Identification of the srtC1 transcription start site and catalytically essential residues required for Actinomyces oris T14V SrtC1 activity

Authors


  • Editor:William Wade

Correspondence: Kai P. Leung, Microbiology Branch, US Army Dental and Trauma Research Detachment, Institute of Surgical Research, 3650 Chambers Pass, Bldg 3610, Fort Sam Houston, TX 78234, USA. Tel.: +1 210 916 3803; fax: +1 210 916 7566; e-mail: kai.leung@amedd.army.mil

Abstract

In Actinomyces oris T14V, sortase SrtC1 mediates the assembly of type 1 fimbriae. We analyzed the effects of the conserved residues (H184, H204, F213, Y236, L263, T265, C266 and R275) on the SrtC1 activity by site-directed mutagenesis. We identified three essential conserved residues (H204, Y236 and C266) that are critical for the assembly of type 1 fimbriae in this organism. rapid amplification of cDNA ends analyses and reverse transcriptase-PCR results indicate that srtC1 was transcribed together with the putative adhesin gene fimQ and major structural subunit gene fimP as a single polycistronic mRNA.

Introduction

Actinomyces oris T14V (Henssge et al., 2009), formerly known as Actinomyces naeslundii T14V, a member of A. naeslundii genospecies 2 family, is considered as one of the primary colonizers for the formation of dental plaque on tooth surfaces (Li et al., 2004). Actinomyces oris T14V possesses two immunologically distinct types of fimbriae, which mediate the attachment of this species to both hard and soft tissue surfaces (Cisar et al., 1988). These fimbriae were among one of the first observed in gram-positive bacteria (Girard & Jacius, 1974). Type 1 fimbriae promote the binding of this organism to tooth surfaces mediated by the adsorbed salivary acidic proline-rich proteins and statherin. These salivary proteins serve as receptors for type 1 fimbriae (Clark et al., 1984; Gibbons et al., 1988). Type 2 fimbriae mediate the adherence of A. oris to oral mucosal epithelial cells and lactose-sensitive coaggregations with certain oral streptococci. Such interactions with other bacteria further promote the formation of dental plaque initiated by type 1 fimbriae of the organism (Palmer et al., 2003).

Previously, we demonstrated that the biogenesis of functional type 1 fimbriae in A. oris T14V required three genes (Yeung et al., 1987; Chen et al., 2007): the putative adhesin gene fimQ, the major structural subunit gene fimP and the type 1 fimbria-specific sortase gene srtC1. Sequence alignment indicates that A. oris SrtC1 contains all three conserved domains (D1, D2 and D3) that are present in all sortases and an extra C-terminal hydrophobic domain. According to the sortase classification (Dramsi et al., 2005), SrtC1 belongs to class C sortase family.

Sortases are a group of bacterial thiol transpeptidases responsible for the covalent attachment of specific surface proteins to the cell wall envelope of gram-positive bacteria (Marraffini et al., 2006). These enzymes are involved in the expression of several virulence factors and the assembly of fimbriae, and have been considered as a target of anti-infective therapy (Maresso & Schneewind, 2008).

SrtC1 is required for both the assembly of type 1 fimbriae in A. oris T14V and its adherence to saliva-coated hydroxylapatite (Chen et al., 2007). Accordingly, preventing the formation of type 1 fimbriae in A. oris by inhibiting the function of this sortase may reduce the colonization of this organism and consequently the dental plaque formation. In order to provide the foundation for developing inhibitor(s) for this sortase at the genetic level and/or protein level, we were interested in how this sortase gene was transcribed and which amino acid residue(s) was critical for the enzyme activity. This enzyme possesses a number of conserved residues, which include H204, F213, Y236, L263, T265, C266 and R275 that are commonly present among different classes of sortases from various bacteria. These conserved residues are located primarily in domains D2 and D3 (Dramsi et al., 2005). For example, H204 and F213 are located in domain D2, Y236 is positioned between domains D2 and D3, and L263, T265, C266 and R275 are found in Domain D3. Thus, the roles of these conserved residues may provide valuable information for developing potent and selective inhibitors for both this particular sortase and other sortases. Herein, we report the identification of the transcription starting site of the srtC1 determined by rapid amplification of cDNA ends (RACE) method and several conserved residues essential for its catalytic function revealed by site-directed mutagenesis.

