SEARCH

SEARCH BY CITATION

Keywords:

  • Novosphingobium;
  • degradation efficiency;
  • gene expression;
  • frame-shift mutation

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The microcystin-degrading genes, mlr, are important participants in the degradation process of hepatotoxic microcystins for several bacterial species. However, their expression status during degrading microcystins is still unknown. In order to study this expression process, we isolated a novel microcystin-degrading bacterial strain, sequenced its mlr gene cluster and examined the expression of the mlrA gene at different concentrations of microcystin LR. The expression of mlrA increased slightly at 0.4 mg L−1, and was significantly upregulated at 2.0 mg L−1. Frameshift mutations were found in the mlrB* gene, and the mRNA of mlrB* could not be detected in the total RNA extracts of Novosphingobium sp. THN1. We conclude that mlrA is actively involved in the microcystin–degrading process, but mlrB* has lost its activity in this bacterial strain.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Microcystins are cyclic peptide hepatotoxins produced by several kinds of bloom-forming cyanobacterial species including Microcystis, Anabaena and Planktothrix (Carmichael, 1994; Zurawell et al., 2005). These cyanotoxins can be detrimental to eukaryotic cells through inhibiting protein phosphatase 1 and 2A and inducing oxidative stress (Campos & Vasconcelos, 2010). Previous studies have reported human intoxication and liver tumor promotion by microcystins (Matsushima et al., 1992; Azevedo et al., 2002). With their chemically stable cyclic heptapeptides structure, microcystins are difficult to remove during traditional water treatment processes. They may also persist in natural waters for a long period (Lahti et al., 1997; Hyenstrand et al., 2003), and are a health risk for humans. Therefore, many studies on removal of microcystins from drinking waters have been performed.

Biodegradation is a promising method for effective removal of microcystins in the process of water treatment (Bourne et al., 2006). It has been confirmed that indigenous bacteria from lake and reservoir waters can efficiently degrade microcystins (Christoffersen et al., 2002). Recently, several bacterial strains have been isolated and characterized with regard to their microcystin-degrading activities (Ishii et al., 2004; Tsuji et al., 2006; Ho et al., 2007; Manage et al., 2009; Eleuterio & Batista, 2010).

Sphingomonas sp. ACM-3962 was the first microcystin-degrading bacteria to be isolated, and it has been reported to possess an enzymatic pathway and a gene cluster for degrading microcystin (Bourne et al., 1996, 2001). Four genes are sequentially located on the cluster as mlrC, mlrA, mlrD and mlrB. The middle two genes, mlrA and mlrD, are transcribed in the forward direction, and mlrC and mlrB are transcribed in the reverse direction. These genes encode a transporter-like protein MlrD and three enzymes MlrA, MlrB and MlrC, which are involved in the process of uptake and degradation of microcystin. In the degradation pathway, microcystinase (MlrA) is the first enzyme to hydrolyze cyclic microcystin LR into a linear intermediate. Because the toxicity of linear microcystin LR decreases about 160 times, MlrA has been regarded as a crucial enzyme for removal of the toxin (Bourne et al., 1996). Therefore, detection of this mlrA gene is of significance for monitoring microcystin-degrading bacteria in natural waters and water treatment systems. Simple PCR methods and a TaqMan PCR assay targeting the mlrA gene were developed for detection and quantitative assessment of microcystin-degrading bacteria (Saito et al., 2003; Hoefel et al., 2009). So far, most research has focused on detection of mlr genes and the degrading activity of different bacterial species. However, little is known about the expression status of mlrA during the process of microcystin degradation.

The MlrB protein was shown to hydrolyze linear microcystin LR into a tetrapeptide, which would later be degraded by MlrC (Bourne et al., 1996). Furthermore, it was found that MlrA and MlrC are able to decompose microcystin LR without MlrB (Bourne et al., 2001). There is some doubt that MlrC has a double activity towards both linear microcystin LR and the tetrapeptide product, and that the function of MlrB towards linear microcystin LR is not essential (Bourne et al., 2001). Further research to elucidate whether MlrB is indispensable in the microcystin degrading pathway is needed.

