SEARCH

SEARCH BY CITATION

Keywords:

  • Salmonella Typhimurium;
  • SopB;
  • in vivo;
  • HEp-2

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Salmonella Typhimurium harbors two Salmonella pathogenicity islands (SPIs), each encoding a type three secretion system for virulence proteins. Although there is increasing evidence of postinvasion roles for SPI-1, it has been generally accepted that SPI-1 genes are downregulated following the invasion process. Here, we analyzed the expression and translocation of SopB in vitro, in cell culture and in vivo. To this end, a sopB-FLAG-tagged strain of Salmonella Typhimurium was obtained by epitope tagging. Tagged proteins were detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting with anti-FLAG antibodies. SopB expression was observed in vitro under cultured conditions that mimic the intestinal niche and different intracellular environments. In agreement, bacteria isolated from infected monolayers expressed and translocated SopB for at least 24 h postinoculation. For in vivo experiments, BALB/c mice were inoculated intraperitoneally with the tagged strain of Salmonella Typhimurium. Infecting bacteria and infected cells were recovered from mesenteric lymph nodes. Our results showed that SopB continues to be synthesized in vivo during 5 days after inoculation. Interestingly, translocation of SopB was detected in the cytosol of cells isolated from lymph nodes 1 day after infection. Altogether, these findings indicate that the expression and translocation of SopB during Salmonella infection is not constrained to the initial host–bacteria encounter in the intestinal environment as defined previously.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Salmonella enterica serovar Typhimurium encodes two type three secretion systems (TTSS) that mediate the delivery of bacterial effector proteins into target host cells. These virulence determinants are encoded within the pathogenicity islands 1 and 2 [Salmonella pathogenicity islands (SPI-1) and SPI-2] (Galán, 2001). Both secretion systems deliver >60 proteins into host cells at different times during infection (Galán, 2001; Waterman & Holden, 2003). In turn, these bacterial effectors interact with signaling proteins of the host modulating a variety of cellular processes, such as actin dynamics, vescicular trafficking and transcriptional responses (Galán, 2001; Waterman & Holden, 2003).

According to the current model, SPI-1 effectors act before SPI-2 ones; this is dependent on the differential regulation of SPI-1 and SPI-2 expression and the degradation or inactivation of translocated SPI-1 effectors (Galán, 2001; Knodler et al., 2002; Kubori & Galán, 2003). Nevertheless, it was demonstrated that SPI-1 effectors may control and complement postinvasion events previously attributed solely to the actions of SPI-2 effectors (Garner et al., 2002; Steele-Mortimer et al., 2002). Moreover, Bustamante et al. (2008) recently revealed the existence of a SPI-1 and SPI-2 transcriptional cross-talk mechanism. Certain effector proteins such as SopB, whose secretion is mediated by the TTSS-1, are encoded by genes located outside SPI-1 (Galyov et al., 1997; Wood et al., 2000). The sopB gene is located in the SPI-5 pathogenicity island and is well conserved in all sequenced Salmonella Typhimurium strains (Mirold et al., 2001).

SopB is involved in a diverse set of responses of the eukaryotic cell to Salmonella infection. For instance, SopB participates in the invasion of nonphagocytic cells (Raffatellu et al., 2005; Patel & Galán, 2006; Bakowski et al., 2007), early maturation of the Salmonella-containing vacuole (SCV) (Hernandez et al., 2004; Mallo et al., 2008), modulation of ion channel activity (Bertelsen et al., 2004), induction of iNOS long after invasion (Drecktrah et al., 2005) and activation of serine protein kinase Akt (Steele-Mortimer et al., 2000). Cell culture experiments indicate that SopB is translocated via the TTSS-1 during invasion and that it persists for up to 12 h (Drecktrah et al., 2005), localizing to different cellular compartments at different times during infection (Patel et al., 2009). At the early stages of infection, SopB localizes to the plasma membrane to mediate bacterial entry and Akt activation. In the late stages of infection, SopB localizes to the SCV, where it is required for bacterial replication and for inhibiting SCV–lysosome fusion (Patel et al., 2009; Bakowski et al., 2010). Moreover, experiments performed in infected polarized epithelial cell monolayers have shown that SopB is involved in the disruption of tight junction structure and function by Salmonella Typhimurium (Boyle et al., 2006). In vivo experiments demonstrated that SopB is synthesized during the final phase of the murine salmonellosis (Giacomodonato et al., 2007; Gong et al., 2010). The translocation of SopB in vivo, however, has not been characterized yet. In this study, we present data on the expression and translocation of SopB in vivo, in mesenteric lymph nodes (MLN) during murine salmonellosis.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Bacterial strains and culture conditions