Materials and methods

Bacterial strains, plasmids and growth conditions

Bacterial strains and plasmids used in this study are listed in Table 1. The Escherichia coli strains used for subcloning and plasmid isolation were grown in Luria–Bertani medium (Difco Laboratories, Detroit, MI) at 37 °C in the presence of the appropriate selective substances. Actinomyces oris T14V and its mutants were grown in Todd–Hewitt broth (THB) (Difco Laboratories), or as otherwise indicated, at 37 °C without agitation. When needed, kanamycin and trimethoprim were included in growth media at concentrations of 50 and 100 μg mL−1, respectively.

Table 1.   Bacterial strains and plasmids
Plasmid or strainDescription*Source
  • *

    Antibiotics: Km, kanamycin; Sm, streptomycin; Tm, trimethoprim.

Plasmid
 p6SrtTmr, plasmid containing srtC1 and both upstream–downstream flanking regions, template for site-directed mutagenesisChen et al. (2007)
 p6Srt H184ATmr, analog of p6Srt, for creating H184A mutantThis study
 p6Srt H204ATmr, analog of p6Srt, for creating H204A mutantThis study
 p6Srt F213ATmr, analog of p6Srt, for creating F213A mutantThis study
 p6Srt Y236ATmr, analog of p6Srt, for creating Y236A mutantThis study
 p6Srt L263ATmr, analog of p6Srt, for creating L263A mutantThis study
 p6Srt T265ATmr, analog of p6Srt, for creating T265A mutantThis study
 p6Srt C266ATmr, analog of p6Srt, for creating C266A mutantThis study
 p6Srt R275ATmr, analog of p6Srt, for creating R275A mutantThis study
 p6Srt R282ATmr, analog of p6Srt, for creating R282A mutantThis study
A. oris
 T14VWild-type strain, Kms SmrCisar et al. (1988)
 ΔSrtC1SrtC1-deficient strain, KmrChen et al. (2007)
 SrtC1-DHFRTransformant of ΔSrtC1 obtained with p6Srt, TmrChen et al. (2007)
 H184ATransformant of ΔSrtC1 obtained with p6Srt H184A, TmrThis study
 H204ATransformant of ΔSrtC1 obtained with p6Srt H204A, TmrThis study
 F213ATransformant of ΔSrtC1 obtained with p6Srt F213A, TmrThis study
 Y236ATransformant of ΔSrtC1 obtained with p6Srt Y236A, TmrThis study
 L263ATransformant of ΔSrtC1 obtained with p6Srt L263A, TmrThis study
 T265ATransformant of ΔSrtC1 obtained with p6Srt T265A, TmrThis study
 C266ATransformant of ΔSrtC1 obtained with p6Srt C266A, TmrThis study
 R275ATransformant of ΔSrtC1 obtained with p6Srt R275A, TmrThis study
 R282ATransformant of ΔSrtC1 obtained with p6Srt R282A, TmrThis study

RNA isolation and transcription start site

Total RNA from exponentially growing wild-type A. oris cells was extracted using the RNeasy Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Residual DNA in the total RNA samples was removed by DNase I treatment. Total RNA was concentrated by ethanol precipitation, resuspended in a small volume of RNase-free water and stored at −80 °C.

To determine the transcription start site(s) of A. oris srtC1, 5′RACE-PCR experiments were carried out using SMART RACE cDNA Amplification Kit (Clontech, Mountain View, CA) with 3 μg of total RNA. The sequences of oligo primers used are shown in Table 2. Briefly, the first strand of cDNA synthesis was carried out at 42 °C for 1.5 h using a gene-specific primer: primer 1 for fimQ, primer 3 for fimP and primer 5 for srtC1. RACE-PCR was performed using the above cDNA as the template and using SMART PCR primer UPM and gene-specific primers: primer 2 for fimQ, primer 4 for fimP and primer 6 for srtC1.

