SEARCH

SEARCH BY CITATION

Keywords:

  • Enterococcus faecalis;
  • bacteriophage φEf11;
  • phage genome sequence and analysis

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgement
  7. References

φEf11 is a temperate Siphoviridae bacteriophage isolated by induction from a lysogenic Enterococcus faecalis strain. The φEf11 DNA was completely sequenced and found to be 42 822 bp in length, with a G+C mol% of 34.4%. Genome analysis revealed 65 ORFs, accounting for 92.8% of the DNA content. All except for seven of the ORFs displayed sequence similarities to previously characterized proteins. The genes were arranged in functional modules, organized similar to that of several other phages of low GC Gram-positive bacteria; however, the number and arrangement of lysis-related genes were atypical of these bacteriophages. A 159 bp noncoding region between predicted cI and cro genes is highly similar to the functionally characterized early promoter region of lactococcal temperate phage TP901-1, and possessed a predicted stem-loop structure in between predicted PL and PR promoters, suggesting a novel mechanism of repression of these two bacteriophages from the λ paradigm. Comparison with all available phage and predicted prophage genomes revealed that the φEf11 genome displays unique features, suggesting that φEf11 may be a novel member of a larger family of temperate prophages that also includes lactococcal phages. Trees based on the blast score ratio grouped this family by tail fiber similarity, suggesting that these trees are useful for identifying phages with similar tail fibers.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgement
  7. References

Enterococcus faecalis is a facultatively anaerobic, Gram-positive coccus, commonly growing in short chains or clusters. Although these bacteria have long been considered to be ubiquitous, commensal organisms commonly isolated from the mammalian alimentary canal as well as from water and soil (Facklam et al., 2002), more recently, they have emerged as opportunistic pathogens associated with a variety of medical and dental infectious diseases. These organisms are among the most frequent causes of nosocomial infections (Moellering, 1992; Edgeworth et al., 1999; Richards et al., 2000), and are the third leading cause of infectious endocarditis, accounting for approximately 20% of all cases (Megran, 1992; National Nosocomial Infections Surveillance System, 1999). Oral manifestations of E. faecalis infections include persistent periapical periodontitis in endodontically treated teeth (Stuart et al., 2006), and the presence of this organism in the subgingival plaque of 5% of teeth with severe periodontitis (Rams et al., 1992). This pathogenic potential has led to concern over the fact that increasingly, strains of E. faecalis have been found to be resistant to currently available antibiotics. In this regard, strains of E. faecalis have recently been found to be resistant to vancomycin, one of the last antibiotics previously thought to be reliably effective against this organism (Bonten et al., 2001).

The genome of one such vancomycin-resistant E. faecalis strain (strain V583) has been sequenced, and within this genome, seven integrated prophage regions were detected (Paulsen et al., 2003). Along with numerous insertion elements, transposons, and integrated plasmid genes, these seven integrated prophage regions comprise over 25% of the total E. faecalis chromosome (Paulsen et al., 2003). Although the degree to which the E. faecalis chromosome is inhabited by exogenous/mobile genetic elements such as prophages is quite remarkable (and unique among sequenced bacterial genomes), the existence of these E. faecalis bacteriophage genomes is not surprising. Enterococcus faecalis bacteriophages have been known for >70 years (Evans, 1934; Bleiweis & Zimmerman, 1961), and their inducibility from lysogenic E. faecalis strains has similarly been well established (Kjems, 1955). Enterococcus faecalis phages have been isolated directly, or induced from E. faecalis lysogens, from a variety of sources such as fresh water streams (Paisano et al., 2004), sewage (Evans, 1934; Bleiweis & Zimmerman, 1961; Uchiyama et al., 2008), rat intestinal contents (Rogers & Sarles, 1963), human urogential secretions (Ackermann et al., 1975), human saliva (Bachrach et al., 2003), and human oral mucosae (Natkin, 1967).

Recently, we isolated temperate bacteriophages that were induced from E. faecalis strains recovered from the infected root canals of teeth that had previously undergone endodontic treatment (Stevens et al., 2009). One of the isolates, designated phage φEf11, was characterized as a Siphoviridae morphotype, with a spherical head and a long noncontactile tail. Analysis of NdeI and NsiI restriction fragments indicated a DNA length of approximately 41 kb. To further our understanding of this virus, and explore its potential for either contributing to or mitigating against the pathogenicity of its host cell, we undertook the sequencing and functional analysis of its complete genome.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgement
  7. References

Bacterial strains and bacteriophage

TUSoD11 is a lysogenic strain of E. faecalis that was originally isolated from an infected human root canal (Stevens et al., 2009). Enterococcus faecalis JH2-2 (originally generously provided by Dr Nathan Shankar, University of Oklahoma Health Science Center) served as an indicator strain in plaque assays. φEf11 is a temperate bacteriophage whose prophage is integrated into the TUSoD11 chromosome.

Phage propagation and purification

Phage φEf11 was induced from lysogenic E. faecalis strain TUSoD11, and purified as described previously (Stevens et al., 2009). Briefly, mitomycin C was added to log-phase cultures of E. faecalis TUSoD11 grown in brain–heart infusion broth, to a final concentration of 4 μg mL−1. Following an overnight incubation, the lysate was treated with DNase I (1 μg mL−1), centrifuged at 10 400 g (Sorvall GSA rotor at 8000 r.p.m.) for 10 min and then 16 300 g (Sorvall GSA rotor at 10 000 r.p.m.) for 5 min, and the resulting supernatant was concentrated by tangential flow filtration. The phage in the concentrated preparation was banded in a CsCl step gradient (δ=1.35, 1.50 and 1.70) at 106 000 g (Beckman SW 41 rotor at 25 000 r.p.m.) for 2 h, and, after dialyzing against SM buffer (0.1 M NaCl, 8.1 mM MgSO4·7H2O, 0.05 M Tris-HCl pH 7.5, 0.01% gelatin), finally pelleted by centrifugation at 153 000 g (Beckman SW 41 rotor at 30 000 r.p.m.) for 2 h.

DNA sequencing

DNA was extracted from the purified phage based on the methods of Sambrook et al. (1989) as described previously (Stevens et al., 2009). The DNA was sheared by nebulization to 2–3-kb size fragments, which were fractionated and purified by agarose gel electrophoresis. The size-selected DNA fragments recovered from the agarose gels were ligated into a pHOS2 sequencing vector, and transformed into competent Escherichia coli DH10B cells. Colonies of transformants were recovered from selective plates and the recombinant plasmid clones were purified, and used as templates in Sanger dideoxy sequencing reactions. The trimmed sequences were assembled together using the celera assembler software (Myers et al., 2000).

