SEARCH

SEARCH BY CITATION

Keywords:

  • Salmonella;
  • holin;
  • inner membrane

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We characterized STY1365, a small ORF of Salmonella enterica serovar Typhi. This 174-bp ORF encodes a putative product of 57 amino acid residues with a premature stop codon. Nevertheless, bioinformatic analyses revealed that the predicted product of STY1365 has similarity to putative holin genes of Escherichia coli and bacteriophage ΦP27. STY1365 showed a high-level expression at the early log phase and a small corresponding protein product was detected mainly in the inner membrane fraction. Cloning of STY1365 in pSU19 mid-copy-vector produced retardation in S. Typhi growth, increased cell permeability to crystal violet and altered the inner membrane protein profile. Similar results were obtained when STY1365 was induced with isopropyl-β-d-thio-galactoside in pCC1 single-copy vector. Our results support the fact that S. Typhi STY1365 encodes a holin remnant protein that is involved in the stability of the bacterial envelope.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Salmonella enterica serovars include a wide group of Gram-negative facultative microorganisms that infect a broad range of hosts, causing a variety of diseases from self-limiting gastroenteritis to severe systemic infection. Salmonella enterica serovar Typhi (S. Typhi) is a highly adapted, human-specific pathogen that causes an enteric fever known as typhoid fever, a systemic disease often characterized by high fever, malaise and abdominal pain (Parry et al., 2002).

The evolution of a host-restricted pathogen such as S. Typhi might have occurred by acquisition of genetic material (plasmids, phages and genomic islands), pseudogenization and/or genome degradation (Andersson & Andersson, 1999; Moran & Plague, 2004; Trombert et al., 2010). In fact, S. Typhi, compared with Salmonella Typhimurium, has a higher number of pseudogenes and has acquired new virulence traits (Sabbagh et al., 2010). The latter is exemplified by a genomic island recently characterized by our laboratory, GICT18/1. This island is inserted within sap operon and causes loss of resistance to protamine in S. Typhi (Rodas et al., 2010). GICT18/1 encodes nine ORFs, of which some have been annotated as phage gene remnants and others as hypothetical proteins (Parkhill et al., 2001; Rodas et al., 2010). However, Faucher et al. (2006) demonstrated that some of these ORFs are transcriptionally down-/upregulated within THP-1 human macrophages, which suggests that these ORFs are indeed expressed. One of these ORFs, STY1365, has been described as a 174-bp phage pseudogene with a premature stop codon that has similarity to holins (Parkhill et al., 2001; Rodas et al., 2010). Holins are small integral membrane proteins involved in the precise temporal control of cell lysis related to the release of new viral particles. These phage proteins assemble stable, nonspecific pores in the bacterial envelope, allowing phage-encoded lysins (endolysins) to access their substrate (peptidoglycan) (Young & Bläsi, 1995; Wang et al., 2000). Several holin-like proteins are encoded in bacterial genomes including Gram-positive such as Staphylococcus aureus and Bacillus spp. (Loessner et al., 1999; Real et al., 2005; Anthony et al., 2010), which display a regulatory role in the activity of murein hydrolases, autolysis and spore morphogenesis (Rice & Bayles, 2003). In the Gram-negative bacteria Borrelia burgdorferi, BlyA exhibits a holin-like function promoting the endolysin-dependent lysis and enhancing haemolytic phenotype in animal erythrocytes (Guina & Oliver, 1997; Damman et al., 2000). In addition, Escherichia coli and Salmonella spp. genomes contain holin-like genes, but little is known about their function. In this work, we performed a combination of bioinformatic, genetic and biochemical experiments in order to characterize the STY1365 small ORF of S. Typhi.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains, growth media and culture conditions

Bacterial strains and plasmids used in this study are listed in Table 1. Cells were routinely grown in 2 mL Luria–Bertani (LB) broth at 37 °C with shaking. When required, media were supplemented with ampicillin (100 μg mL−1), chloramphenicol (20 μg mL−1), kanamycin (50 μg mL−1) and l-arabinose (2 μg μL−1). Solid media were prepared by addition of 1.5 g w/v agar.