Table 2.   Primers used in RACE-PCR and RT-PCR
PrimerSequence (5′–3′)Gene
1CTTGTCAGTGAAGTCCTGCGTCATGfimQ
2CATCGGAGTAGATCGGACTGTTGACGTfimQ
3GTGAGAACCACCTTGCCGTACTTGfimP
4CACCGGCCTTGACCACGTCACCCTTGAfimP
5ACGTAGAAGACGTCGCCCTTCTTGsrtC1
6TCCGGGCCATGACCGGGTCGATGTCCAsrtC1
7GCCATCAACCGCGAGTACTGGCTGfimQ
8GTCGATGGTGGAGCCGTTCGGGTCfimP
9GCGCCAACGACTACGTCAACGGTGfimP
10AGGAAGCGCTCACGCAGGACCTTGsrtC1
11CACGGTCATCCTGCTGCGTCAGmt1
12GACACCATGGTCACCAGGACGAfimQ
13ATGCAGACCTGGATGAAGGCCATCsrtC1
14CAACCAATAGGAAGTCAGCAGCGAorfC

The amplified PCR products were further cloned into Zero Blunt TOPO vector (Invitrogen, Carlsbad, CA) and transformed into E. coli competent cells. Plasmid DNAs were isolated with QIAprep Spin Miniprep Kit (Qiagen). Cloned fragments were sequenced in both directions (ACGT Inc., Wheeling, IL) using an ABI automated sequencer and Dye Terminator Cycle Sequencing Kit, and the transcription start site was determined.

Transformation

Actinomyces oris transformation was performed with a modification to a previous method (Yeung & Kozelsky, 1994). Briefly, bacteria were grown in 150 mL of THB in the presence of 0.05% Tween 80 and 20 mM dl-threonine until the culture reached the early-exponential phase with an OD600 nm of 0.2. The culture was chilled on ice for 30 min, and the bacteria were harvested by centrifugation and washed extensively with ice-cold sterile distilled water and 10% glycerol in distilled H2O. Cells from the 150 mL culture were suspended in 0.6 mL of 10% glycerol. One hundred microliters of suspended cells were used for each electroporation, which was conducted in a chilled 2-mm Gap cuvette using a Pulser model of ECM630 (BTX, San Diego, CA) with the following settings: 2.5 kV, 25 μF capacitor and 400 Ω resistor. One milliliter of THB with 0.05% Tween 80 was added to the pulsed cells. After 2-h incubation at 37 °C, the samples were plated on TH agar plates with appropriate selective substance(s).

Construction of A. oris mutants

Nine plasmid p6Srt derivatives were created with a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA): H184A, H204A, F213A, Y236A, L263A, T265A, C266A, R275A and R282A using the primer sets listed in Supporting Information, Table S1. The presence of the desired mutation in each plasmid was confirmed by sequencing the mutagenized plasmids. Actinomyces oris mutants were constructed by transforming SrtC1-deficient strain A. orisΔSrtC1 with corresponding p6Srt derivative plasmids based on the allelic-exchange mechanism.

Extraction of surface proteins from A. oris

Surface proteins were solubilized from A. oris T14V and its mutants using a procedure modified from a mutanolysin digestion method as described previously (Demuth et al., 1996). Briefly, cells from a 10-mL overnight culture were harvested by centrifugation and washed twice with sterile water. The washed cells were suspended in the extraction buffer at a ratio of 4 μL of buffer per milligram of wet cells. The extraction buffer consisted of 26% melezitose, 10 mM MgCl2, 10 mM phosphate buffer (pH 7.0) and 1000 U mL−1 mutanolysin. After a 5-h incubation at 37 °C, the suspension was centrifuged (10 000 g, 10 min, 4 °C). The supernatant was dialyzed against distilled water using a 10-kDa molecular weight cut off mini Dialysis Units (Pierce, Rockford, IL) and stored at −20 °C for analyses. All chemicals used in the extraction were obtained from Sigma-Aldrich Corp. (St. Louis, MO).

Western blot analysis

Extracted surface proteins were separated on 3–8% Tris-Acetate NuPAGE gels (Invitrogen) and transferred onto nitrocellulose membranes. These membranes were incubated with 1 μg mL−1 monoclonal antibody C8A4 directed against the structural subunit (FimP) of T14V type 1 fimbriae (Cisar et al., 1991). Membranes were washed, incubated with a secondary antibody and developed according to the instructions of WesternBreeze Chromogenic Immunodetection System kit (Invitrogen).