Bioinformatic analysis

ORF prediction was carried out using glimmer (Salzberg et al., 1998). Candidate genes were selected from ORFs of at least 90 bp length. All putative proteins were searched using blastp (Altschul et al., 1990) against several nonredundant amino acid databases (GenBank, SwissProt, PIR, CMR). Significant hits were then stored in a mini database for Blast-Extend-Repraze (BER) searches. The putative proteins were also analyzed with two sets of hidden Markov models (HMMs) constructed for a number of conserved protein families: Pfam version 22.0 (Finn et al., 2008) and TIGRFAMs release 8.0 (Selengut et al., 2007). A protein matching a TIGRFAMs HMM with a score that is above the curated trusted cut-off is given the annotation of the TIGRFAM. The automated functional assignments were refined by manual curation of each putative protein by means of the manatee web-based annotation tool (http://manatee.sourceforge.net). The sequence and annotation of the φEf11 genome has been deposited in the GenBank database under the accession number GQ452243.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgement
  7. References

φEf11 DNA characteristics

The phage genome was found to be comprised of 42 822 bp. Based on the DNA sequence, the predicted NdeI and NsiI restriction maps were in good agreement with those experimentally obtained previously (Stevens et al., 2009). The G+C mol% of the phage DNA was 34.4%. In comparison, the G+C mol% of the host E. faecalis chromosome is 37.38% (McShan & Shankar, 2002).

Genome analysis

An analysis of the genome revealed 65 ORFs. Most initiate translation at an ATG codon (60 ORFs), while GTG (two ORFs) and TTG (three ORFs) are used less frequently. The genome of φEf11 is very condensed in terms of coding sequences: protein-coding sequences account for 92.8% of the genome. The small portion of noncoding sequence is distributed over the genome in an uneven, nonuniform manner. There are 50 bp or fewer in most (43/65 or 66.2%) of the intergenomic, non-protein-coding regions of the genome. The longer (>50 bp) noncoding sequences are distributed among the remaining 22 (33.8%) intergenomic regions, and among these are the most likely candidates for operator/promoter sites. The highly condensed nature of the protein-coding sequences within the genome allows transcriptional read-through, permitting the expression of many genes to be under the control of each operator/promoter. Therefore, it is to be expected that few regulatory/control sequences would be required within the φEf11 genome.

The putative proteins of the entire genome were compared with databases using a web-based manual annotation tool (manatee) at the J. Craig Venter Institute. Protein homologies were identified (Table 1) on the basis of significant blastp matches (P-value ≤10−5 and identity ≥35%) to phage-encoded proteins or similarity to proteins with identified functions using BER and HMMs. Of the 65 putative proteins specified in the φEf11 genome, seven (gene products of PHIEF11_006, PHIEF11_0022, PHIEF11_0042, PHIEF11_0043, PHIEF11_0053, PHIEF11_0057, and PHIEF11_0059) showed no matches to any protein from other species, and were termed ‘hypothetical proteins,’ while the majority of the deduced proteins showed significant similarity to proteins in the databases. In most cases, homologies were found to phages infecting other Gram-positive, low GC bacteria such as Lactococcus lactis, Lactobacillus casei, Streptococcus pyogenes, and E. faecalis (Table 1).