Table 1.   Bacterial strains and plasmids used
 Relevant characteristicsSource or reference
Bacterial strain
 Salmonella enterica serovar Typhi
  STH2370Clinical strain,Vi+Hospital Lucio Córdova, Santiago, Chile
  RP23ΔSTY1365∷FRTThis work
  RP28ΔSTY1365∷FRT/pSU19This study
  RP32ΔSTY1365∷FRT/pRP005This study
  RP67ΔSTY1365∷FRT/pCC1This study
  RP68ΔSTY1365∷FRT/pRP010This study
  RP48ΔSTY1365∷FRT∷pCE36[Φ (STY1365′–lacZY′)]This study
  RP56ΔSTY1365∷FRT∷pCE37[Φ (STY1365′–lacZY′)]This study
  RP71STY1365∷3XFLAG∷FRTThis study
 Escherichia coli
  DH5αCloning host for blue/white screeningInvitrogen
  EPI300Electrocompetent E. coli strain for cloning by blue/white screeningEpicentre
Plasmids
 pKD4Cassette flanked by FRT sites, KanRDatsenko & Wanner (2000)
 pKD46Red recombinase expression, AmpRDatsenko & Wanner (2000)
 pCP20FLP recombinase expression, AmpRDatsenko & Wanner (2000)
 pCE36FRT lacZY+ this oriRK6, KanREllermeier et al. (2002)
 pCE37FRT lacZY+this oriRK6 (opposite orientation), KanR,Ellermeier et al. (2002)
 pSUB113XFLAG template plasmid, KanR,Uzzau et al. (2001)
 pSU19Mid-copy number cloning vector, CamRBartolome et al. (1991)
 pCC1Copy-control cloning vector, T7 promoter, CamREpicentre
 pRP005pSU19+402-bp PCR product (STY1365 gene+putative promoter), CamRThis study
 pRP010pCC1+174 bp-PCR product (STY1365 gene), CamRThis study

Bioinformatics analyses

The nucleotide sequence from S. Typhi CT18 genome (AL513382) was accessed via the National Center for Biotechnology Information (NCBI) Genome database (http://www.ncbi.nlm.nih.gov/sites/entrez?Db=genome) and was used to compare STY1365 and both flanking regions with S. Typhimurium DT104 prophage-like element (AB104436, Saitoh et al., 2005). The STY1365 coding sequence of S. Typhi STH2370 strain was sequenced previously and it was shown to be identical to the corresponding genomic region of S. Typhi CT18 (Rodas et al., 2010). Transmembrane domains of STY1365 were analyzed using tmhmm server v2.0 program (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Analysis of STY1365 predicted amino acid sequence (NC_003198.1) was performed using psi-blast program (http://www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence alignments of STY1365 amino acid sequences and EcolTa2 holin of E. coli TA271 (ZP_07522128.1), ESCE_1669 holin of E. coli SE11 (YP_002292944.1), ECDG_01257 holin of E. coli B185 (ZP_06657343.1) and holin 1 of phage ΦP27 (NP_543080.1) were constructed using vector nt suite v.8 software (Invitrogen).

Construction of mutant strains

For the chromosomal deletion of STY1365, the ‘one step inactivation’ method described by Datsenko & Wanner (2000) was used. Following mutagenesis, the aph resistance cassette was removed by FLP-mediated recombination. The FRT site generated by excision of antibiotic resistance cassette was used to integrate plasmid pCE36, generating a transcriptional lacZY fusion (Ellermeier et al., 2002). The 3xFLAG epitope tag was fused to the 3′end of STY1365 and was carried out as described previously (Uzzau et al., 2001). Template plasmids and oligonucleotides used for genetic constructions are listed in Tables 1 and 2, respectively.

Table 2.   Oligonucleotides used in this study
NameSequence*
  • *

    Complementary sequences in deletion and fusion primers are in capital letters. Introduced restriction sites are underlined.