Lake Taihu, China's third largest lake, encounters annual cyanobacterial blooms mainly caused by Microcystis, a major microcystin producer (Ye et al., 2009). However, microcystins can be detected only at a relatively low level in lake water through the year (Chen et al., 2008). It is possible that bacterial species in Lake Taihu play an important role in these low microcystin levels. Research on microcystin-degrading bacteria from this lake will be helpful in understanding these questions. In the present study, we successfully isolated a microcystin-degrading bacterium through detection of the mlrA gene in bacterial clones from a water sample of Lake Taihu. The whole mlr gene cluster of this bacterial strain was cloned and characterized. In addition, we examined the mlrA expression response to microcystin LR exposure and analyzed the features of mlrB* in the bacterial isolates.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Water sample and bacteria isolation

Water samples were collected from Lake Taihu in September 2009 during a cyanobacterial bloom. The samples were preserved at 4 °C before further processing. One milliliter of water sample was diluted 10 000-fold with sterile distilled water and 100 μL of the dilution was spread on R2A medium plates (Massa et al., 1998). All plates were incubated at 25 °C for 5 days. Single bacterial colonies were selected and inoculated onto fresh R2A plates. After 48-h cultivation, the colonies were used as templates for mlrA detection by PCR using the primer pair mlrAF/mlrAR (Table 1). Positive colonies were preserved in liquid R2A medium containing 10% glycerol at −80 °C.

Table 1.   Primer sequences used in this study
GenePrimerSequence (5′–3′)Tm (°C)
  • The numbers are counted from the first adenine base of mlrB gene.

  • *

    * This gene has a mutation.

mlrAmlrAFCCTCGATGACCTCGTAGC60
mlrARCGGCCATCTTCAGCAAT 
mlrB*mlrBFCCATCGCGTTCTGGTACAGT60
mlrBRTGCGGTATTTGCTGACATCA 
mlrCmlrCFTCGGACGACTTTACGGCA60
mlrCRGGATTTCGCAACCGAGG 
mlrDmlrDFGTTCCTCGGCGTAGCCT60
mlrDRGCGACGAAGATCGTTGCT 
mlrC walkingmlrCR1CCCTGGCAGTACAATTGGGCTTTGA65
mlrCR2CACAGGGCTTGCCGAGAATGTCA 
mlrCR3CGTCAGCGAAATTCGCGACCAGT 
mlrB* walkingmlrBF1TCGTAGACCTTAGGGAGGTCAGGCA65
mlrBF2GGATAAGAGCGGCCGTGAACTGCT 
mlrBF3AGCATAGGCGCAGCCCGGTTGAT 
mlrA Real-timeqmlrAFAGGAGACGCACGCTCACCTC60
qmlrARGGCTATGACAGTAACGCCCTGA 
16S rrn Real-timeq16SFCGTAAAGCTCTTTTGCCAGGGA60
q16SRCTTTCACCTCTGACTTGTGTCGC 
mlrB* cDNAmlrB-84GGCTTTGGACTTGCTGATCTAG58
mlrB-203GCGTTCCTGTGCCAAGATTA 

Identification of the bacterial species

Partial sequence of the 16S rRNA gene from the isolated bacteria was amplified and sequenced using primer sets 27F and 1492R (Eden et al., 1991). Then, similar sequences to this 16S rRNA gene were searched for in the database of GenBank using a blast network service (blastn). Denomination of the bacterium was determined according to bacterial species having a similar identity with this 16S rRNA gene.