Table 1.   General features of putative ORFs of bacteriophage φEf11, putative functions, and best matches of predicted proteins
ORFStartStopLength (aa)Size (kDa)pIPutative function (gene name)Significant matches (source, accession no.)% Identitye-Value
012181526430.0410.009Phage terminase A domain protein (terA)Putative ATPase subunit of terminase (PF06056)0.0019
      Putative terminase small subunit (Clostridium phage phiCD27, YP_002290877)32.03.0e−15
02808226248454.506.003Phage terminase B protein (terB)Terminase B protein (Enterobacteria phage P1, SP: P27753)29.72.0e−19
      Putative terminase B (Clostridium phage phiCD27, GB: ACH91293)58.02e−148
032267388053761.944.587Phage portal protein (por)Phage portal protein, SPP1 Gp6-like (PF05133)8.6e−42
      Phage portal protein, SPP1 family (TIGR01538)1.6e−34
      Phage portal protein, SPP1 family (Streptococcus agalactiae H36B, GB: EA078841.1)40.02.0e−91
043886482431236.389.287Major head proteinPhage Mu F-like protein (major head protein) (PF04233)1.1e−8
      Phage putative head morphogenesis protein, SPP1 gp7 family (TIGR01641)6.7e−19
      Phage Mu protein F-like protein (Lactococcus lactis ssp. cremoris SK11, GB: ABJ73270.1)52.01.1e−72
05482550948910.579.198Conserved hypothetical proteinUnnamed protein product, ORF20 (Bacillus phage phi105, GB: BAA36677.1)30.50.051
0650995218394.703.794Hypothetical protein
07518454659210.817.345Phage proteinUncharacterized 10.3-kDa protein in GP2-GP6 intergenic region, ORF5 (Bacillus phage SPP1, SP: Q38441)43.28.4e−11
      gp119 (Lactococcus phage KSY1, GB: ABG21662.1)50.63.5e−12
085595623621323.455.100Phage scaffold protein (sfp)Phage scaffold protein (Streptococcus pyogenes phage 10750.2, GB: ABF33893.1)34.92.8e−12
096249659011312.285.883Conserved phage proteinPhage protein (Lactobacillus casei ATCC 334, GB: ABD83378.1)66.73.4e−30
106613762633737.324.833Major head proteinHypothetical protein LSEI_1925 (Lactobacillus casei ATCC 334, GB: ABJ70683.1)58.71.4e−97
      Putative major head protein (Lactobacillus prophage Lj965, GB: AAR27461)50.56.8e−80
117700803211012.894.984Conserved hypothetical proteinUnknown (Lactococcus phage ul36, GB: AAM75791.1)51.93.0e−22
      ORF38 (Lactococcus phage TP901-1, GB: AAK38055.1)48.23.1e−20
128029836411112.714.617Conserved hypothetical proteinHypothetical protein (Lactococcus lactis ssp. cremoris SK11, GB: ABJ72674.1)59.57.9e−31
      Unknown (Lactococcus phage ul36, GB: AAM75792.1)59.51.0e−30
138339871912614.1311.452Phage protein HK97 gp10 (tail assembly) familyPhage (tail assembly) protein, HK97 gp10 family (TIGR01725)8.5e−10
      Putative structural protein (Lactococcus phage P335, GB: ABI54239.1)48.03.0e−23
148716910512914.715.197Major structural proteinORF41 (Lactococcus lactis bacteriophage TP901-1, GB: AAK38058.1)71.13.0e−47
      Major structural protein 2 (Lactococcus phage Tuc2009, GB: AAA32612.1)70.41.0e−46
159121971419721.544.126Phage major tail protein (mtp)Phage major tail protein, TP901-1 family (TIGR02126)8.1e−39
      Major tail protein (Lactococcus phage B1, GB: CAA59191.1)57.12.1e−39
16973010 18815215.954.680Phage major tail protein (mtp)Major tail protein (Staphylococcus phage phiSLT, GB: BAB21741.1) ORF03135.42.8e−12
      (Staphylococcus phage 187, GB: AAX90707.1)36.37.1e−14
1710 24310 59311613.144.957Phage proteinUnknown phage protein (Streptococcus pyogenes MGAS10394, GB: AAT87690.1)42.21.8e−15
1810 68610 9438510.269.344Phage proteinPhage protein (Lactobacillus casei ATCC 334, GB: ABD83368.1)48.39.0e−07
1910 95914 3661135122.195.173Phage tape measure protein (tmp)Tape measure domain (TIGR02675)7.5e−20
      Tail tape measure protein (Bacillus phage BCJA1c, GB: AAU85096.1)35.72e−136
      Tape measure protein, putative (Enterococcus faecalis V583, GB: AAO81743.1)27.91.3e−42
2014 36715 29630935.074.608Phage tail proteinPhage putative tail component, N-terminal domain (TIGR01633)8.2e−18
      Tail protein, putative (Enterococcus faecalis V583, GB: AAO81082.1)78.32e−134
2115 31317 32867174.556.364Phage structural proteinPhage minor structural protein, N-terminal region (TIGR01665)4.9e−38
      74-kDa protein (phage FC1, GB: CAA82772.1)88.82e−295
      Structural protein, putative (Enterococcus faecalis V583, GB: AAO81083.1)65.93e−180
      Phage minor structural protein (Bacillus anthracis phage and conserved domain to Pb1B superfamily, RF: NP843020.1)40.91.6e−103
2217 32917 502576.584.420Hypothetical protein
2317 51319 27658763.274.630Conserved hypothetical proteinHypothetical protein EF_1291 (Enterococcus faecalis V583, GB: AAO81084.1)66.31e−156
2419 35619 577737.987.700Conserved hypothetical proteinORF25 (Streptococcus phage 858, GB: ABT18013.1)43.75.3e−09
2519 57419 777677.309.510Phage holin (hol)Holin (Enterococcus faecalis V583, GB AAO82498.1)95.51.7e−28
      Holin (Lactococcus phage phiAM2, GB: AAG24367.1)54.04.4e−14
2619 78221 04141946.644.860Phage endolysin (lys)LysM domain (PF01476)7.9e−32
      Endolysin (Enterococcus faecalis V583, GB: AAO82497.1)90.31e−202
      Lysozyme (Streptococcus phage CP-L9, SP: P19386)40.92.2e−22
      Lysin (Lactococcus phage ul36, GB: AAM75805.1)58.71.8e−127
      Lysin (Lactococcus phage TP901-1, GB: AAK38070.1)57.52.6e−126
      Lysin (Leuconostoc phage 10MC, GB: AAD02487.1)50.73.2e−98
2721 05421 43412615.088.880Phage autolysin regulatorPhage transcriptional regulator, RinA family (TIGR01636)0.025
2821 52322 78842146.137.276AmidaseM23 peptidase domain protein (PF01551)6.9e−31
      Mannosyl-glycoprotein endo-β-N-acetylglucosaminidase (PF01832)7.7e−05
      N-acetylmuramoyl-l-alanine amidase (E. faecalis phage φEF24C, GB: BAF81277.1)60.71.9e−27
      N-acetylmuramoyl-l-alanine amidase (Streptococcus agalactiae prophage Lambda Sa1, GB: AAM99497)41.81.7e−32
      N-acetylmuramoyl-l-alanine amidase (Streptococcus pyogenes phage 315.3, GB: AAX92493.1)34.73.6e−23
2924 35422 85250057.908.978Membrane protein, putativePutative membrane protein (Lactococcus lactis ssp. cremoris MG1363, GB: CAL96902.1)25.20.0040
      Possible membrane protein (Enterococcus faecalis OG1RF. GB: EDX18748.1)97.00.0
3025 30124 72019320.784.820LysM domain proteinLysM domain lipoprotein (Enterococcus faecalis V583, GB: AAO82491.1)40.74.9e−22
3126 78425 64837844.2610.022Phage integrase protein (int)Site-specific recombinase, phage integrase family (PF00589)3.0e−20
      Integrase (Staphylococcus phage L54a, SP: P20709)33.61.6e−30
3227 42326 85119020.704.828Phage proteinGp32 (Listeria phage A118, GB: CAB53818.1)37.51.9e−11
3327 68427 484667.5611.590Conserved hypothetical proteinUnknown (Lactococcus phage TPW22, GB: AAF12708.1)75.94.0e−20
3428 28027 72618421.145.101Phage proteinPhage protein (Streptococcus pyogenes MGAS6180, GB: AAX72394.1)36.07.0e−07
3528 84128 36815718.235.044Conserved hypothetical proteinDomain of unknown function (DUF955) (PF06114)0.0007
      Hypothetical protein (Enterococcus faecalis V583, GB: AAO81069.1)71.22.0e−57
3629 43028 85819022.306.809Phage repressor (cI)Helix–turn–helix DNA-binding domain (PF01381)5.6e−06
      Repressor (Staphylococcus phage tp310-1, GB: ABS87406.1)54.41.1e−31
      cI (Lactococcus phage TP9011, GB: AAK38021.1)52.39.4e−28
3729 58929 822779.038.843Phage cro-like repressor (cro)Putative Cro repressor protein (PF05339)5.3e−33
      Lj928 prophage Cro repressor (Lactobacillus johnsonii NCC 533, GB: AAS09224.1)57.02.0e−16
3829 90430 62323927.859.820Phage antirepressor proteinPhage antirepressor protein (PF03374)1.7e−69
      Phage AntA/AntB antirepressor (PF08346)1.0e−36
      P1-antirepressor homolog (Streptococcus phage TP-J34, GB: AAC03459.1)57.96.2e−70
3930 63930 8878210.1010.107Phage excisionase protein (xis)Excisionase, putative (Enterococcus faecalis V583, GB: AAO80172.1)31.30.0011
      Excisionase (Lactococcus lactis prophage ps2, GB: AAK04607.1)  
4030 90931 082576.649.734Conserved hypothetical proteinHypothetical protein (Enterococcus faecalis V583, GB: AAO80176.1)73.79.7e−10
4131 07931 204415.2910.752Conserved hypothetical proteinHypothetical protein EF_2033 (Enterococcus faecalis V583, GB: AAO81769.1)76.03.0e−06
4231 18931 344515.869.944Hypothetical protein
4331 40131 637788.974.006Hypothetical protein
4431 63832 31522525.214.735Phage single-strand DNA-binding protein (ssb)ERF superfamily (PF04404) phage single-strand DNA-binding protein1.9e−21
      (Streptococcus pyogenes MGAS5005, GB: AAZ51655.1)36.46.7e−18
      Single-stranded annealing protein (Lactococcus phage ul36.13, GB: AAR1430.91)44.14.1e−18
4532 31533 23830734.804.983Replication protein, putativeLj928 prophage replication protein (Lactobacillus johnsonii NCC533, GB: AAS09218.1)28.71.1e−13
      Protein of unknown function (DUF1351) (PF07083)6.9e−11
4633 23533 91522626.389.096Conserved hypothetical proteinProtein of unknown function (DUF968) (PF06147)7.4e−54
4733 92034 87631837.625.459Phage replisome organizer (rep)Phage replisome organizer, putative, N-terminal region (TIGR01714)2.6e−33
      N-terminal phage replisome organizer (Phage_rep_org_N) (PF09681)1.0e−33
      Phage replisome organizer, putative (Clostridium botulinum A3 str. Loch Maree prophage, GB: ACA53737)40.91.1e−24
      N-terminal phage replisome organizer (Listeria monocytogenes phage A118, GB: CAD00395.1)34.98.2e−32
      N-terminal phage replisome organizer, (Staphylococcus aureus phage 52A, GB: AAX91809)38.13.0e−30
      N-terminal phage replisome organizer (Streptococcus mitis phage SM1, GB: AAP81901.1)42.86.4e−29
4834 88035 40417420.0810.361Conserved hypothetical proteinHypothetical protein (Enterococcus faecalis V583, GB: AAO81860.1)50.62.0e−18
4935 53235 759758.518.963Conserved hypothetical proteinHypothetical protein (Enterococcus faecalis V583, GB: AAO81229.1)92.01.1e−31
5035 85236 28014216.957.127MethyltransferaseMethyltransferase, putative (Enterococcus faecalis V583, GB: AAO81857.1)88.41.2e−68
5136 28236 60210612.748.666pcfupcfu (Enterococcus faecalis plasmid pCF10, GB: AAW51338.1)75.32.6e−41
5236 62337 03313615.584.099Conserved hypothetical proteinPhage conserved hypothetical protein (TIGR01671)8.5e−07
      Hypothetical protein (Streptococcus phage phi3396, GB: ABN10791.1)38.71.0e−07
5337 03037 197556.294.249Hypothetical protein   
5437 19037 79520123.474.371ASCH domain proteinASCH domain (PF04266)2.7e−07
      Conserved domain protein (Enterococcus faecalis V583, GB: AAO81851.1)61.58.1e−45
5537 80938 29416118.789.531Conserved hypothetical proteinHypothetical protein (Enterococcus faecalis V583, GB: AAO81235.1)98.25.8e−83
5638 29538 477606.503.701Conserved hypothetical proteinHypothetical protein (Enterococcus faecalis V583, GB: AAO82522.1)80.02.2e−19
5738 47838 663616.719.926Hypothetical protein
5838 66038 860667.645.493Conserved hypothetical proteinHypothetical protein (Enterococcus faecalis V583, GB: AAO82521.1)50.01.8e−10
5938 82338 942394.6111.648Hypothetical protein 
6039 00539 42113815.869.850Phage autolysin regulatory protein, ArpU familyPhage transcriptional regulator, ArpU family (TIGR01637)5.7e−50
      ArpU (Enterococcus hirae, GB: CAA90711.1)81.15.5e−55
6139 88540 33414916.954.573sbcC domain proteinsbcC domain (COG 0419) conserved domain protein (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, GB: ACA57419.1)33.60.0003
6240 38940 91017319.464.074Phage methylase proteinParB-like nuclease domain (PF02195)1.2e−09
      Adenine methyltransferase, putative (Enterococcus faecalis V583, GB: AAO81243.1)65.96.2e−47
6340 89741 50520222.9610.276DNA modification protein (mom)mom protein. (Enterobacteria phage Mu, SP: P06018)27.15.2e−05
      Putative DNA modification protein (Escherichia coli, GB: BAB38421.1)28.32.7e−09
6441 64241 830627.256.525Conserved domain proteinHypothetical protein (Bacillus licheniformis ATCC 14580,GB: AAU24477.1)51.29.0e−07
      Conserved hypothetical protein (Enterococcus faecalis V583, GB: AAO81244.1)37.04.3e−07
6541 87542 79530634.694.906Conserved hypothetical proteinHypothetical protein phage-associated (Streptococcus pyogenes MGAS315, GB: AAM79581.1)28.52.3e−11
      gp11 (Streptococcus phage SM1, GB: AAP81893.1)24.53.6e−11