Deletion primers
 H1+P1 STY13655′CGCTCTAAAGAACAGGCTTAATCTTGTTGGTGAGACGATTtgtaggctggagctgcttcg3′
 H2+P2 STY13655′GTTCTAATCTTAAGAGGCACTCCATCAAACAAACCACCCAcatatgaatatcctcctttag3′
Primers for checking deletions
 ExtWan 1365-F5′AGAACAGGCTTAATCTTGTT3′
 ExtWan 1365-R5′CACTCCATCAAACAAACCAC3′
Cloning primers
 C65-F-PstI (pSU19)5′AAACTGCAGTGTTGCTGGGTATTAAACGCTCTAAAGAACA3′
 C6265-R-EcoRI (pSU19)5′ACGAATTCGTCCTGACTAAAAGGAACAGGCTTCACGGGCT3′
 C65-F (pCC1)5′AAATGTTGCTGGGTATTAAACGCTCTAAAGAACA3′
 C6265-R (pCC1)5′ACGTCCTGACTAAAAGGAACAGGCTTCACGGGCT3′
Cloning confirmation and sequencing primers
 pSU19-Fw5′CCAGTCACGACGTTGTAAAA3′
 pSU19-Rv5′ATGACCATGATTACGCCAAGCT3′
 FP (pCC1)5′GGATGTGCTGCAAGGCGATTAAGTTGG3′
 RP (pCC1)5′CTCGTATGTTGTGTGGAATTGTGAGC3′
Primers for lacZY fusion
 B-H1′+P2 W65BD5′AATCGTCTCACCAACAAGATTAAGCCTGTTCTTTAGAGCGcatatgaatatcctccttag3′
 B-H2′+P1 W65R5′TGGGTGGTTTGTTTGATGGAGTGCCTCTTAAGATTAGAACtgtaggctggagctgcttcg3′
Primers for 3xFLAG fusion
 65FlagFw5′GCCGCAGATACTGTCACCCCAAAGCACTCCTTCAAGCTTCgactacaaagaccatgacgg3′
 65FlagRv5′GACTAAAAGGAACAGGCTTCACGGGCTGGATTTATCCAACcatatgaatatcctccttag3′

Cloning of STY1365 ORF

The sequence of STY1365 was amplified by PCR and the product was purified using the Nucleotide Removal Kit (Qiagen). The purified DNA was digested by PstI/EcoRI (Invitrogen) and cloned in the PstI/EcoRI-digested mid-copy-number vector pSU19 (Bartolome et al., 1991) to yield pRP005 plasmid. To generate pRP010, a PCR product of STY1365 was directly cloned in the pCC1 vector according to the manufacturer's instructions (CopyControl PCR Cloning Kit, Epicentre). The plasmids were confirmed by PCR, restriction endonuclease assays and sequencing (Macrogen Corp., Rockville, MD). Finally, these plasmids were introduced into the corresponding mutant strain by electroporation. Primers for cloning as well as sequencing are described in Table 2.

Determination of β-galactosidase activity

Salmonella Typhi strains carrying lacZY fusions were grown routinely in LB broth and OD600 nm was monitored. β-Galactosidase activity was measured as described previously (Bucarey et al., 2005). β-Galactosidase activity was calculated as follows: 103× (A420 nm−1.75 × A550 nm) mL−1 min−1/A600 nm, and expressed in Miller Units where A is the absorbance units. Each assay was made in duplicate and repeated at least three times.

RNA isolation and reverse transcriptase (RT)-PCR

Isolation of total RNA was performed as described previously (Rodas et al., 2010). RT-PCR amplification was performed with 5 μg of DNAse I-treated RNA using Superscript II RT (Invitrogen). Amplification included 35 cycles (94 °C for 30 s, 58 °C for 45 s and 72 °C for 90 s) followed by a 5-min extension at 72 °C to ensure full extension of amplified fragments. Primers used to amplify STY1365 are described in Table 2. Reverse transcription of 16S rRNA was used as a positive control (Bucarey et al., 2005). DNAse-treated RNA that had not been transcribed was used as negative control. Thirty-microliter aliquots were resolved in 1.5% agarose gels, stained with ethidium bromide and visualized under UV source.

