SEARCH

SEARCH BY CITATION

Keywords:

  • oral microbiology;
  • veillonellae;
  • mutagenesis

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Veillonellae are one of the most prevalent and predominant microorganisms in both the supra- and subgingival plaques of the human oral cavity. Veillonellae's mutualistic relationships with the early, middle, and late colonizers of the oral cavity make them an important component of oral biofilm ecology. Unlike other ubiquitous early colonizers in the oral cavity, surprisingly little is known about Veillonella biology due to our lack of ability to genetically transform this group of bacteria. The objective of this study was to test the transformability of veillonellae. Using Veillonella parvula strain PK1910, we first obtained spontaneous mutations conferring streptomycin resistance. These mutations all carry a K43N substitution in the RpsL protein. Using the mutated rpsL gene as a selection marker, a variety of conditions were tested and optimized for electroporation. With the optimized protocol, we were able to introduce the first targeted mutation into the chromosome of V. parvula PK1910. Although more studies are needed to develop a robust genetic manipulation system in veillonellae, our results demonstrated, for the first time, that V. parvula is transformable, at least for strain PK1910.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Veillonellae are one of the most prevalent and numerically predominant species in the oral microbiome (Valm et al., 2011). One of the unique characteristics of veillonellae is their inability to ferment sugars and their utilization of lactic acid excreted by other fermentative bacteria as a carbon source. This characteristic makes veillonellae a central player in establishing multispecies oral biofilms with the early, middle, and late colonizers (Periasamy & Kolenbrander, 2009; Jakubovics & Kolenbrander, 2010; Periasamy & Kolenbrander, 2010).

Veillonellae were generally regarded as commensal bacteria of the oral cavity and the gastrointestinal tract of humans; however, numerous molecular epidemiological studies have found veillonellae to be associated with dental caries (Loesche et al., 1984; Marchant et al., 2001; Becker et al., 2002; Rozkiewicz et al., 2006; Aas et al., 2008; Al-Ahmad et al., 2010; Kanasi et al., 2010; Lima et al., 2010; Ling et al., 2010), as well as the initiation of periodontitis (Kamma et al., 1995; Tanner et al., 1996; Socransky et al., 1998), both of which are polymicrobial diseases of the oral cavity. Some species of Veillonella can also cause monomicrobial infections of the joint (Marchandin et al., 2001) or life-threatening bacteremia in immunocompromised patients (Strach et al., 2006).

Currently 11 species of Veillonella have been described (Kraatz & Taras, 2008), none of which has been shown to be genetically manipulatable. Thus, the studies of these organisms have been largely confined to physiological characterizations, making them one of the most prevalent, yet least understood organisms of the human microbiome. Of all the Veillonella species, Veillonella parvula is the most frequently isolated species of both the human oral cavity and the gastrointestinal tract. The genome sequence of the type strain V. parvula Te3T (=DSM 2008=ATCC 10790=JCM 12972) has been published recently (Gronow et al., 2010), which makes this species an attractive model for in-depth analysis of the biology and pathogenesis potential of veillonellae as a group. Another strain, V. parvula PK1910 [formerly Veillonella atypica PK1910 (Hughes et al., 1992), Veillonella spp. PK1910 (Periasamy & Kolenbrander, 2009)], has been the most characterized Veillonella strain in the oral biofilm. The genome of PK1910 was recently sequenced by our group. Analysis of the draft sequence (http://www.oralgen.lanl.gov/) identified many genes homologous to the competence related genes of both gram-positive and gram-negative bacteria (Qi & Ferretti, 2011), suggesting that this strain might be transformable. The objective of this investigation was to test the transformability of V. parvula PK1910. Using spontaneous and PCR-generated mutations in the rpsL gene, which confers streptinomycin-resistance, we demonstrated that DNA containing these mutations could be transferred into PK1910 via electroporation and integrated into the chromosome possibly through homologous recombination. To our knowledge, this is the first report of genetic transformation in veillonellae.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains and growth conditions

The bacterial strains and plasmids used in this study are listed in Table 1. Veillonella parvula strain PK1910 was formerly named V. atypica PK1910 or Veillonella spp. PK1910 (Hughes et al., 1992; Periasamy & Kolenbrander, 2009) and is now renamed V. parvula PK1910 based on our recent sequence analysis using the rpoB gene (Qi & Ferretti, 2011). Veillonella parvula PK1910 was grown in Todd–Hewitt (TH) broth (Difco) supplemented with 0.6% sodium lactate (THL), or brain heart infusion (BHI) broth (Difco) supplemented with 0.6% sodium lactate (BHIL), or a chemically defined medium (He et al., 2008) without glucose but supplemented with 0.6% sodium lactate and 0.1% peptone (ASSPL). Streptomycin (Sigma Chemical Co.) was added to the medium at a final concentration of 1 mg mL−1 for mutant selection. All V. parvula PK1910 cultures were grown anaerobically (85% nitrogen, 5% carbon dioxide, 10% hydrogen) at 37 °C. Escherichia coli cells were grown in Luria–Bertani (LB; Difco) broth with aeration at 37 °C. Escherichia coli strains carrying plasmid was grown in LB containing 100 μg mL−1 ampicillin (Fluka).