A successful bacteriophage infection requires the regulation of gene expression, DNA replication, formation of the phage capsid, and the release of new phage particles from the infected host (Brøndsted et al., 2001). In most bacteriophages, the genes encoding related biological functions are clustered together in functional groups or modules and they are turned on and off in coordination (Ptashne, 2004). The prototype of such a coordinated gene regulation in bacteriophages is the λ family of phages of E. coli (Ptashne, 2004). The genomes of these lambdoid phages typically are composed of 11 modules of clustered, functionally related genes (Casjens et al., 1992). These functional modules in lambdoid genomes include integration/excision, homologous recombination, early gene control, DNA replication, late gene control, head morphogenesis, tail morphogenesis, lysis, and three nonessential regions (Casjens et al., 1992).

In the case of phage φEf11, the 65 ORFs are divided between two divergently oriented groups of modules consisting of eight and 57 genes, respectively (Fig. 1). The eight leftward-transcribed genes (PHIEF11_0029 to PHIEF11_0036) include functions involved in the establishment and maintenance of lysogeny, whereas the rightward-transcribed genes are involved in lytic growth. Further inspection of the identified functions encoded by bacteriophage φEf11 (Table 1) reveals that the genome can be divided into the following eight functional modules (Fig. 1): (1) DNA packaging, (2) head morphogenesis, (3) tail morphogenesis, (4) lysis, (5) recombination, (6) early gene control (lytic vs. lysogenic infection), (7) excision, and (8) late genes of DNA replication/modification.

image

Figure 1.  Organization of the φEf11 genome. The 42 832 bp genome is represented by a horizontal bar with 2.0-kb intervals marked. ORFs are numbered consecutively from left to right and are indicated by arrows pointing to the direction of transcription.

Download figure to PowerPoint

(1) Genes encoding proteins involved in packaging phage DNA (PHIEF11_001 to PHIEF11_003): The deduced amino acid sequences of PHIEF11_001 and PHIEF11_002 gene products show homologies to the terminase A and B subunits of several other phages including Clostridium phage φCD27 and Enterobacteria phage P1 (Table 1). Terminases are phage-specific ATP-binding, packaging proteins that assemble into multimeric packaging complexes. They cut the phage genome at defined sites and mediate the translocation of the DNA through the portal protein into the prohead of the assembling phage particle (Bazient & King, 1985; Black, 1989; Fujisawa & Morita, 1997). The terminase/DNA complex binds to the portal protein before translocation of the DNA into the prohead (Yeo & Feiss, 1995). The smaller terminase protein (TerA) recognizes and binds to the concatemeric phage DNA, whereas the larger terminase protein (TerB) binds to the portal protein, cleaves the DNA, and translocates the mature DNA into the prohead. Analysis of large terminase protein trees has been shown to predict the packaging site mechanism (Casjens et al., 2005); however, a tree including the terminase B subunit of phage φEf11 was inconclusive (data not shown).

A second component of the bacteriophage DNA packaging system is the portal protein. The portal protein forms the portal vertex of the prohead and functions as the site of entrance (and exit) of the DNA into and out of the phage head. The portal also serves as the connector or the joining site between the head and the tail subunits during virion assembly. The deduced protein specified by PHIEF11_003 demonstrated similarity to the portal protein genes of numerous bacteriophages, including Bacillus subtilis phage SPP1, suggesting that PHIEF11_003 is the φEf11 portal protein involved in DNA packaging (Table 1).

(2) Genes encoding proteins involved in head subunit morphogenesis (PHIEF11_004 to PHIEF11_0010): Many of the genes in the next functional module are responsible for head morphogenesis. The PHIEF11_004 gene product shows strong identity with the major head proteins of phage Mu (F protein) and phage SPP1 (gp7 protein). Similarly, the deduced protein specified by PHIEF11_0010 shows similarity to the major head protein of Lactobacillus prophage Li965. Therefore, the gene products of PHIEF11_004 and PHIEF11_0010 are likely to be major components of the phage head subunit. PHIEF11_008 exhibits similarity to the genes for phage scaffold proteins found in several other phages including S. pyogenes phage 10750.2, Lactobacillus johnsonii prophage Lj965, and Staphylococcus aureus phage 80alpha. Moreover, the deduced size (23 446 Da) and pI (5.1) of the product of PHIEF11_008 is well within the size range (22 241–24 369 Da) and pI values (4.7) of the scaffold proteins of these other phages. For these reasons, it would appear that PHIEF11_008 specifies the scaffold protein required for the assembly of the head. The function of the remaining genes within this module cannot be assigned; however, the products of several of these ORFs have similarity to proteins of unknown function encoded by other phages (Table 1).