Detection of STY1365 product

The STY1365-3xFLAG fusion protein was detected by Western blotting using an anti-FLAG M2 monoclonal antibody (Sigma). Overnight cultures of S. Typhi strain carrying the FLAG epitope was subcultured in 25 mL of LB broth and grown to an OD600 nm of 0.2 at 37 °C with shaking. Cells were collected by centrifugation, and subcellular fractionation of inner- and outer-membrane proteins was performed (Santiviago et al., 2001; Bucarey et al., 2006). Cytoplasmic fraction was obtained according to the protocol described by Ludwig et al. (1995). Protein fractions were concentrated by precipitation with ice-cold trichloroacetic acid (final concentration 10%) and washed with acetone. Proteins were quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific). Twenty micrograms of proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS)-PAGE using 16% Tris-Tricine gels (Schägger, 2006). Resolved proteins were transferred to polyvinylidene difluoride membranes (Thermo Scientific), and detected with mouse anti-FLAG Ab M2 (1 : 5000) and alkaline phosphatase-conjugated goat anti-mouse IgG (1 : 10 000) as described previously (Uzzau et al., 2001).

Bacterial growth assays

Salmonella Typhi strains were grown overnight in LB broth at 37 °C with shaking. Aliquots of these cultures were subcultured in LB broth and supplemented with chloramphenicol when required. To induce STY1365 expression, isopropyl-β-d-thio-galactoside (IPTG, Sigma) was added at a final concentration of 1 mM. Cultures were incubated with shaking at 37 °C and growth was measured at OD600 nm.

SDS-PAGE of outer-membrane proteins

Salmonella Typhi strains were grown overnight in LB broth at 37 °C with shaking. Subcultures of strains were grown in LB broth and supplemented with chloramphenicol and IPTG when required. At an OD600 nm of 0.2, bacteria were harvested by centrifugation, and extraction of outer-membrane proteins was performed as described above. Proteins were quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific). Twenty micrograms of proteins were resolved by SDS-PAGE (12.5%) as described by Lobos & Mora (1991). The intensity of bands was analyzed using imagemeter software (Adobe)

Crystal violet assays

Exposure of bacteria to crystal violet (1.5 μg mL−1) was performed by the method described previously (Onufryk et al., 2005). The efficiencies of plating were calculated by dividing the number of CFUs of a given strain on supplemented LB plates by the number of CFUs of the same strain on LB plates. Assays for each strain were performed in duplicate and repeated three times with three independent isolates.

Statistics

All results are expressed as the means±SD of an individual experiment performed in triplicate. P-values were calculated according to Student's t-test, and a value of P<0.05 was considered to be statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bioinformatics analyses of STY1365

According to S. Typhi CT18 genome, STY1365 corresponds to a sequence interrupted by a premature stop codon (TGA). This observation was correlated to the data obtained by the STY1365 sequencing in S. Typhi STH2370 (Rodas et al., 2010). To find sequences with identity to STY1365 and flanking regions a blast algorithm was used. We found two sequences both with identity to a prophage-like element of S. Typhimurium DT104 (Saitoh et al., 2005; Fig. 1a). One sequence corresponds to artA and the other sequence to artB. Although no putative ORFs were annotated downstream of artB, our analysis showed that this region has 89% of identity to STY1365, suggesting that this is probably a prophage-like element (Fig. 1a). No dual-start motif was found in the predicted amino acid sequence of STY1365, but our blast searches revealed that the closest homologues of STY1365 amino acid sequence (57 residues) are all putative holins of different E. coli strains and the phage ΦP27. STY1365 showed 76% identity (e=6e−12) to EcolTa2 holin of E. coli TA271, 78% identity (e=4e–11) to ECDG_01257 holin of E. coli B185, 67% identity (e=9e−11) to holin 1 of phage ΦP27 and 66% identity (e=2e–10) to ESCE_1669 holin of E. coli SE11 (Fig. 1c). Analysis of STY1365 predicted product using the tmhmm server showed a single α-helical transmembrane domain (TM) from residues 28 to 47, suggesting a membrane location in accordance to a major feature of holins (Fig. 1b).