Degradation test

The isolated bacterium was grown in triplicate using liquid R2A medium to an OD600 nm=0.3 at 28 °C by shaking the culture flask at 150 r.p.m. Then microcystin LR was added to a final concentration of 1.38 mg L−1. After culturing for 0, 12, 24, 36, 48 and 60 h, 1-mL aliquots were taken and centrifuged at 12 000 g for 5 min at 4 °C. The supernatants were assayed for remaining microcystin LR. A mixture of R2A medium and microcystin LR was used as a negative control, and sampled under the same given conditions. Microcystin LR was purified and analyzed as described previously (Wu et al., 2008).

Cloning of mlr genes

Primers used in this study were designed using primer premier 5.0 software referring to mlr sequences in GenBank or this study. Details for these primer pairs are shown in Table 1. In order to assemble the amplicons into an integrated mlr gene cluster, we designed primers with overlaps within amplification regions. The primers mlrAF, mlrAR and mlrBF were, respectively, located at the mlrC, mlrD and mlrB* genes. Flanking regions of the mlr gene cluster were amplified by PCR walking. Two groups of primers for this purpose were designed based on mlrC and mlrB* sequences of THN1 (Table 1). General amplifications, purification and sequencing of the PCR products were performed as described previously (Lin et al., 2010), except that the annealing temperature was adjusted according to the Tm values of different primers. A Genome Walking Kit (Takara, Japan) was utilized for PCR walking according to procedures provided by the manufacturer. All amplifications were conducted in an MJ mini personal thermal cycler (Bio-Rad). Sequences were compared with known mlr genes in GenBank using blastn.

mlrA transcription at different microcystin concentrations

A single colony of the bacterium was inoculated into 20 mL R2A medium and cultivated overnight. One milliliter of the culture was centrifuged at 3000 g for 1 min. The pellet was resuspended in 20 mL fresh medium within a conical flask and cultivated to an OD600 nm=0.6 at 28 °C. Nine flasks of this kind were divided into three groups for independent experiments. Within each group, three parallel cultures were prepared. Then, microcystin LR was added to a final concentrations of 0.4 and 2.0 mg L−1, respectively, and sterile water with no microcystin was used as a control. Two milliliters of culture were taken from the flasks 10, 20, 30, 45, 60, 90 and 120 min after inoculation, and centrifuged (12 000 g, 1 min) at 4 °C. The supernatant was decanted and the bacterial pellet was resuspended in 1 mL Trizol reagent (Invitrogen). Total RNA extraction, reverse transcription and Real-time PCR were performed as described previously (Shao et al., 2009), except that a MyiQ mini Real-time system (Bio-Rad) was used in our study. Two pairs of specific primers, qmlrAF/qmlrAR and q16SF/q16SR (Table 1), were used for quantification of mlrA and the 16S rRNA gene, respectively. The mRNA copy number was determined using the Ct value. The induction ratio was calculated by inline image where ΔΔCt=(Ct, target geneCt, 16S rrn)stress−(Ct, target geneCt, 16S rrn)control according to the handbook for the Bio-Rad Real-time PCR system. Significant differences between treatments and control at different times were determined by independent-samples t-test with spss 13.0 for Windows, and differences were considered to be significant at P<0.05.

Detecting mRNA of mlrB*

The RNA and cDNA samples were obtained from bacterial cultures containing 2.0 mg L−1 microcystin LR as described in the above section and were used in this section. Before reverse transcription, total RNA extracts were digested by DNase to eliminate genomic DNA contamination. Total cDNA of pure RNA extracts were used for detecting mlrB* using primer sets mlrB-84 and mlrB-203 (Table 1). Positive and negative controls were performed using THN1 cells and pure RNA extracts as templates, respectively. Amplification of the mlrA gene was also performed using primer sets qmlrAF and qmlrAR to ensure template quality.