(3) Genes encoding proteins involved in tail subunit morphogenesis (PHIEF11_0011 to PHIEF11_0020): PHIEF11_0013, PHIEF11_0015, PHIEF11_0016, and PHIEF11_0020 are proposed to be genes encoding the components of the φEf11 tail. They exhibit similarity to tail components of Lactococcus, Staphylococcus, and Enterococcus phages (Table 1). The tape measure protein of bacteriophage λ determines the tail length of the virion (Katsura & Hendrix, 1984; Katsura, 1987). In the φEf11 genome, PHIEF11_0019 has an HMM match (above the curated trusted cut-off) to the tape measure domain found in many tape measure proteins (TIGRFAM TIGR02675), and also overall similarity (blastp) to the tape measure proteins of Bacillus and E. faecalis phages (Table 1). The genes located between the major tail protein and the tape measure protein in many bacteriophages are involved in the formation of a tail initiator complex onto which the major tail protein can polymerize (Brøndsted et al., 2001). PHIEF11_0017 and PHIEF11_0018 show similarity to proteins of S. pyogenes and L. casei phages, which have unknown functions (Table 1). However, PHIEF11_0013, located upstream of the predicted major tail protein genes, has high blastp identity to tail assembly proteins of other phages (Table 1, Fig. 1), suggesting that this may be the gene for the tail initiator complex in φEf11. Furthermore, in most bacteriophages, the genes located between the major head and the major tail genes are involved in the formation and connection of the head and tail structures (Brøndsted et al., 2001); therefore, by analogy, PHIEF11_0011 to PHIEF11_0014 may encode the proteins that serve a similar function.

(4) Genes encoding lysis proteins (PHIEF11_0025 to PHIEF11_0030): The lysis module of the φEf11 genome consists of genes for a holin protein (PHIEF11_0025), an endolysin protein (PHIEF11_0026), a lysin regulatory protein (PHIEF11_0027), an amidase (PHIEF11_0028), a membrane protein (PHIEF11_0029), and a protein with a Lys M domain (PHIEF11_0030). The holin (PHIEF11_0025) and endolysin (PHIEF11_0026) proteins are almost identical to the holin and endolysin of the prophage detected in E. faecalis V583 (Table 1). They also show similarity to similar genes of other phages, such as the holin of Lactococcus phage φAM2 and the endolysins of Streptococcus phage φCP-L9, Lactococcus phages ul and TP901-1, and Leuconostoc phage 10MC (Table 1). Following phage assembly, holin proteins assemble to form pores in the cellular membrane, allowing the digestive enzymes (presumably PHIEF11_0026, PHIEF11_0028, and PHIEF11_0030) access to the surrounding peptidoglycan (Young et al., 2000). The PHIEF11_0027 protein contains a C-terminal domain that is homologous with a family of phage proteins that are autolysin regulatory proteins (ArpU). These transcriptional regulators are believed to control the expression of the lysin genes, which, in the φEf11 genome, surround PHIEF11_0027. The amidase (PHIEF11_0028) belongs to a peptidase family of (zinc) metallo endopeptidases that lyse bacterial cell wall peptidoglycans at gly–gly linkages. Similar peptidases are known to lyse the cell walls of other bacteria as a mechanism of ecological antagonism. The deduced PHIEF11_0028 gene product shows identity to the amidases of numerous other phages including E. faecalis phage φEF24C, Streptococcus agalactiae prophage Lambda SA1, and S. pyogenes phage 315.3 (Table 1). The PHIEF11_0029 protein has eight predicted transmembrane helix motifs along its length. In addition, it shows similarity to a membrane protein of Lactococcus lactis ssp. cremoris MG1363 (Table 1) and a hypothetical protein of L. casei 334, which in turn shows similarity to membrane proteins of E. faecalis OG2RF and TX0204 (NCBI accessions ZP_03056680 and ZP_0394962, respectively). Taken together, this evidence suggests that PHIEF11_0029 codes for a membrane protein. Because holin proteins function through disruption of the host cell membrane, it is possible that as a membrane protein, the PHIEF11_0029 product contributes to this action. PHIEF11_0030 contains a LysM domain detected in chromosomal locus EF2795 of E. faecalis V583 (Table 1). The LysM domain is found in a variety of enzymes involved in bacterial cell wall degradation, and may have a general peptidoglycan-binding function. Consequently, the product of PHIEF11_0030 is also likely to be involved in host cell lysis.

This arrangement of lysis-related genes is unusual in several aspects. First, there appears to be more genes concerned with host cell lysis in the φEf11 genome than is found in most other bacteriophages. Typically, there is one holin gene and one lysin gene present in each phage genome. Here, the φEf11 genome appears to contain at least four (and perhaps five) genes that code for proteins that participate in host cell lysis. Streptococcus mutans phage M102 also has more than one endolysin gene, but both the endolysins found in this viral genome are transcribed in the same direction (van der Ploeg, 2007), whereas φEf11 genes in ORFs PHIEF11_0029 and PHIEF11_0030 are transcribed divergently to the other genes in the lysis module. Secondly, the genes within this module are transcribed divergently, with ORFs PHIEF11_0025 to PHIEF11_0027 and PHIEF11_0028 being transcribed in a rightward direction, and ORFs PHIEF11_0029 and PHIEF11_0030 being transcribed in a leftward direction. This suggests that these two groups of genes within this module are under different regulatory control.

(5 and 6) Genes of the recombination and early gene control modules (PHIEF11_0031 to PHIEF11_0038): The earliest transcriptional activity within the temperate phage genome, after infection, occurs in the recombination and early gene modules. Transcription of the repressor gene, within the early gene module, results in the synthesis of a repressor protein that blocks transcription of the genes of the lytic pathway, leading to the establishment of lysogeny (Ptashne, 2004). Concomitantly, expression of the integrase gene, within the recombination module, mediates the integration of the phage genome into the host chromosome. The deduced protein specified by PHIEF11_0036 contains a helix–turn–helix motif typical of DNA-binding proteins. In addition, the PHIEF11_0036 gene product shows similarity to DNA-binding (cl) repressor proteins of Staphylococcus phage TP310.1 and Lactococcus phage TP901-1 (Table 1). This suggests that PHIEF11_0036 codes for a cl-type repressor protein. Similarly, the deduced product of PHIEF11_0031 bears significant resemblance to a family of proteins (integrases) responsible for site-specific recombination of phage DNA, and specifically shows high sequence identity with the integrase of Staphylococcus phage L54a (Table 1). Consequently, PHIEF11_0031 can be considered to be a gene coding for an integrase.