Results and discussion

Previously, we identified three essential genes (fimQ, fimP and srtC1) for the biosynthesis of type 1 fimbriae in A. oris T14V (Chen et al., 2007). These three genes were bordered by methyltransferase gene (mt1) at the upstream and putative orfC gene at downstream (Fig. 1a). A blast search indicates that OrfC contains a PAP2 domain (type 2 phosphatidic acid phosphatase) and may be a PAP2-like superfamily member. In order to localize the promoter(s) for these three genes, RACE analyses were performed to determine the transcription start site(s). As shown in Fig. 1b, we were able to obtain a RACE fragment only from RACE-PCR reactions initiated within fimQ (lane 1), not from the reactions initiated within either fimP (lane 2) or srtC1 (lane 3). The size of the RACE fragment is consistent with the sequence-derived size of 590 bp. The results suggest that the transcription of either fimP or srtC1 was not initiated immediately upstream of these two respective genes. It is likely that both fimP and srtC1 were transcribed together with fimQ as a single mRNA unit. To confirm this, we amplified the junctional regions of fimQ-fimP and fimP-srtC1. As shown in Fig. 1c, lanes 1 and 3, when the same cDNA generated by the use of primers 3 or 5 were used as the templates, both junctional regions were amplified. The two PCR products have the expected sizes of 540 and 712 bp. These results indicated that fimQ-fimP and fimP-srtC1 are together at the mRNA level. Therefore, these data confirmed that fimQ, fimP and srtC1 were transcribed as a single polycistronic mRNA. In addition, no amplification was observed when total RNA was used as the template (Fig. 1c, lanes 2 and 4). The results suggest that there is no DNA contamination in the RNA preparation and the amplicons produced were derived from the cDNA generated in the RACE reactions. When similar reverse transcriptase-PCR reactions were performed on the junctional regions of mt1-fimQ and srtC1-orfC, no amplicon was obtained (data not shown). These results reveal that fimQ is the first gene and srtC1 is the last gene in a tricistronic operon. This assignment is consistent with our previous findings that orfC is not required for the type 1 fimbriae biosynthesis (Chen et al., 2007).

Figure 1.

 (a) Schematic presentation of the type 1 fimbriae gene cluster in Actinomyces oris T14V (Chen et al., 2007). Primers 1, 3 and 5 were used to initiate the first strand of cDNA synthesis from the regions of fimQ, fimP and srtC1, respectively. Primers 2, 4 and 6 were used for RACE-PCR. Primers 7–14 were used for amplifying the junction regions of fimQ-fimP, fimP-srtC1, mt1-fimQ and srtC1-orfC. (b) RACE fragments amplified from RACE-PCR reactions initiated within fimQ (lane 1), fimP (lane 2), srtC1 (lane 3). The size of the fragment is shown on the left. (c) Reverse transcriptase-PCR showing that fimQ, fimP and srtC1 were transcribed as a contiguous transcript. fimQ-fimP and fimp-srtC1 junction regions were amplified with the cDNA templates synthesized in the RACE reactions initiated with primer 3 (lane1) and primer 5 (lane 3), respectively, not with total RNA sample as the template (lanes 2 and 4). The sizes of the two amplified fragments are shown on the left. (d) The nucleotide sequence of the operon promoter region is shown. The transcription start site, as determined by 5′RACE analysis, is indicated with +1 and underlined. The deduced −35 and −10 promoter sequences and the putative ribosome-binding site (RBS) are also underlined.

To locate the transcription start site, the amplified RACE PCR product (Fig. 1b, lane 1) was cloned into Zero Blunt TOPO vector and sequenced. Based on the DNA sequence obtained, the fimQ (and the fimP and srtC1) transcription start site was located at the adenine residue that is 58 bp upstream of the proposed ATG start codon (Fig. 1d). The identified transcription start point was subsequently used to deduce the putative promoter sequence of the type 1 fimbria gene cluster based on the consensus sequences observed in promoters from prokaryotic organisms. The deduced −35 (TTGGGG) and −10 (TACATT) boxes for the promoter of the gene cluster are separated by a spacer of 16 nucleotides (Fig. 1d). The −10 box sequence is consistent with the promoters' −10 consensus sequence (Hawley & McClure, 1983), TAtAaT, whereas the −35 hexamer shares only three out of the six bases with the consensus sequence TTGACa.