Salmonella Typhimurium American Type Culture Collection (ATCC) 14028 and derived strains tagged with the 8-aa FLAG epitope tag peptide were used in this work. Strains ST813 (sopA∷3xFLAG cat∷FLAG), ST814 (sopD∷3xFLAG cat∷FLAG) and ST815 (sopB∷3xFLAG cat∷FLAG) of Salmonella Typhimurium were obtained using the method described by Uzzau et al. (2001). 3xFLAG epitope tails were added to the ends of the sopA, sopB and sopD gene. The 3xFLAG epitope is a sequence of three tandem FLAG epitopes (22 aa). A pair of primers was designed to amplify a 3xFLAG and kanR coding sequence using plasmid pSUB11 (Uzzau et al., 2001). The 3′-ends of these oligonucleotides were complementary to the first 20 nt of the pSUB11 3xFLAG coding region (GACTACAAAGACCATGACGG, forward primers) and to the 20 nt of the pSUB11 priming site 2 (CATATGAATATCCTCCTTAG, reverse primers). The 5′-ends of the oligonucleotides were designed to be homologous to the last 40 nt of each tagged gene, not including the stop codon (forward primers), and to the 40 nt immediately downstream of the gene stop codon (reverse primers).

For in vitro studies, bacteria were grown under different culture conditions. To mimic the intestinal environment (Miki et al., 2004) bacteria were grown overnight at 37 °C without aeration in a Luria–Bertani (LB) broth containing 0.3 M NaCl. An intracellular milieu was recreated by growing bacteria overnight in MgM minimal medium containing 0.1% casaminoacids at 37 °C with aeration (Miki et al., 2004) at different pH. Early and late intracellular conditions were mimicked by growing bacteria at pH 6 or 4.5, respectively. sopD∷3xFLAG cat∷FLAG strain was used as control for in vitro experiments; SopD is a dual effector because it is translocated into host cells by both TTSSs (Brumell et al., 2003).

For in vivo studies, bacterial inocula used to infect cells or animals were prepared by growing the tagged strains overnight under SPI-1 noninducing conditions (LB at 28 °C) as described previously (Giacomodonato et al., 2009). In this way, the residual expression of SopB from in vitro bacterial growth was ruled out.

Cultures were centrifuged, diluted in sterile saline and inoculated to cell cultures or mice. Viable bacteria in the inoculum were quantified by dilution and plating onto LB agar plates with appropriate antibiotics.

In vitro expression and secretion of SopB

For the isolation of cell-associated proteins, 1.5 mL of bacterial cultures were centrifuged and resuspended in 100 μL of H2O and immediately mixed with 100 μL of Laemmli buffer. For the isolation of proteins released into the culture supernatants (secreted proteins), bacteria were pelleted by centrifugation and 2 mL of supernatant was collected from each sample. Supernatants were then filtered (0.45 μm pore size), and the proteins were precipitated with 25% trichloroacetic acid and sedimented by high-speed centrifugation (14 000 g for 30 min). The pellet was washed in cold acetone and resuspended in phosphate-buffered saline (PBS) and Laemmli buffer. Four independent extractions for each sample were added together to minimize differences in protein recovery from sample to sample. The proteins (cell-associated and secreted proteins) were then boiled for 5–10 min, and an aliquot of each sample was separated by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-PAGE) (Raffatellu et al., 2005). Finally, effector proteins were immunodetected as described below.