image

Figure 1.  Bioinformatic analyses of STY1365 gene. (a) Genomic context of STY1365 in the Salmonella Typhi genome compared with a prophage-like element of the Salmonella Typhimurium DT104 chromosome. Percentages of nucleotide identity are indicated. Illustration of STY1365 on top shows the length (bp) of this ORF and a premature stop codon (TGA). (b) Bioinformatic analysis of transmembrane domains from STY1365 deduced amino acid sequence. Transmembrane sequence is showed in red. (c) Multiple sequence alignment of STY1365 deduced amino acid sequence with putative holins of Escherichia coli and phage ΦP27. Identical and similar amino acid residues are marked light and dark grey, respectively. The sequences were aligned and compared using vector nti suite 8.0 (see Material and methods).

Download figure to PowerPoint

STY1365 expression along bacterial growth

Promoter activity of STY1365 was evaluated by construction of a targeted transcriptional fusion with the lac operon. β-Galactosidase assays showed that it was optimal at the early log phase (OD600 nm of 0.2), whereas no activity was detected at the stationary phase (RP48 strain, Fig. 2a). These results were supported by RT-PCR from total RNA samples obtained at an OD600 nm of 0.2, showing a transcript corresponding to an mRNA of STY1365 (Fig. 2b). Detection of a STY1365 protein product was successfully achieved by Western blotting using a targeted translational fusion of FLAG epitope. A detectable band of ∼17 kDa was mainly obtained from the inner-membrane fraction of S. Typhi grown at an OD600 nm of 0.2, which is consistent with the predicted molecular weight of STY1365 product based on in silico analysis and the size of FLAG tag (Fig. 2c). The latter result supports that STY1365 ORF is indeed a gene encoding a peptide.

image

Figure 2.  Expression of STY1365. (a) β-Galactosidase activity was measured during growth of strain RP48 (Φ[STY1365′-lacZY]). Control strain (RP56) consists of a transcriptional fusion of the reporter genes lacZY in a direction opposite to the putative promotor of STY1365. Values are presented as means±SD of three independent experiments. (b) Detection of STY1365 by RT-PCR. Total RNA was extracted from bacteria cultured in LB broth and grown to OD600 nm of 0.2. Transcription control was performed by detection of 16S rRNA gene. (c) Detection of STY1365-3XFLAG protein in Salmonella Typhi. Protein samples were extracted from different subcellular fractions of cultures grown to OD600 nm of 0.2 as described in Materials and methods. The epitope fusion protein was resolved by SDS-PAGE in Tris-Tricine gel (16%) following Western blotting with anti-FLAG antibody. TF, total protein fraction; CF, cytoplasmatic fraction; IMF, inner-membrane fraction; OMF, outer-membrane fraction.

Download figure to PowerPoint

Effect of expression of STY1365 in S. Typhi growth

Previous studies have shown that the expression of holin-like genes in E. coli causes growth impairment (Loessner et al., 1999). We evaluated whether STY1365 affects S. Typhi growth. Figure 3 shows that the wild type and the deleted mutant of STY1365 (RP23, white squares) exhibited the same growth curve. However, the complemented mutant ΔSTY1365 strain (RP23/pRP005, black squares), harboring a mid-copy number vector, showed a significant retardation exhibiting an extended lag phase. To ensure that this phenomenon was not caused by the copy number of the vector (pRP005), the mutant strain was complemented with a single-copy-number vector (RP23/pRP010, black triangles) showing a behaviour similar to the wild type and the ΔSTY1365 strain. Nevertheless, when STY1365 cloned in pRP10 was induced by IPTG, the growth curve was similar to RP23/pRP005 (white circles). These results suggest a detrimental effect dependent on STY1365 in the early log phase. No significant differences were observed in strains carrying empty vectors and pCC1 vector induced by IPTG (data not shown).

image

Figure 3.  Effect of STY1365 gene overexpression in the Salmonella Typhi growth. Growth curve of strains STH2370 (wild type), RP23 (ΔSTY1365), RP23/pRP005, RP23/pRP010 and RP23/pRP010+1 mM IPTG. Bacterial cultures were grown in LB broth and monitored by absorbance at OD600 nm at the times indicated. Values represent the mean of three independent experiments±SD.

