binding proteinNo data
STM39442.240.010STM3944 | putative inner membrane proteinNo data
STM02972.260.017putative transposaseNo data
STM18072.280.005dsbB | disulfide bond formation protein BSurface structure
STM00592.290.045citD2 | putative citrate lyase acyl carrier protein γ chainEnergy production and conversion | Islands
STM16272.350.010STM1627 | alcohol dehydrogenase class IIIEnergy production and conversion
STM38272.380.012dgoT | d-galactonate transport proteinCarbohydrate transport and metabolism
STM44092.400.019ytfM | putative outer membrane proteinCell envelope biogenesis and OM
STM34292.680.010rplX | 50S ribosomal protein L24Translation, ribosomal structure and biogenesis

Discussion

The search for new osmoregulated genes in S. Typhimurium led us to identify the yfeR gene. We show here that, as predicted (McClelland et al., 2001) it encodes a new member of the LTTR family, which includes one of the largest sets of prokaryotic transcriptional regulators (Henikoff et al., 1988). LTTRs were initially characterized as transcriptional activators of a single divergently transcribed gene. Since then, extensive research has provided evidence that LTTRs also include regulatory proteins that can act either as activators or as repressors of gene expression and that can also be considered as global regulators (Maddocks & Oyston, 2008). A relevant example of this latter class is OxyR, a positive modulator of the expression of genes in response to oxidative stress in E. coli and Salmonella (Christman et al., 1989). Evidence also exists of regulation of genes other than the adjacent one. As an example, NhaR modulates expression of its adjacent gene nhaA in response to Na+ (Rahav-Manor et al., 1992) and, in addition, modulates osmC in response to different environmental inputs (Sturny et al., 2003). LysR-like proteins regulate genes with diverse functions in many prokaryotic genera. A significant number of these modulators are involved in the adaptation to nutritional stimuli (Guillouard et al., 2002). Others are involved in the response of bacterial cells to environmental outputs, such as stress (Lahiri et al., 2008) or quorum sensing (Cao et al., 2001; Kim et al., 2004). Some of them are of special interest due to their implication in virulence (Axler-Diperte et al., 2006; Heroven & Dersch, 2006).

A recent report has shown that Salmonella encodes 44 LTTRs. To date, the target genes of just 16 of them have been characterized (Lahiri et al., 2009). We present here preliminary characterization of YfeR (referred as STM2424 by Lahiri et al., 2009). Evidence that this modulator belonging to the LTTR family comes from the facts that YfeR (1) exhibits sequence and structure similarities to members of the LTTR, (2) binds specifically to the intergenic yfeR/yfeH region and (3) autoregulates its own transcription. An outstanding feature of YfeR is the fact that its expression is sensitive to the osmolarity of the medium, and it is induced when cells grow at low osmolarity. Apart this report, low osmotic stress increasing the expression of a LTTR has only been described for the Anabaena regulator RbcR1 (Mori et al., 2002). A global transcriptomic analysis of Yersinia pestis showed three osmolarity-regulated LTTRs (upregulated by high-salinity stress; Han et al., 2005).

Interestingly, expression of the putative Na+-dependent transporter YfeH appears to be governed by a complex network, rather than by YfeR alone. It is apparent that, rather than osmolarity, the main factor influencing YfeH expression is the stationary phase. Expression of yfeH increases in yfeR mutants only when cultures grown at high osmolarity enter the stationary phase. Whereas this suggests that YfeR is a repressor of yfeH transcription, it is also apparent that factors other than YfeR modulate YfeH expression. In turn, this strongly suggests that, as has been shown for other LTTRs, YfeR targets genes other than to those adjacent to it, and that may be required for optimal growth under low osmolarity conditions. The global transcriptomic analysis performed in this work supports this assumption. Interestingly, whereas several upregulated genes in the yfeR mutant encode envelope proteins, downregulated genes encode proteins related to amino acid transport and metabolism. These results suggest that, when growing under low osmolarity conditions, YfeR, either directly or indirectly, represses some envelope proteins and induces specific amino acid metabolic pathways. These factors may contribute to the adaptive response of Salmonella to low osmolarity conditions. Whereas in the recent past LTTRs appeared to specifically modulate transcription of their adjacent gene, increasing experimental evidence shows that both modulators and the modulated genes are related to more complex regulatory networks (Lehnen et al., 2002; Hernández-Lucas et al., 2008; Lahiri et al., 2008).

Acknowledgements

This work was supported by funds from the Spanish Ministry for Education and Sciences (BIO2007-64637; CSD2008-00013). J. Casadesús is acknowledged for supplying strains of S. enterica serovar Typhimurium TT1704 and TT0288.

Ancillary