Expression and secretion of SopB in infected eukaryotic cells

Human laryngeal epithelial (HEp-2) cells (ATCC, CCL-23) were maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. Infected monolayers (multiplicity of infection=10 : 1) were incubated for 20 min at 37 °C in 5% CO2, washed twice with PBS and then incubated in fresh tissue-culture medium containing 100 mg mL−1 of gentamicin for 30 min to remove extracellular bacteria. At 20 min and 24 h postinfection monolayers were washed twice with cold Hank's balanced salt solution (HBSS) and lysed with 1.0 mL of HBSS containing 0.1% Triton X-100 and 1 mM phenylmethylsulfonyl fluoride as described by Kubori & Galán (2003). This procedure lyses the infected cells but does not affect the integrity of the bacterial membrane (Collazo & Galán, 1997). An aliquot of this suspension was used to determine the number of intracellular bacteria by plating serial dilutions onto LB agar plates. Cell lysates were collected in chilled microfuge tubes, and centrifuged at 17 000 g for 15 min at 4 °C to separate the soluble fraction, containing bacterial proteins that have been translocated into the host cell cytosol, from the insoluble fraction, which contains the internalized bacteria. The soluble fraction was filtered through a 0.45-μm-pore size filter and subjected to 10% trichloroacetic acid precipitation and sedimented by high-speed centrifugation (14 000 g for 30 min). The pellet was washed in cold acetone and resuspended in PBS and Laemmli buffer. The insoluble fraction was washed once with cold PBS and resuspended in an appropriate volume of PBS and Laemmli buffer. The protein extracts were boiled for 5–10 min, and resolved on SDS-PAGE. Finally, effector proteins were immunodetected using mouse-monoclonal anti-FLAG M2-peroxidase (HRP) antibodies (Sigma, St Louis, MO). Some blots were reprobed with rabbit-polyclonal antibodies to actin (Sigma) as cytosolic protein marker. Detection was performed by chemiluminiscence (Luminol, Santa Cruz Biotechnology, Santa Cruz, CA).

Animal studies

Six to 8-week-old BALB/c mice were purchased from the Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina and kept in our animal house throughout the experiments. All experiments were performed in accordance with the guidelines of the University of Buenos Aires School of Medicine Animal Care and Use Committee.

Lethal dose 50 assay (LD50)

Groups of six mice were inoculated intraperitoneally with 100 μL of serial dilutions of the bacterial suspension. Survival of infected mice was recorded for a minimum of 4 weeks. LD50 was calculated as described by Reed & Muench (1938).

Expression and translocation of SopB in vivo

In vivo expression of SopB was studied daily after infection. Mice were inoculated intraperitoneally with four different lethal doses of Salmonella-tagged strains (107, 106, 104 and 102 CFU per mouse); thus a comparable number of bacteria was recovered from MLN at all time points. Animals infected with 107 CFU were euthanized at day 1 whereas those receiving 106 CFU were sacrificed at day 2. In the same way, mice receiving 104 or 102 CFU were euthanized at days 3/4 or 5 postinfection, respectively. Bacterial inocula were prepared growing tagged strains overnight in LB at 28 °C. Cultures were centrifuged, diluted in physiological saline and inoculated to mice. Viable bacteria in the inocula were quantified by dilution and plating onto LB agar plates with appropriate antibiotics.

MLN were removed daily postintraperitoneal infection and incubated for 20 min in 3 mL of HBSS containing 100 mg mL−1 of gentamicin, followed by three washes in 10 mL of HBSS without antibiotic, before single-cell suspensions were prepared using an iron mesh sieve. Then, the isolated cells were processed as described above (Expression and secretion of SopB in infected eukaryotic cells) in order to obtain a soluble and an insoluble fraction to analyze the expression and translocation, respectively.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

The expression and secretion of SopB was studied in vitro and in vivo using a FLAG-tagged strain of Salmonella Typhimurium. First, we analyzed the phenotype of the tagged strains in all models of infection used throughout the experiments. As shown in Table 1, no significant differences in virulence were found between parental and tagged strains. These results are in accord with those reported earlier (Giacomodonato et al., 2007, 2009) and confirm that epitope tagging does not impair the invasiveness, colonization capacity or virulence of Salmonella. Consequently, we used our FLAG-tagged strains of Salmonella as a tool to study the in vitro and in vivo expression and translocation of SopB.