Table 1.   Bacterial strains and plasmids used in this study
Strains and plasmidsCharacteristicsReference
Strains
 V. parvula PK1910Wild typeHughes et al. (1992); Periasamy & Kolenbrander (2009)
 SR1PK1910 derivative containing an AAG to AAC mutation in codon43 of rpsL, streptomycin resistantThis work
 SR2PK1910 derivative containing an AAG to AAT mutation in codon43 of rpsL, streptomycin resistantThis work
 E. coli DH5aCloning strain 
Plasmids
 pSR1-rpsLpGEM+rpsL-SR1; AprThis work
 pWM-rpsLpGEM+rpsL-WM; AprThis work

Isolation and characterization of spontaneous streptomycin-resistant mutants

Veillonella parvula PK1910 overnight culture was plated on THL plates supplemented with 1 mg mL−1 streptomycin and colonies grown on the plates were isolated and purified. Chromosomal DNA was isolated from these mutants, and then the rpsL gene fragment was generated by PCR using primers rpsL-F and rpsL-R (Table 2 and Fig. 1) and sequenced.

Table 2.   Primers used in this study
PrimerSequence (5′–3′)
rpsL-FACGGATTGCTTGTGAAGAAC
rpsL-RTTGCTGTTGTACACCGGATC
rpsLup-FTTTGATGTCACCTAGCGAAC
rpsLdn-RTTAGCACTGAACACCGCAAC
rpsL-WM-FCTTGTTAGGAGTAGCTGTGTACACACG
rpsL-WM-RCCAAACTCCGCGCTTCGTAAAG
image

Figure 1.  The rpsL locus in Veillonella parvula PK1910 and sequence of the codon 43 region. The hollow arrows represent genes around the rpsL locus in the chromosome and the solid arrowheads illustrate the position and orientation of primers used in this study. The DNA sequence at and flanking codon 43 in rpsL-WT, rpsL-SR1, rpsL-SR2, and rpsL-WM is shown above the rpsL gene. Small letters in the codon indicate mutations.

Download figure to PowerPoint

Optimization of electroporation conditions

Veillonella parvula PK1910 cells were grown in THL, BHIL, or ASSPL media to designated growth phases (OD600 nm of 0.15–0.6), and harvested by centrifugation. Cells were washed in the following electroporation buffers, respectively, before subject to electroporation: (1) 10% glycerol in water, (2) 10% glycerol+1 mM MgCl2 in water, (3) 10% glycerol+272 mM sucrose in water, (4) 10% glycerol+0.5 M sucrose+10 mM potassium phosphate, and (5) 272 mM sucrose+7 mM sodium phosphate+1 mM MgCl2. Electroporation was performed using a Bio-Rad Gene Pulser with field strength settings from 5 to 20 kV cm−1 and a Bio-Rad Pulse Controller Plus with resistance settings of 200–400Ω.

Site-directed mutagenesis

A 2.1-kb fragment containing the rpsL gene was generated by PCR with primers rpsLup-F and rpsLdn-R (Table 2 and Fig. 1), using genomic DNA of the spontaneous streoptomycin resistance mutant (SR1) as template. The PCR amplicon was cloned into the pGEM-T easy vector (Promega) to generate pSR1-rpsL. To introduce the silent point mutations used to identify true transformants, plasmid pSR1-rpsL was used as template for inverse PCR using the phosphorylated primers rpsL-WM-F (containing the silent point mutations) and rpsL-WM-R (Table 2 and Fig. 1). Then the PCR reaction was purified and digested with DpnI to eliminate the template plasmid pSR1-rpsL. The PCR fragment, which actually was a linearized plasmid, was then self-ligated and transformed into E. coli. The plasmid containing the expected silent point mutations was confirmed by sequencing and designated as pWM-rpsL. Using the resulting plasmid as template, the 2.1-kb fragment with the introduced point mutations was generated with primer pair rpsLup-F/rpsLdn-R (Table 2 and Fig. 1).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Spontaneous streptomycin-resistant V. parvula PK1910 mutants carry a K43N substitution in the RpsL protein

It has been reported in other bacteria that spontaneous mutations in the rpsL gene can confer streptomycin resistance (Shima et al., 1996; Bjorkman et al., 1998; Barnard et al., 2010). To generate a selective marker for testing the transformability of V. parvula PK1910, we isolated spontaneous streptomycin-resistant mutants and sequenced the rpsL gene of these mutants. From the eight clones randomly selected for sequencing, all carried a single point mutation at codon 43 of the rpsL gene, among which five had a change from AAG to AAC (named SR1) while three from AAG to AAT (named SR2). These mutations resulted in exactly the same substitution of the wild-type lysine (K) by asparagine (N) at codon 43. This indicates that it is the K43N mutation in RpsL that confers streptomycin resistance in V. parvula.