Nucleotide sequence accession numbers

The 16S RNA gene and mlr gene cluster sequences found in this study are available under GenBank accession numbers HQ664117 and HQ664118, respectively.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Isolation and identification of microcystin-degrading bacterial strain

From only one bacterial colony, THN1, a potential mlrA gene was amplified and sequenced. blast analysis showed a 98.5% identity between this sequence and the mlrA gene sequence of Sphingomonas sp. ACM-3962. The 16S rRNA gene of this bacterial strain was also sequenced, and a homologous search by blastn showed a maximum identity (99%) to Novosphingobium aromaticivorans DSM 12444 (GenBank no. CP000248). Therefore, this bacterial strain was identified as Novosphingobium sp. THN1 belonging to the family Sphingomonadaceae.

Microcystin LR degradation characteristics

Removal of microcystin LR in the THN1 culture was observed following analysis of the remaining microcystin LR (Fig. 1). There was a sharp decline during the first 12 h and 91.2% of the toxin was eliminated in this period. Because microcystin LR could not be detected in the culture after 60 h, complete degradation was concluded. No decrease in the toxin occurred in the negative control (data not shown).

image

Figure 1.  Degradation profile of microcystin LR by Novosphingobium sp. THN1. The initial concentration of microcystin LR was 1.38 mg L−1. Initial culture of THN1 was adjusted to an OD600 nm=0.3. Values are an average of three repeats. SDs were small and not shown in the graph.

Download figure to PowerPoint

Sequence analyses

A potential mlr gene cluster with four genes mlrA, mlrB*, mlrC and mlrD was successfully cloned from THN1. All the gene sequences were confirmed to be mlr by aligning with the corresponding genes found in GenBank. The coverage of each mlr sequence from GenBank and their similarity to mlr of THN1 was calculated using bioedit V5.0.6 (Table 2). THN1 had maximum identities with different strains for each gene including mlrA (MD-1, 99.7%), mlrB* (C-1, 96%), mlrC (C-1, 91.7%) and mlrD (ACM-3962, 95.7%). A particularly low similarity (83.7%) of mlrA was found between THN1 and Y2 (Saito et al., 2003), indicating that the Y2 strain has experienced more variation. The two mlr clusters of THN1 and ACM-3962 had a similarity of 95.6%. Relative locations and directions of transcription for each mlr gene of THN1 were the same with ACM-3962. Because the only available mlrC gene sequence (1521 bps) from ACM-3962 does not contain a stop codon, the mlrC (1536 bps) coding 511 amino acid residues, found in this study, was the first reported complete ORF for this gene.

Table 2.   Comparison of mlr genes sequences in GenBank
GeneAccession no.BacteriaCoverage (%)*Similarity (%)
  • *

    Coverage was calculated according to mlr sequences of THN1 in this study.

  • Similarities between mlr genes of THN1 and other available mlr sequences in GenBank.

  • Sequences in this study.

mlrAHQ664118Novosphingobium sp. THN1100100
AF411068Sphingomonas sp. ACM-396210098.5
AB114203Sphingomonas sp. Y27983.7
AB114202Sphingomonas sp. MD-17999.7
DQ112243Sphingopyxis sp. LH217291.2
AB468058Sphingopyxis sp. C-110091.8
GU224277Stenotrophomonas sp. EMS7991.2
HM245411Sphingopyxis sp.USTB-0510092
mlrBHQ664118Novosphingobium sp. THN1100100
AF411069Sphingomonas sp. ACM-396210088.2
AB468059Sphingopyxis sp. C-110096
DQ423530Sphingopyxis sp. LH213094.5
mlrCHQ664118Novosphingobium sp. THN1100100
AF411070Sphingomonas sp. ACM-39629991.5
AB468060Sphingopyxis sp. C-110091.7
DQ423531Sphingopyxis sp. LH214189.4
mlrDHQ664118Novosphingobium sp. THN1100100
AF411071Sphingomonas sp. ACM-396210095.7
DQ423532Sphingopyxis sp. LH215089.1