Table 1.   Relevant characteristics of strains used in this study
StrainLD50 intraperitoneally*Persistence (intraperitoneally) (log CFU per MLN)Invasion (HEp-2 cells) (%)
Day 1Day 2Day 3Day 4Day 5
  • BALB/c mice were inoculated intraperitoneally with wild-type (untagged) Salmonella Typhimurium ATCC 14028, sopA-tagged, sopB-tagged and sopD-tagged strains of Salmonella Typhimurium as described in Materials and methods.

  • *

    LD50 was calculated as described by Reed & Muench (1938). No significant differences were observed between the LD50s of the strains studied.

  • Bacterial persistence in the MLN from days 1 to 5 after intraperitoneal inoculation of four different lethal doses. Animals infected with 107 CFU were euthanized at day 1 whereas those receiving 106 CFU were sacrificed at day 2. In the same way, mice receiving 104 or 102 CFU were euthanized at days 3–4 or 5 postinfection, respectively. Data are presented as mean ± standard error for 10 animals. No significant differences in the number of infecting bacteria were observed among the Salmonella strains inoculated to mice.

  • Percentage of bacteria that invaded HEp-2 epithelial cells during 20 min and survived a gentamicin protection assay. Plating was done 2 h after infection. Values were normalized to invasion rate of untagged strain of Salmonella Typhimurium ATCC 14028.

  • ND, not determined.

Wild type<107.10 ± 0.307.24 ± 0.257.59 ± 0.707.14 ± 0.326.89 ± 0.37100
sopA-tagged<106.95 ± 0.417.00 ± 0.127.41 ± 0.367.85 ± 0.657.01 ± 0.46103
sopB-tagged<107.36 ± 0.557.20 ± 0.516.80 ± 0.456.97 ± 0.856.90 ± 0.2596
sopD-tagged<10NDNDNDNDNDND

To investigate the capacity of the Salmonella-tagged strains to synthesize and secrete SopB, bacteria were grown under different conditions resembling early and late stages of Salmonella infection (as described in Materials and methods). Under conditions that mimic the intestinal environment Salmonella synthesized SopB (Fig. 1b, lane 1). Interestingly, this effector protein was also found associated with bacteria cultured under conditions that resemble the early and late intracellular environment (Fig. 1b, lanes 2 and 3), whereas SopA expression was evident only under conditions that mimic the intestinal milieu (Fig. 1a, lane 1). On the other hand, although SopB expression was evident under all conditions tested, its secretion was observed only into media that mimic the intestinal environment (Fig. 1e, lane 1). As expected for a dual effector translocated by both TTSSs, SopD was synthesized and secreted at similar levels under all conditions analyzed (Fig. 1c, lanes 1–3 and Fig. 1f, lanes 1–3). Taken together these results suggest that SopB can be synthesized not only by Salmonella located in the intestinal environment but also by intracellular bacteria.

image

Figure 1.  Analysis of SopB expression and secretion in vitro by Western blot. FLAG-tagged strains of Salmonella Typhimurium SopA (a, d), SopB (b, e) and SopD (c, f) were grown under different culture conditions that mimic the intestinal niche (lane 1), and that resemble early (lane 2) and late (lane 3) intracellular environments. Expression (a–c) and secretion (d–f) were investigated in bacterial pellets and supernatants, respectively. Samples were subjected to SDS-PAGE and tagged proteins were detected by anti-FLAG antibodies. SopD was used as control because – as a dual effector – it is translocated into host cells by both TTSS. Each lane was loaded with material from approximately 106 CFU. Molecular weight markers in kDa are indicated on the right of each panel.