Sortases catalyze the assembly of surface proteins and fimbriae in the cell wall envelope of gram-positive bacteria. SrtC1 is required for the biosynthesis of type 1 fimbriae in A. oris T14V (Chen et al., 2007). In order to better understand the structure–function of this sortase, we analyzed the role of eight conserved amino acid residues. The amino acids to be mutated were chosen based on the sequence alignment of several class C family sortases (Fig. 2). Each mutation was first introduced in vitro into plasmid p6Srt carrying the srtC1 gene (Chen et al., 2007) by site-directed mutagenesis to replace each conserved amino acid with an alanine residue. The desired mutations were confirmed by sequencing and the integrity of all plasmid constructs was verified by enzyme digestions and sequencing. The mutated srtC1 copies were introduced into the srtC1 deletion host strain ΔSrtC1 (Chen et al., 2007) by transformation.

Figure 2.

 Partial sequence alignment of class C sortases from different bacteria. Identical residues are indicated with pink letters. The sequences were aligned using the vector nti program (Invitrogen).

The resultant transformants were confirmed for the presence of mutated srtC1 introduced by allelic exchange. Cell surface proteins from these mutants were extracted, separated on gel and probed with monoclonal antibody against the type 1 structural subunit FimP. The ability to assemble type 1 fimbriae, as indicated by the polymerization of FimP, was used to evaluate the activity of mutated sortases. As shown by the results of the Western blot (Fig. 3), five mutants (H184A, L263A, T265A, F213A and R275A) produced patterns of surface proteins similar to those of the wild type, displaying the polymeric form of the structural subunits in the high-molecular-weight region as revealed by the anti-FimP antibody. However, only the monomeric form of FimP was observed in the other three mutants, H204A, Y236A and C266A. The results indicate that each of these three mutations either abolished the SrtC1 activity, or reduced the activity to an undetectable level as revealed by the blot method, or that these three mutated sortases might not be expressed and/or stable compared with the wild-type SrtC1. Dot-blot results indicate that there are less FimP components on the surfaces of these three mutants than on those of the wild-type strain and other mutants (Fig. S1).

Figure 3.

 Western blot analyses of type 1 fimbriae extracted from Actinomyces oris wild-type and mutant strains. Cell-surface proteins were extracted by mutanolysin digestion of bacteria, separated on a NuPAGE gel, transferred to a nitrocellulose membrane, probed with mAb 8A against an epitope of FimP and developed with Chromogenic Western Blot Immunodetection Kit (Invitrogen). Marker represents 10 μL of MagicMark XP Western Protein Standard (Invitrogen). WT, wild-type A. oris T14; ΔSrtC1, srtC deletion mutant. Other lanes represent mutants that have one of the conserved amino acids replaced with alanine.

There is a conserved TLXTC motif in all indentified sortases. The Cys residue in this motif is essential for any sortase activity. Based on the newly published crystal structure of SrtC1(Persson, 2011), the nucleophile Cys 266 is located at the centre of the active site. The effect of C266A mutation is consistent with the hypothesis that this catalytic cysteine residue is used in the nucleophilic attack of the Thr-Gly peptidic bond in the target's LPXTG motif. A similar mutation effect has also been reported for both nonpilus-related and pilus-related sortases from other organisms. For example, Cys 184 in SrtA from Staphylococcus aureus (Ton-That et al., 1999, 2002; Frankel et al., 2007), Cys 193 in SrtC1 from Streptococcus pneumoniae (Manzano et al., 2008) and Cys 219 in SrtC1 from Group B Streptococcus (Cozzi et al., 2011) are critical for each of their corresponding sortase activities. When two other residues (Leu263 and Thr265) in this motif were changed to Ala, the effect on the enzyme activity was minimal (Fig. 3). Regarding whether these two residues are important for sortase activity, there are no mutagenesis data available for comparison in other pilus-related sortases. However, in the nonpilus-related SrtA, the corresponding L181A mutation has modest effect on catalytic efficiency, while T183A mutation resulted in a 1200-fold decrease in kcat relative to wild-type SrtA (Frankel et al., 2007). Because our polymerization assay only indicates the presence or the absence of activity, not the rate of the enzymatic activity, quantitative methods need to be developed to address the effect of these mutations more precisely. To this end, our dot-blot results did show that there are less FimP components on the surface of T265A mutant than on the surface of the wild-type strain (Fig. S1).