In lambdoid phages, the phage repressor gene is expressed concurrently with the integrase gene as lysogeny is being established, but in an established lysogen, the phage repressor is on and the integrase is off (Ptashne, 2004). These two ORFs (PHIEF11_0031 and PHIEF11_0036), and most of the remaining genes in the early gene modules (up to and including the repressor gene, PHIEF11_0036), are likely involved in the establishment of lysogeny of phage φEf11, and are all transcribed in a divergent (leftward) orientation from all the remaining ORFs of the genome. The two remaining ORFs in the early gene module (ORFs PHIEF11_0037 and PHIEF11_0038) are transcribed in a rightward direction. PHIEF11_0037 appears to be a cro-like repressor as seen from its similarity to proteins of the Cro repressor protein family, as well as with the Cro repressor of L. johnsonii prophage Lj928 (Table 1). Cro (control of repressor and other genes) repressors are antagonistic to cl repressors and therefore function to block or terminate lysogeny. It is of interest to note that there is a 159 bp noncoding region between the divergently oriented PHIEF11_0036 repressor (cl) and PHIEF11_0037 (cro). As indicated previously, most of the other ORFs in the φEf11 genome are very densely packed, with little intervening, noncoding segments between the ORFs. The noncoding segment between ORFs PHIEF11_0036 and PHIEF11_0037 likely represents a regulatory region where the control of lysogeny vs. lytic growth is determined. This region contains a predicted stem-loop structure in between predicted PL and PR promoters (Fig. 2). The naming of these promoters follows the convention of bacteriophage TP901-1 (Madsen & Hammer, 1998). The base of the stem includes the predicted −35 regions of both promoters, suggesting the stabilization of this stem-loop structure as a possible mechanism for repression. This region is highly similar to the functionally characterized early promoter region of lactococcal temperate phage TP901-1 (Madsen & Hammer, 1998), with just four differences noted in the helix within the stem-loop structure. Three of these differences appear as compensatory base substitutions that maintain base pairing within the stem while the fourth difference alters the size of the loop (three nucleotides in φEf11 and five nucleotides in TP901-1). Additional differences occur in the loop: an AA in φEF11 vs. a TT in TP901-1. The structure of this region is unlike bacteriophage λ, suggesting a different strategy for the control of these promoters.

image

Figure 2.  Predicted structure of a 159 bp intergenic control region between cI and cro. (a) Sequences from nucleotide positions 29 428–29 591 of φEf11, including the stop codon of cI and the start codon of cro, are depicted. (b) The corresponding region (3186–3359) in bacteriophage TP901-1 is illustrated. The −10 and −35 promoter regions are marked by open boxes, while the distance between the −10 and −35 regions is underscored. Specific nucleotide differences within the predicted stem-loop structures and within the promoter regions are boldface. The start and stop codons are boldface italics. The promoter regions in φEf11 were discovered by comparison with PR and PL of TP901-1 (Madsen & Hammer, 1998). The predicted stem-loop structures were discovered through visual observation and verified using mfold (version 3.2) by Zuker (2003) and Zuker and Turner (http://mfold.bioinfo.rpi.edu/cgi-bin/dna-form1.cgi). Free energy (ΔG) was calculated by the mfold web site using the energy rules from SantaLucia (1998).

Download figure to PowerPoint

The remaining ORF of the early gene module, PHIEF11_0038, appears to be an antirepressor, by virtue of similarity to the antirepressor protein family, specifically to the antirepressor of Streptococcus phage TP-j34 (Table 1). Antirepressors act by binding to, and inactivating repressors, thereby preventing or terminating lysogeny (Riedel et al., 1993).

(7) Genes of the excision module (PHIEF11_0039): The excision module is represented solely by PHIEF11_0039, although maximal excision of the prophage from the host chromosome is typically accomplished by the combined action of the integrase and excisionase gene products (Breuner et al., 1999; Ptashne, 2004). Phage excisionases typically are small, basic proteins. For example, the lactococcal bacteriophage TP901-1 excisionase is a 64 amino acid (7.5 kDa), pI 9.8 protein (Breuner et al., 1999). The φEf11 PHIEF11_0039 protein consists of 82 amino acids (10.1 kDa), pI 10.1 (Table 1). The TP901-1 excisionase is located at a position two ORFs downstream from the TP901-1 cro homolog (Madsen & Hammer, 1998; Breuner et al., 1999). Likewise, in φEf11, PHIEF11_0039 is located two ORFs downstream from the cro gene (PHIEF11_0039). Moreover, PHIEF11_0039 shows similarity to putative excisionases for Lactococcus prophage ps2 and an E. faecalis V583 prophage (Table 1). These findings suggest that PHIEF11_0039 encodes the φEf11 excisionase.

(8) Late genes of DNA replication and modification (PHIEF11_0044 to PHIEF11_0065): Beginning with PHIEF11_0044, the genes of the remaining module have functions related to the replication and modification of the phage DNA. The deduced PHIEF11_0044 protein contains a conserved domain of the ERF (essential recombination function) superfamily of proteins (Table 1). These are single-strand (DNA) annealing proteins (SSAPs) that are related to the ERF protein of phage P22 that mediates circularization of linear double-stranded DNA following infection of the host cell (Poteete, 1982). The gene product of PHIEF11_0044 also shows similarity to a single-stranded DNA-binding protein of a prophage of S. pyogenes MGA55005, and an SSAP of Lactococcus phage ul36.13.

PHIEF11_0045 shows similarity to a replication protein of L. johnsonii prophage Lj928 (Table 1) and is presumably involved in the replication of the φEf11 DNA. Replisome organizers, such as the DnaA protein of E. coli, function as initiators of DNA replication. They act by binding to the origin of replication (ori) and promote unwinding of the DNA. The unwound region of the DNA allows access of helicases such as DnaB/DnaC, and other proteins required for DNA polymerization, to replicate the DNA (Missich et al., 1997; Majka et al., 2001). PHIEF11_0047 contains a conserved domain of phage replisome organizer proteins from several different phages (Table 1). These include similarities in sequence to the replisome organizer domains of proteins from Listeria monocytogenes phage A118, S. aureus phage 52A, a Clostridium botulinum phage, and Streptococcus mitis phage SM10. Therefore, PHIEF11_0047 appears to be a replisome organizer protein.

Additional genes in the DNA replication/modification module include a putative methyltransferase (PHIEF11_0050), an ASCH domain protein (PHIEF11_0054), and a SbcC domain protein (PHIEF11_0061). The domains found in these gene products are all associated with DNA replication functions. In addition, the final gene of this module (PHIEF11_0065) is similar to a gene of S. pyogenes phage SM1 that is in turn similar in sequence to a gene of Streptococcus phage NZ131.3 that functions in DNA replication (e.g. DNA polymerase III β-subunit/dnaN). PHIEF11_0062 has a significant HMM match to PF02195: ParB-like nuclease domain, suggesting a possible role in DNA replication.

Location of φEf11 within the lysogenic host TUSoD11

The location of the lysogenized φEf11 genome within the lysogenic host TUSoD11 was investigated computationally by mapping the complete genome of φEf11 to the unfinished (draft) genome of E. faecalis strain TUSoD11 (GenBank accession ACOX00000000), using NUCMER (Delcher et al., 2002). Analysis of the SHOW-COORDS output of the NUCMER package indicated the integrated genome of φEf11 spread across three contigs (ACOX01000066, 44 534 bp; ACOX01000045, 647 bp; and ACOX01000055, 103 862 bp), ordered relative to the φEf11 genome beginning with the integrase gene. Examination of the ends of alignments with TUSoD11 as the reference revealed a putative 27 bp attachment site with the sequence (ACTAAGCAAGTGCCGCCATGTGTCTGA), manifested as a direct repeat. There is no evidence at this point to suggest that φEf11 targets a gene due to the unfinished nature of the TUSoD11 genome.