Mutations within mlrB* gene and mRNA detection

Alignment of mlrB* sequences for THN1 and ACM-3962 showed three base insertions (Fig. 2a) at positions 30(C), 44(C) and 1176(G). Apparently, the insert mutations caused a frameshift and eight stop codons (Fig. 2b) within the gene sequence. In an attempt to determine whether mlrB* was transcribed into mRNA in the THN1 cells, we tried to amplify mlrB* from the total cDNA. As displayed in the gel image (Fig. 3), high-quality total RNA was extracted from THN1 cells and no genomic DNA could be detected in the RNA extracts after digesting with DNase. In PCR reactions using total cDNA, the mlrA amplicon was obvious, but no mlrB* product could be detected. In other words, no mRNA of mlrB* gene existed in the complete RNA for the THN1 cells.

image

Figure 2.  Alignment of partial mlrB* sequences of THN1 and ACM-3962 (GenBank no. AF411069) (a) and presumed partial amino acid sequences encoded by mlrB* gene of THN1 (b). Shaded regions show base insertions (a) and stop codons (b) within the mlrB* sequence of THN1.

Download figure to PowerPoint

image

Figure 3.  Total RNA extracts of THN1 cells and PCR products of mlrA and mlrB* displayed on a 1% agarose gel. Lanes 1 and 2 are DNA marker and RNA extracts, respectively. Lanes A-1, A-2 and A-3 represent amplification products of mlrA from THN1 cells, pure RNA extracts and total cDNA, respectively. Lanes B-1, B-2 and B-3 represent amplification products of mlrB* from THN1 cells, pure RNA extracts and total cDNA, respectively.

Download figure to PowerPoint

Regulation of mlrA gene expression

Upregulated expression of mlrA gene was detected upon exposure to microcystin LR (Fig. 4). The mlrA transcription increased slightly at 0.4 mg L−1 microcystin LR. A statistically significant increase of transcription at 2.0 mg L−1 microcystin LR was observed at 10, 45 and 90 min (P<0.05 or 0.01) with ratios of 2.68, 3.03 and 1.95, respectively, with the highest transcription level occurring at 45 min. It seems that exposure to a higher concentration of microcystin caused a more rapid and enhanced transcriptional response of the mlrA gene. During the 2 h period for the experiment, transcription of the mlrA gene experienced a three-step process of gradually increasing, going to the highest and then reducing to the normal level (similar to the control). An exception to this finding was the rapid increase in transcription, within 10 min, at 2.0 mg L−1 microcystin LR.

image

Figure 4.  Effects of microcystin LR on expression of mlrA gene in THN1. The single asterisk means a significant difference at P<0.05 and double asterisks at P<0.01 (t-test between microcystin LR treatments and negative control).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

In this study, we successfully isolated a novel microcystin-degrading bacterium, Novosphingobium sp. THN1, from a water sample of Lake Taihu. Moreover, we characterized the mlr gene cluster of THN1 and examined the expression level for mlrA at different concentrations of microcystin LR.

THN1 mlr genes are very similar to the reported mlr sequences in previous studies, demonstrating that this gene cluster is conserved among different bacterial species. With regard to the activity of mlrB* gene in this enzymatic pathway, we observed stop codons within the mlrB* sequence of THN1 as well as no transcription of the mlrB* gene in THN1 cells. Therefore, the mlrB* gene may have experienced inactivation mutations during the evolution for the mlr gene cluster of THN1. Another available mlrB* sequence from Sphingopyxis sp. C-1 (AB468059) contains the same base insertions and stop codons with THN1 (data not shown). It is likely that the mlrB* of C-1 is also silent in this bacterial strain. However, C-1 has not been examined by experiment and whether silent mlrB* is a universal phenomenon is not known. Further study including use of more microcystin-degrading bacterial strains is needed.