It has been proposed that sortases use a catalytic triad composed of His-Cys-Arg during the catalytic process (Table 3). The His204 residue is most likely the His residue in the catalytic triad. The His 204 residue is located 6 Å from the Cys 266 SG atom (Persson, 2011). The H204A mutation effect is consistent with what has been reported about other histidine residues located in the catalytic triads. For instance, in pilus-related sortases, its counterparts His 131in SrtC-1 of S. pneumoniae and His157 in SrtC1 of Group B Streptococcus were essential for pilus fiber formation in both organisms (Manzano et al., 2009; Cozzi et al., 2011). In the nonpilus-related SrtA from S. aureus, His120 residue at a similar location in relation to the essential Cys184 residue is also critical for the catalytic process (Ilangovan et al., 2001; Ton-That et al., 2002). However, the catalytic function of this critical histidine residue is still a subject of debate. It is speculated that the His residue, because it is being positively charged, might contribute to the electrostatic environment essential for the catalytic activity (Zong et al., 2004).

Table 3.   Putative catalytic triad composition of different sortases
Sortase originCatalytic triad compositionReference
SrtA of S. aureusHis120-Cys184-Arg197Zong et al. (2004)
SrtC1 of S. pneumoniaeHis131-Cys193-Arg202Manzano et al. (2009)
SrtC1 of Group B StreptococcusHis157-Cys219-Arg228Cozzi et al. (2011)
SrtC1 of A. orisHis204-Cys266-Arg275Persson (2011)

Although the newly published crystal structure (Persson, 2011) showed that Arg275 is part of the His-Cys-Arg catalytic triad, our results indicate that this Arginine residue is not important for the SrtC1 activity in A. oris T14V. In contrast, its counterparts Arg202 in SrtC-1 of S. pneumoniae and Arg228 in SrtC1 of Group B Streptococcus are essential for the activity of the corresponding sortases (Manzano et al., 2009; Cozzi et al., 2011). Even in the nonpilus-related sortase SrtA, the Arginine 197 residue was identified to be important for the enzyme's activity(Frankel et al., 2007). However, in SrtA, the Arg197 residue is 13 amino acids away from the essential Cys194 residue instead of the nine-amino acid distance between the arginine and cysteine residues in the SrtC catalytic triads. To eliminate the possibility that the triad Arg residue is located a bit farther out, we also mutated the Arg282 residue. Western blot results indicate that Arg 282 is not critical for the activity either (Fig. 3). Considering that the type 1 fimbriae of A. oris consists of two components, FimP and FimQ, and both components are likely polymerized by SrtC1 (Chen et al., 2007), it is possible that that A. oris SrtC1 may be more flexible compared with other class C sortases, and only use Cys 266-His 204 catalytic dyad, instead of Arg 275-Cys 266-His 204 catalytic triad, for the catalytic process. The role that the critical residue Tyr 236 plays with regard to SrtC1 activity in A. oris is presently unknown and will be the subject of our future study.

In summary, we have identified the promoter (transcription start site) for the type 1 fimbria gene cluster and the three essential amino acid residues critical for the SrtC1 activity in A. oris T14V. These findings fill the knowledge gap with regard to the transcription and structure–function of SrtC1 of A. oris T14V. The identification of these essential amino acid residues that are critical for the catalytic function of this enzyme in A. oris may reveal potential targets for therapeutic use to prevent or reduce dental plaque formation initiated by this oral colonizer.

Acknowledgements

This work was supported by the US Army Medical Research and Materiel Command. The authors are indebted to Dr John O. Cisar for providing the monoclonal antibody C8A4 for the study.

Statement

The opinions or assertions contained herein are the private views of the author and are not to be construed as official or as reflecting the views of the Department of the Army or the Department of Defense.

Ancillary