Genome organization

The organization of the φEf11 genome resembles that of many other temperate Siphoviridae phages. The modular arrangement of genes responsible for: packaging[RIGHTWARDS ARROW]head morphogenesis[RIGHTWARDS ARROW]tail morphogenesis[RIGHTWARDS ARROW]lysis[RIGHTWARDS ARROW]recombination[RIGHTWARDS ARROW]lytic/lysogenic control[RIGHTWARDS ARROW]excision[RIGHTWARDS ARROW] and DNA replication is seen repeatedly in numerous temperate phages of low GC bacteria. These include: S. mitis phage SM1 (Siboo et al., 2003), Streptococcus thermophilus phage Sfi21 (Lucchini et al., 1999), S. pyogenes prophages SF370.1, SF370.2, and SF370.3 (Canchaya et al., 2002), Lactobacillus lactis phage r1t (van Sinderen et al., 1996) Lactobacillus lactis ssp. cremoris phage TP901-1 (Brøndsted et al., 2001), L. johnsonii prophages Lj928 and Lj965 (Ventura et al., 2004), Lactobacillus gasseri prophage LgaI, (Ventura et al., 2006), and Lactobacillus salivarius prophages SalI and SalII (Ventura et al., 2006). In contrast, lambdoid phages of coliform bacteria show a modular genomic organization of: packaging[RIGHTWARDS ARROW]head morphogenesis[RIGHTWARDS ARROW]tail morphogenesis[RIGHTWARDS ARROW]recombination[RIGHTWARDS ARROW]lytic/lysogenic control[RIGHTWARDS ARROW]DNA replication[RIGHTWARDS ARROW]lysis (Hogness, 1966; Campbell, 1994). Thus phage φEf11 belongs to a group of phages (temperate Siphoviridae phages of low GC, Gram-positive bacteria), which is distinguishable from the group of temperate Siphoviridae phages that infect Gram-negative bacteria.

The arrangement of genes within some individual modules of the φEf11 genome is identical to that found in several other phages of low GC Gram-positive bacteria: the terminase A–terminase B–portal protein gene sequence found in the packaging module of the φEf11 genome is also found in the packaging modules of Lactobacillus plantarum phage phig1e, Lactobacillus delbrueckii phage LL-H, Listeria phage A118, L. johnsonii prophage Lj965, and S. thermophilus phage Sfi11 (Desiere et al., 2000; Fig. 3). This suggests a common ancestry of these viruses and E. faecalis phage φEF11. On the other hand, in the genome of the phages of other low GC Gram-positive bacteria (S. mitis phage SM1, Lactococcus phage r1t, and S. pyogenes prophage SF370.3) the portal protein gene precedes (i.e. is upstream from) the terminase gene(s) (Siboo et al., 2003; Fig. 3), demonstrating a difference in genome organization between these phages and phage φEf11. The arrangement of other φEf11 genes is unique to phage φEf11. The φEf11 gene encoding a scaffold protein is located at a position 4 ORFs downstream from the first head protein-encoding gene of the head morphogenesis module (Table 1, Fig. 1). In the genome of other phages of low GC, Gram-positive bacteria, the gene encoding the scaffold protein either immediately follows (downstream) the initial head protein-encoding gene (phages LL-H, A118, Lj995, Sfi11) or there is only one (phage phig1e) or two (phage SPP1) intervening gene(s) between the first head protein-encoding gene and the scaffold protein-encoding gene (Desiere et al., 2000; Fig. 3).

image

Figure 3.  Comparative organization of the packaging, head morphogenesis, and tail morphogenesis gene modules of Enterococcus faecalis phage φEf11 and 10 other phages of Gram-positive, low GC bacteria. LL-H (Lactococcus delbrueckii ssp. lactis phage) (GenBank accession EF455602, nucleotides 1229-15005), Sfi11 (Streptococcus thermophilus phage) (AF158600, 1013-14741), A118 (Listeria monocytogenes phage) (AJ242593, 21-14926), Lj965 (Lactobacillus johnsonii phage) (AY459535, 15588-31779), TP901-1 (Lactococcus lactis phage) (AF304433, 13562-25951), phig1e (Lactobacillus plantarum phage) (X98106, 30136-15416), SPP1 (Bacillus subtilis phage) (X97918, 1-15495), SM1 (Streptococcus mitis phage) (AY007505, 15988-27775), r1t (Lactococcus lactis phage) (U38906, 15054-26302), SF370.3 (Streptococcus pyogenes prophage) (prophage region in AE004092, 1211352-1199760). inline image, Terminase A; inline image, terminase B; inline image, portal; inline image, minor head protein; inline image, scaffold protein; inline image, major head protein; inline image, major tail protein; inline image, tape measure protein.

Download figure to PowerPoint

The organization of the φEf11 lysis module is unique from those of all other temperate Siphoviridae phages of low GC Gram-positive bacteria. The φEf11 lysis module includes a lysin/muramidase (PHIEF11_0026), and an amidase (PHIEF11_0028) transcribed in a rightward direction, and a LysM domain protein (PHIEF11_0030) divergently transcribed in a leftward direction. In addition, there is a holin protein (PHIEF11_0025) transcribed in a rightward direction and another (putative) membrane protein (PHIEF11_0029) divergently transcribed in a leftward direction. This complexity of lysis-related genes is not seen in the genome of other temperate Siphoviridae phages.

The arrangement of the early genes that control the switch between the lytic and the lysogenic alternative life cycle pathways in phage φEf11 is similar to that found in most temperate Siphoviridae phages: a repressor gene is divergently expressed from adjacent tandem cro and antirepressor genes. Within this module, between the repressor and the cro genes is a 159 bp noncoding sequence. It is likely that within this span is an operator/promoter site (Fig. 2), controlling the expression of the adjacent repressor and cro genes.

Finally, a virulent Myoviridae E. faecalis phage (φEF24C) has been described by Uchiyama et al. (2007). The genome of this virus has been sequenced and annotated (Uchiyama et al., 2008). The genome of this phage was found to be 142 072 bp, with a GC content of 35.7%, and predicted to encode 221 ORFs and five tRNA genes. Although this virus infects strains of the same species (E. faecalis) as phage φEf11, with one exception, there is no similarity in genome size, arrangement or sequence. The one common feature detected between the genomes of φEF24C and φEf11 is the sequence of the amidase gene (φEf11 PHIEF11_0028) of both viruses. blastp analysis reveals high sequence similarity (60.7% identity, p=1.9e−27) between these lytic enzymes of these two E. faecalis phages (Table 1). This may be due to the need for both of these phages to hydrolyze similar cell wall amide linkages in host E. faecalis cells, in order to be released following productive infection. However, it should also be noted that no such similarity was detected between the endolysin gene products (φEf11 PHIEF11_0026) of these viruses. Consequently, it must be concluded that, except for a degree of similarity in the method of achieving cell wall lysis of the host cell, these two viruses have developed alternative solutions in solving the problems of adsorbing to, replicating in, and lysing their host cell.