Download figure to PowerPoint

Synthesis and secretion of SopB by intracellular bacteria

To investigate to what extent SopB is induced intracellularly, confluent HEp-2 cells were infected with Salmonella-tagged strains. Twenty minutes and 24 h postinfection cells were mechanically disrupted and centrifuged at low speed to separate cell lysates into soluble fraction (containing host cell cytoplasm and membranes) and insoluble fraction (containing intact bacteria, host cell nuclei, unbroken host cells and host cells cytoskeleton). Insoluble fraction analysis revealed that SopB is expressed not only soon after infection (20 min) but also within host cells at 24 h postinfection (Fig. 2a). SopA was also expressed at 20 min and 24 h although at a lower level (Fig. 2a). Immunoblotting analysis of the soluble fraction showed that SopB is translocated upon initial contact (20 min) with host cells and also by intracellular bacteria for at least 24 h (Fig. 2b). In other words, SopB expression and translocation are not suppressed upon internalization. On the other hand, SopA was translocated only 20 min postinfection (Fig. 2b). It is important to note that the cytosolic bacterial protein Cat was not detected in the soluble fraction, indicating that bacterial integrity was conserved during these experiments.

image

Figure 2.  Analysis of SopB expression (a) and translocation (b) in HEp-2 cells by Western blot. Epithelial cells were infected with sopA-tagged or sopB-tagged strains of Salmonella Typhimurium for 20 min or 24 h. Postinfection cells were processed as indicated in Materials and methods to obtain an insoluble fraction (intact bacteria) and a soluble fraction (host cell cytoplasm and membranes). Both fractions were analyzed by immunoblotting using anti-FLAG antibodies. C, control uninfected cell cultures; ST814, positive control for SopA expression; ST815, positive control for SopB expression. As a control for the host cell cytosolic fraction some blots were reprobed with polyclonal antibodies to actin. Each lane was loaded with material from approximately 106 CFU. Molecular weight markers in kDa are indicated on the right of each panel.

Download figure to PowerPoint

These findings demonstrate the efficient expression and translocation of SopB by intracellular Salmonella during early and late stages of infection. The persistence of SopB may explain how this SPI-1 effector can modulate cellular events, like iNOS expression, that take place at late stages of infection (Drecktrah et al., 2005). Moreover, it has been suggested that SopB participates in the creation of a spacious phagosome for Salmonella to reside (Patel & Galán, 2005). In agreement, experiments performed in Salmonella-infected Henle cells showed that SopB localizes to diverse cellular compartments at different times during infection (Patel et al., 2009). Upon infection, SopB is delivered to the cytoplasmic surface of the plasma membrane where it participates in plasma membrane ruffling and signaling events. After bacterial entry, SopB localized to the SCV, where it is required for bacterial replication (Patel et al., 2009).

In vivo synthesis and translocation of SopB

We determined the length of time that this effector is synthesized in infecting bacteria and is translocated into the cytosol of infected cells. SopB expression and translocation was investigated daily in bacteria and cells recovered from MLN of mice-inoculated intraperitoneally. Animals received different infectious inocula in order to yield a sufficient number of infecting bacteria (recovered to investigate SopB expression), and also to provide an adequate amount of infected cells (isolated to determine SopB translocation). As shown in Fig. 3a, SopB revealed maximum expression on day 1 following intraperitoneal inoculation. From days 2 to 5 postinfection the expression of SopB was maintained at comparable levels (Fig. 3a). On the other hand, SopA was expressed at day 1 after infection (Fig. 3a); it was not detected at later time points. SopB, on the other hand, was induced at all stages of Salmonella infection. Altogether, our results clearly show that SopA and SopB are differentially expressed in vivo by infecting Salmonella. SopA is expressed mainly at the early stages of infection.