Whether mlr genes have other essential biological functions for the bacterial hosts is still unknown. The results of mlrA expression response to microcystin LR in this paper provide some clues. Addition of microcystin LR into the culture of THN1 induced upregulation of mlrA expression. The mlr genes seem to be specific for microcystin-degrading bacteria to utilize microcystin efficiently. It probably indicates an ancient origin of the mlr genes for dealing with microcystin, which are also regarded as of ancient origin in cyanobacteria (Rantala et al., 2004). To test this hypothesis, phylogenetic analyses of microcystin-degrading bacteria were performed based on available 16S rRNA gene and mlrA gene sequences in GenBank (Supporting Information, Fig. S1). The neighbor-joining trees of the mlrA gene and the 16S rRNA gene are mostly congruous, proving that mlrA is as conserved and ancient as the 16S rRNA gene. However, incongruence between mlrA and the 16S rRNA gene for Stenotrophomonas sp. EMS (Chen et al., 2010) indicates a recent lateral gene transfer. The mlrA of EMS may have been obtained from one or more of the Sphingopyxis species.

Microcystin-degrading bacteria, which possess mlr genes, may play an important role in decreasing microcystin in Lake Taihu and other water bodies. Because mlrB is probably silent, the mlrA gene is a better molecular probe than mlrB for detecting or monitoring dynamics of microcystin-degrading bacteria.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