Comparative genomics

To investigate whether other phage or prophage genomes exist that are similar to φEf11, we searched an NCBI blast-formatted protein database for top matching phage and prophage genomes. The database consisted of 579 NCBI RefSeq complete bacteriophage genomes, 1520 phage_finder-predicted (Fouts, 2006) prophages from 1102 complete RefSeq bacterial genomes, and 1463 phage_finder-predicted prophages from 1016 draft RefSeq bacterial genomes. blastp results of the top 20 best matching (cut-offs: e-value ≤1 × 10−5, percent identity ≥35%, and subject and query alignment lengths ≥70%) genomes plus all sequenced Enterococcus phage (Uchiyama et al., 2008; Son et al., 2009; Yasmin et al., 2010) were used as input into an in-house perl script that computed a distance matrix based on the mean of the blast score ratio (BSR) (Rasko et al., 2005). This BSR-based distance method has been previously shown to generate reliable trees capable of resolving Campylobacter jejuni species from the closely related Campylobacter coli and has been used as a method to construct phage trees based on whole-genome protein sequence data (Fouts, 2006). A neighbor-joining tree was constructed from the blast data (Fig. 4a).

image

Figure 4.  Comparison of phage φEf11 genome with those of most closely matching phage and prophage genomes. (a) Proteins from the top 20 blastp matching phages and predicted prophages from complete and draft genomes were combined with proteins from all sequenced Enterococcus phages to construct a dendrogram based on a distance calculated from the mean of the BSR (Fouts, 2006). Asterisks (*) refer to those phages/prophages whose genomes were plotted as linear representations in part (b) of this figure. (b) Select node representatives were plotted in a linear illustration. φEf11 ORFs were colored by functional role categories: capsid structural components and assembly (inline image, terminase A; inline image, terminase B; inline image, portal; inline image, scaffold protein; inline image, major head protein; inline image, minor head protein), tail and baseplate assembly (inline image, tail component; inline image, tape measure), host cell lysis (inline image, endolysin/lysin; inline image, holin), DNA and RNA metabolism (inline image, integration; inline image, excision; inline image, replication; inline image, single-stranded DNA-binding protein; inline image, restriction/modification), regulatory functions (inline image, cl/cro repressor; inline image, antirepressor), inline image, conserved hypothetical protein, and inline image, hypothetical protein. Other regions were colored by protein percent identity to φEf11 proteins (see key). The phage/prophage regions were aligned to the φEf11 tape measure protein. GenBank accession numbers of the bacterial genomes and complete phage genomes as well as the GI numbers of each prophage region used in this figure are as follows: Enterococcus phage φEF24C (AP009390), Enterococcus phage φFL4A (GQ478088), Enterococcus faecalis S613 [NZ_ADDP01000047:PFPR01(gi293387879..gi293387096)], E. faecalis R712 [NZ_ADDQ01000037:PFPR01(gi293383689..gi293383717)], E. faecalisφEf11 (GQ452243), E. faecalis X98 [NZ_GG688434:PFPR02(gi257422023..gi257422110), NZ_GG688434:PFPR04(gi257422396..gi257422452)], E. faecalis E1Sol [NZ_GG692673:PFPR01(gi257080643..gi 257080698)], E. faecium 1,231,410 [NZ_GG692473:PFPR01(gi257891036..gi257891089)], E. faecium 1,231,408 [NZ_GG688552:PFPR01(gi257893866..gi257893905)], E. faecium D344SRF [NZ_ACZZ01000059:PFPR01(gi289567069..gi289567085)], L. lactis ssp. cremoris SK11 [NC_008527:PFPR14(gi116512451..gi116512497)], Lactococcus phage Tuc2009 (NC_002703), Lactococcus phage ul36 (NC_004066), E. faecalis T1 [NZ_GG670358:PFPR03(gi255972569..gi255972627)], E. faecalis T3 [NZ_GG670369:PFPR02(gi256762666..gi256762723)], Enterococcus phage φFL3B (GQ478087), Enterococcus phage φFL3A (GQ478086), Enterococcus phageφFL2A (GQ478084), Enterococcus phage φFL2B (GQ478085), Enterococcus phage φFL1B (GQ478082), Enterococcus phage φFL1A (GQ478081), Enterococcus phage φFL1C (GQ478083), E. faecalis Merz96 [NZ_GG692918:PFPR02(gi256960097..gi256960153)], E. faecalis HIP1174 [NZ_GG692651:PFPR02(gi256964490..gi256964544)], and Enterococcus phage EFAP-1 (FJ792813). E. faecalis φEf11 is in bold since it is the phage to which all others in this figure are being compared.

Download figure to PowerPoint

The top 20 blastp matches plus available enterococcal phage genomes resulted in a tree with two main branches, with Enterococcus phages EFAP-1 and φEF24C serving as the most distant outgroups (Fig. 4a). These were the only lytic phages represented in Fig. 4a, implying that the genomes of these lytic phages do not recombine with the temperate phages in this dataset. It may also suggest that EFAP-1 and φEF24C originated from a more distantly related bacterial host species than the temperate phages that have coevolved with E. faecalis or that these temperate and virulent phages have different host strain specificities and therefore do not coinfect the same strains. φEf11 was most similar to predicted prophages from E. faecalis strains S613 and R712, followed by X98 and E1Sol (Fig. 4a). This group of phages/prophages formed a larger cluster with three prophages from Enterococcus faecium. Surprisingly, this larger group was more similar to lactococcal phages than to other Enterococcus phages or prophages (Fig. 4a). This suggests that either φEf11 and related phages originated from a dairy source or that these particular lactococcal phages originated from an Enterococcus strain. In this regard, it should be noted that both enterococci and lactococcal/Lactobacillus species are found in dairy products such as cheese (Izquierdo et al., 2009; Javed et al., 2009; Martín-Platero et al., 2009), thereby providing ample opportunity for genetic interaction among the phages of these species. Furthermore, a recent report has revealed a close relationship between the virulent E. faecalis bacteriophage φEF24C and a lytic phage (Lb338-1) that infects Lactobacillus paracasei, a cheese isolate (Alemayehu et al., 2009). φEF24C and Lb338-1 have been classified previously as SPO1-like phages. Recently, it has been proposed to ICTV to generate a subfamily, Spounavirinae, containing all SPO1-related phages, subdivided into SPO1-like and Twort-like genera (Klumpp et al., 2010).

To investigate how the tree topology is related to the location and percent identity of protein matches, a linear representation of the blastp matches was constructed from a representative of each node (Fig. 4b). The region highlighted in light yellow in Fig. 4b denotes the single large cluster containing φEf11. It appears that these phages/prophages have grouped based on the similarity of the components that make up the tail and tail fibers (Fig. 4b). As these sequences become more distant, the tail fiber similarity remains, suggesting that the BSR phage trees are useful for identifying phages with similar tail fibers. Future work is needed to investigate whether these sequences recognize the same or different host receptors.

In conclusion, while the overall gene arrangement of phage φEf11 resembles that of many other phages of low GC Gram-positive bacteria, there are a number of unique features of the φEf11 genome that set it apart from those of all other characterized phages/prophages. These include the specific location of the scaffold protein gene within the packaging module, and the number and arrangement of divergently transcribed lysis-related genes. The predicted stem-loop operator controlling the switch between the transcription of either the cI repressor or cro genes that we identified in the φEf11 genome clearly distinguishes this genome from the classic tripartite operator system used by the λ-type phages. It remains to be determined whether any of the other phages of low GC Gram-positive bacteria (in addition to Lactococcus phage TP901-1) use a similar regulatory system.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgement
  7. References

This work was supported by a Grant-in-Aid from Temple University.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgement
  7. References