Download figure to PowerPoint

To demonstrate that growth impairment triggered by overexpression of STY1365 is due to alteration in bacterial permeability, S. Typhi strains were treated with crystal violet, a hydrophobic dye that easily enters when the membrane is disrupted (Vaara & Vaara, 1981; Onufryk et al., 2005). In this assay we observed an increased uptake of crystal violet when STY1365 gene product is overexpressed from pRP005 or from pRP0010 induced with IPTG (Fig. 4a). Analyses of the outer-membrane protein profile by SDS-PAGE also showed a modified protein profile in the complemented strain (RP23/pRP005), showing decreased band intensities of the three major outer membrane porins (OmpC, OmpF and OmpA) compared with the wild-type strain, as revealed by densitometric analysis (Fig. 4b, lane 4). Overexpression of STY1365 induced by IPTG from pRP010 showed a slight difference in band intensity of OmpF and OmpC compared with the wild-type strain (lane 5). No significant difference was observed with ΔSTY1365 strain when tested for the crystal violet uptake and outer membrane protein profile. Moreover, strains carrying the empty vector pSU19 or the vector pCC1 induced or not by IPTG showed no differences in uptake of crystal violet (data not shown).

image

Figure 4.  Effect of overexpression of STY1365 gene in the envelope of Salmonella Typhi. (a) Crystal violet was used to evaluate bacterial membrane permeability. Briefly, bacteria were grown overnight in LB broth at 30°C. One hundred microliters of 10-fold dilutions were spread on LB agar and LB agar plates supplemented with 1.5 μg mL−1 crystal violet and were incubated overnight at 30°C. Numbers under each strain name correspond to the efficiencies of plating calculated as described in Materials and methods. Values represent the mean of three independent experiments performed in duplicate. (b) Outer-membrane proteins profile of Salmonella Typhi strains. Samples were obtained from cultures grown to an OD600 nm of 0.2 and resolved by SDS-PAGE (12.5%). Lane 1, Spectra multicolor broad range protein ladder (Promega); lane 2, S. Typhi STH2370; lane 3, RP23 (ΔSTY1365); lane 4, RP23/pRP005; lane 5, RP23/pRP010+1 mM IPTG; lane 6, RP23/pRP010. Densitometric analysis of scanned protein bands corresponding to OmpA, OmpC and OmpF porins of S. Typhi strains have been included in the annexed table. All measurements are relative to porins of S. Typhi wild-type strain (STH2370), which were used as standards and normalized as 1.0.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Holins have been described extensively in bacteriophages, >50 unrelated protein families having been reported (Young, 2002). Because of the enormous diversity, location and characterization of holin-like protein-coding genes in bacterial genomes has been difficult (Damman et al., 2000; Wang et al., 2000; Real et al., 2005; Anthony et al., 2010). Nevertheless we found some features of holin in STY1365 of S. Typhi by structural analysis of its sequence. Although it was not found a typical dual-start motif in the predicted amino acid sequence of STY1365, this result is not unusual because many holins lack this motif (Bläsi & Young, 1996; Farkasovska et al., 2004). Our experimental evidence reported in this work does not allow us to establish a full-holin activity to this small ORF of S. Typhi. Bacterial holins have been associated with an endolysin gene located adjacent to the holin gene, which is not the case for STY1365 because both flanking ORFs are annotated as proteins without such endolysin function (Damman et al., 2000; Parkhill et al., 2001; Rice & Bayles, 2003; Delisle et al., 2006; Rodas et al., 2010). Moreover, overexpression of STY1365 showed growth impairment and alteration of the bacterial envelope, but cell lysis was not observed as expected with overexpression of other holin genes (Loessner et al., 1999; Anthony et al., 2010; Rajesh et al., 2011). These evidences suggest that the protein encoded by STY1365 of S. Typhi has lost some but not all features associated with holins.