This research was supported by the State Key Basic Research and Development Plan of China (2008CB418002), the National Water Science and Technology Projects (2009ZX07101-013-02) and the Talent Scientist Program of the Chinese Academy of Sciences (082303-1-501).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Azevedo SMFO, Carmichael WW, Jochimsen EM, Rinehart KL, Lau S, Shaw GR & Eaglesham GK (2002) Human intoxication by microcystins during renal dialysis treatment in Caruaru-Brazil. Toxicology 181–182: 441446.
  • Bourne DG, Jones GJ, Blakeley RL, Jones A, Negri AP & Riddles P (1996) Enzymatic pathway for the bacterial degradation of the cyanobacterial cyclic peptide toxin microcystin LR. Appl Environ Microb 62: 40864094.
  • Bourne DG, Riddles P, Jones GJ, Smith W & Blakeley RL (2001) Characterisation of a gene cluster involved in bacterial degradation of the cyanobacterial toxin microcystin LR. Environ Toxicol 16: 523534.
  • Bourne DG, Blakeley RL, Riddles P & Jones GJ (2006) Biodegradation of the cyanobacterial toxin microcystin LR in natural water and biologically active slow sand filters. Water Res 40: 12941302.
  • Campos A & Vasconcelos V (2010) Molecular mechanisms of microcystin toxicity in animal cells. Int J Mol Sci 11: 268287.
  • Carmichael WW (1994) The toxins of cyanobacteria. Sci Am 270: 7886.
  • Chen J, Hu L, Zhou W, Yan S, Yang J, Xue Y & Shi Z (2010) Degradation of microcystin LR and RR by a Stenotrophomonas sp. strain EMS isolated from Lake Taihu, China. Int J Mol Sci 11: 896911.
  • Chen W, Song L, Peng L, Wan N, Zhang X & Gan N (2008) Reduction in microcystin concentrations in large and shallow lakes: water and sediment-interface contributions. Water Res 42: 763773.
  • Christoffersen K, Lyck S & Winding A (2002) Microbial activity and bacterial community structure during degradation of microcystins. Aquat Microb Ecol 27: 125136.
  • Eden PA, Schmidt TM, Blakemore RP & Pace NR (1991) Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA specific DNA. Int J Syst Bacteriol 41: 324325.
  • Eleuterio L & Batista JR (2010) Biodegradation studies and sequencing of microcystin LR degrading bacteria isolated from a drinking water biofilter and a fresh water lake. Toxicon 55: 14341442.
  • Ho L, Hoefel D, Saint CP & Newcombe G (2007) Isolation and identification of a novel microcystin-degrading bacterium from a biological sand filter. Water Res 41: 46854695.
  • Hoefel D, Adriansen CMM, Bouyssou MAC, Saint CP, Newcombe G & Ho L (2009) Development of an mlrA gene-directed TaqMan PCR assay for quantitative assessment of microcystin-degrading bacteria within water treatment plant sand filter biofilms. Appl Environ Microb 75: 51675169.
  • Hyenstrand P, Rohrlack T, Beattie KA, Metcalf JS, Codd GA & Christoffersen K (2003) Laboratory studies of dissolved radiolabelled microcystin LR in lake water. Water Res 37: 32993306.
  • Ishii H, Nishijima M & Abe T (2004) Characterization of degradation process of cyanobacterial hepatotoxins by a gram-negative aerobic bacterium. Water Res 38: 26672676.
  • Lahti K, Rapala J, Färdig M, Niemelä M & Sivonen K (1997) Persistence of cyanobacterial hepatotoxin, microcystin LR in particulate material and dissolved in lake water. Water Res 31: 10051012.
  • Lin S, Wu Z, Yu G, Zhu M, Yu B & Li R (2010) Genetic diversity and molecular phylogeny of Planktothrix (Oscillatoriales, cyanobacteria) strains from China. Harmful Algae 9: 8797.
  • Manage PM, Edwards C, Singh BK & Lawton LA (2009) Isolation and identifcation of novel microcystin-degrading bacteria. Appl Environ Microb 75: 69246928.
  • Massa S, Caruso M, Trovatelli F & Tosques M (1998) Comparison of plate count agar and R2A medium for enumeration of heterotrophic bacteria in natural mineral water. World J Microb Biot 14: 727730.
  • Matsushima RN, Ohta T, Nishiwaki S, Suganuma M, Kohyama K, Ishikawa T, Carmichael WW & Fujiki H (1992) Liver tumor promotion by the cyanobacterial cyclic peptide toxin microcystin LR. J Cancer Res Clin 118: 420424.
  • Rantala A, Fewer DP, Hisbergues M, Rouhiainen L, Vaitomaa J, Börner T & Sivonen K (2004) Phylogenetic evidence for the early evolution of microcystin synthesis. P Natl Acad Sci USA 101: 568573.
  • Saito T, Okano K, Park HD, Itayama T, Inamori Y, Neilan BA, Burns BP & Sugiura N (2003) Detection and sequencing of the microcystin LR-degrading gene, mlrA, from new bacteria isolated from Japanese lakes. FEMS Microbiol Lett 229: 271276.
  • Shao JH, Wu ZX, Yu GL, Peng X & Li RH (2009) Allelopathic mechanism of pyrogallol to Microcystis aeruginosa PCC7806 (Cyanobacteria): from views of gene expression and antioxidant system. Chemosphere 75: 924928.
  • Tsuji K, Asakawa M, Anzai Y, Sumino T & Harada KI (2006) Degradation of microcystins using immobilized microorganism isolated in a eutrophic lake. Chemosphere 65: 117124.
  • Wu X, Xiao B, Gong Y, Wang Z, Chen X & Li R (2008) Kinetic study of the 2-methyl-3-methoxy-4-phenylbutanoic acid produced by oxidation of microcystin in aqueous solutions. Environ Toxicol Chem 27: 20192026.
  • Ye W, Liu X, Tan J, Li D & Yang H (2009) Diversity and dynamics of microcystin–producing cyanobacteria in China's third largest lake, Lake Taihu. Harmful Algae 8: 637644.
  • Zurawell RW, Chen H, Burke JM & Prepas EE (2005) Hepatotoxic cyanobacteria: a review of the biological importance of microcystins in freshwater environments. J Toxicol Env Heal B 8: 137.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1. Neighbor-joining trees constructed from the 16S rRNA gene (left) and the mlrA gene sequences (right) of microcystin-degrading bacteria. Bootstrap values are indicated at nodes.

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
FML_2337_sm_suppinfo.doc84KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.