image

Figure 3.  Analysis of SopB expression and translocation in MLN by Western blot. Groups of mice were inoculated intraperitoneally with four different lethal doses 107, 106, 104 or 102 CFU of the tagged strains and euthanized at days 1, 2, 3–4 or 5 postinfection, respectively. MLN were removed and processed as indicated in Materials and methods to obtain an insoluble fraction containing intact bacteria and a soluble fraction containing translocated effectors. Both fractions were analyzed by immunoblotting using anti-FLAG antibodies. (a) SopB expression. Lanes 1 and 2, samples from mice inoculated with sopA-tagged or sopB-tagged strain of Salmonella Typhimurium and euthanized at day 1 postintraperitoneal infection; lanes 3–6, samples from mice inoculated with sopB-tagged strain of Salmonella Typhimurium and euthanized at days 1-5 postintraperitoneal infection, respectively; C, sample from control uninfected mice. (b) Translocation at day 1 postinfection. Lanes 1, 5 and 7, positive controls for SopB, SopD and SopA expression, respectively; lanes 2, 4 and 6, samples from mice inoculated intraperitoneally with sopB-tagged, sopD-tagged and sopA-tagged strains of Salmonella Typhimurium, respectively; lane 3, sample from control uninfected mice. Each lane was loaded with material from approximately 106 CFU. As a control for the host cell cytosolic fraction some blots were reprobed with polyclonal antibodies to actin. Molecular weight markers in kDa are indicated on the right of each panel.

Download figure to PowerPoint

These results are consistent with data reported earlier (Drecktrah et al., 2005; Giacomodonato et al., 2007; Patel et al., 2009) and indicate that the expression of SopB can be induced and maintained in vivo under environmental conditions different to those found in the intestinal milieu. In agreement, our in vitro experiments showed that SopB can be expressed and secreted in growth conditions that resemble early and late intracellular niches (Fig. 1). Concurrently, we investigated the in vivo translocation of SopB in the cytosol of infected cells isolated from MLN during murine Salmonella infection. Gentamicin experiments revealed that 80% of bacteria recovered from MLN were intracellular. This result was confirmed by electron microscopy (data not shown).

As shown in Fig. 3b (lane 2), translocation of SopB in infected cells recovered from MLN was evident for at least 24 h after animal infection coincident with the peak of expression (Fig. 3a). At later time points we were not able to detect SopB in the cytosol of infected cells. On the other hand, although SopA is expressed at day 1 (Fig. 3a, lane 1), it could not be detected in the eukaryotic cytosol of infected cells (Fig. 3b, lane 6).

Again, we observed that the dual effector SopD is translocated during the first 24 h after inoculation (Fig. 3b, lane 4).

To the best of our knowledge, this is the first time that the translocation of Salmonella SPI-1 effector proteins has been assessed in vivo. Altogether, our results are consistent with those reported earlier showing that sopB continues to be transcribed and translated in vitro for many hours after bacterial internalization (Knodler et al., 2009). Our work acknowledges the significance of analyzing protein expression and translocation, in vivo, in the context of bacteria–host interactions. For instance, attenuated Salmonella carrier vaccines have the potential to be used as delivery systems for foreign antigens from pathogens of viral, bacterial and parasitic origin (Everest et al., 1995). In this regard, Panthel et al. (2005) proposed SPI-1 and SPI-2 type III effector proteins as carrier molecules for heterologous antigens. Taking into account our results, SopB appears as an attractive carrier, potentially able to translocate heterologous antigens at different time points of the Salmonella infection cycle. Moreover, Nagarajan et al. (2009) have recently highlighted the importance of understanding the time and the compartment in which expression of SPI-1 and SPI-2 proteins occurs in selecting vaccine candidates; the authors proposed Salmonella Typhimurium sopB as a potential DNA vaccine.

Further investigation on kinetics, lifespan and function of Salmonella effectors in vivo would provide additional information regarding the function of these proteins in Salmonella pathogenesis and would confirm the complementary behavior of SPI-1 and SPI-2 effector functions.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

We are very grateful to Ms. María Isabel Bernal for her excellent technical assistance. This work was supported in part by grants from Agencia Nacional de Promoción a la Ciencia y Tecnología (PICT 2006-00407) and from Universidad de Buenos Aires (UBACyT 2002 00903 0028 y M009), Argentina.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References