Sequence analysis of STY1365 showed the presence of a premature stop codon (TGA) within its single TM domain, suggesting the disruption of this segment, and consequently this protein will not be inserted within the bacterial membrane. The frequency of use of TGA as a premature stop codon in bacterial genomes increases with the increase in GC content, a classical feature of genomic regions acquired by horizontal transfer (Wong et al., 2008). This is in accordance with the genomic location of STY1365, which is part of a genomic island (GICT18/1) with high GC content compared with whole genome of S. Typhi (Rodas et al., 2010). In addition, we detected the presence of a protein in the inner membrane of S. Typhi (∼17 kDa) consistent with the molecular weight of STY1365 protein product plus FLAG tag, suggesting that STY1365 is fully translated. It has been reported that some phage genes containing TGA premature stop codon can be hopped by ribosomes, allowing protein synthesis (Goldman et al., 2000; Wong et al., 2008; Vakhrusheva et al., 2011).

Typically, holins have at least one α-helical TM domain that drives location into the inner membrane of Gram-negative bacteria and a highly charged hydrophilic C-terminal domain (Wang et al., 2000). Our bioinformatics analysis showed that STY1365 contains a single TM domain but the C-term is shorter compared with related putative holins of E. coli and phage ΦP27. The C-terminal sequence of holins contains a cytoplasmic regulatory domain that participates in proper lysis timing, whereas altered C-terminus triggers incomplete or delayed lysis (Bläsi et al., 1999; Vukov et al., 2000). Thus, the possibility of impairment in the protein membrane anchorage could explain the presence of the STY1365 product also in the cytoplasmic fraction.

Overexpression of STY1365 triggers an alteration of bacterial envelope, as shown by the uptake of a hydrophobic dye (crystal violet) and a modified outer-membrane proteins profile. Although it is unusual that bacterial outer membrane can be affected by holins, it has been reported that in consideration of the enormous diversity in structure and amino acid sequence of holins, some systems based on these proteins can use auxiliary proteins to disrupt the outer membrane (Wang et al., 2000; Young, 2002). One example is gpl of the PM2 bacteriophage lysis system, which is encoded downstream of a canonical holin (gpk) and is necessary for disruption of the outer membrane of Pseudoalteromonas spp., representing a new type of outer-membrane-disrupting protein (Krupovic et al., 2007). In S. Typhi, the GICT18/1 genomic island, in addition to STY1365, also encodes genes with unknown functions that have not yet been characterized (Rodas et al., 2010).

In the process of adaptation to humans, S. Typhi has been exposed to different environments that have contributed to the acquisition of genetic material by horizontal transfer mechanisms (Moran & Plague, 2004). The prophage complement of S. Typhi and other Salmonella serovars represents a significant proportion of the bacterial genome in this genus. Thus, bacteriophages and prophage-like elements have played a critical role in the evolution and generation of genetic diversity within S. enterica (Thomson et al., 2004). In spite of the fact that we have not deciphered the specific function of the STY1365 product, our results support the idea that the STY1365 protein product of S. Typhi is involved in bacterial envelope stability. Considering that STY1365 is transcriptionally upregulated within THP-1 human macrophages (Faucher et al., 2006), further studies are necessary to dilucidate the specific role of STY1365 in the pathogenesis of this human pathogen.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported by a grant from Fondo Nacional de Desarrollo Científico y Tecnológico (Chile) (FONDECYT 1110120). P.I.R. was supported by fellowships from Comisión Nacional de Investigación Científica y Tecnológica (Chile) (CONICYT D-21060491 and AT-24080052). A.N.T. was supported by UNAB Grant DI-05/I (Chile).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References