Transformation with mutant genomic DNA

Analysis of the draft sequence of V. parvula PK1910 revealed a type I restriction system, suggesting a potential transformation barrier for foreign DNA. Thus, to avoid complications with the restriction system, we chose to use the chromosomal DNA from the isogenic rpsL mutant strain as transforming DNA to optimize transformation conditions.

Several factors have been reported to affect the efficiency of electroporation-mediated transformation, including cultivation conditions, composition of the electroporation buffer, and electroporation conditions. Using the streptomycin-resistant mutant DNA as transforming DNA and the wild-type DNA as negative control, we tested different combinations of these parameters (see Materials and methods) and found an optimal combination of buffer and electroporation condition for transformation. The procedure is described as follows. Cells were grown in ASSPL to early log phase (OD600 nm of 0.15–0.2) and harvested by centrifugation. Harvested cells were washed twice with cold electroporation buffer (10% glycerol+1 mM MgCl2) and centrifuged at 4000 g for 10 min at 4 °C. The cell pellet was resuspended in the same electroporation buffer to 1/50 volume of the original culture. Eighty microliters of this cell suspension was mixed with 2 μg of genomic DNA or PCR amplicon on ice and transferred to a precooled 0.1-cm gap electroporation cuvette (BTX, Harvard Apparatus). The cell–DNA mixture was subjected to electroporation at field strength of 20 kV cm−1, capacitance of 25 μF, and resistance of 200 Ω. Following electroporation, the cells were immediately diluted in 1 mL of THL medium and incubated anaerobically for 16 h at 37 °C then plated on THL agar plates supplemented with 1 mg mL−1 streptomycin. Colonies would appear after 24–48 h.

Using this protocol, we were able to consistently obtain 9–12 colonies μg−1 mutant genomic DNA, which was two to three times higher than the number of colonies from the wild-type DNA (3–5 colonies μg−1 DNA and these colonies are spontaneous mutants). This result suggested that at least half of the streptomycin-resistant colonies obtained using the mutant DNA contained introduced mutations while the rest may have originated from spontaneous mutation. We could not obtain consistent transformation results when using other parameter combinations mentioned in Materials and methods.

Electroporation with PCR products

With the optimized protocol, we next tested whether PCR-generated DNA could be used to transform V. parvula PK1910. PCR amplicons were generated with the primers rpsLup-F and rpsLdn-R (Table 2 and Fig. 1) using the wild-type and the spontaneous streptomycin-resistant strains SR1 (AAG to AAC mutation) and SR2 (AAG to AAT mutation) as templates. The amplicons were named rpsL-WT, rpsL-SR1, and rpsL-SR2, respectively (Fig. 1).

The three PCR amplicons were transformed into PK1910 with the procedure described above. In five separate experiments, we obtained similar results as the transformation with genomic DNA: there were always about two times more colonies in the transformation with the mutant DNA than with the wild-type DNA. For one of these experiments, we sequenced the rpsL gene of all the colonies that appeared on the plates. As shown in Table 3, most colonies in the rpsL-SR1 transformation have AAC mutation in codon 43, while most colonies in the rpsL-SR2 transformation have AAT mutation in codon 43. The colonies in rpsL-WT transformation, representing the spontaneous mutation, have a similar distribution of the AAC or AAT mutation in codon 43. This result strongly suggests that DNA-mediated transformation had occurred in V. parvula PK1910; however, a definitive demonstration of true transformation has yet to be made by introducing ‘silent’ mutations in the rpsL gene, in addition to the missense mutation (AAG to AAC or AAT) that confers streptomycin resistance.

Table 3.   Results of transformation with rpsL-SR1 and rpsL-SR2 DNA
Transforming DNANumber of colonies with AAC at codon 43Number of colonies with AAT at codon 43
rpsL-WT34
rpsL-SR1 (AAC)164
rpsL-SR2 (AAT)514

Electroporation with ‘watermarked’rpsL gene

To truly distinguish whether a streptomycin-resistant mutant is introduced by transformation via electroporation or generated by spontaneous mutation, we created two silent mutations flanking the missense mutation of codon 43 of rpsL-SR1 (Fig. 1). PCR amplicon was generated from this mutation, named rpsL-WM, and used to transform V. parvula PK1910. In five independent experiments, we obtained similar results: when equal amounts of DNA was used, rpsL-WM transformation always gave two to three times more streptomycin-resistant colonies than rpsL-WT transformation. The result of one transformation was shown in Fig. 2a. The rpsL gene from all these streptomycin-resistant colonies was then sequenced. Of the 19 colonies from rpsL-WM transformation, 11 contained the rpsL-WM sequence (Fig. 2b), three had the rpsL-SR1 sequence, and five had the rpsL-SR2 sequence. In contrast, of the nine colonies from the rpsL-WT transformation, five had the rpsL-SR1 sequence, four had the rpsL-SR2, and no colony had the rpsL-WM sequence. This result unequivocally demonstrates that V. parvula PK1910 is transformable.

image

Figure 2.  A representative result of transformation with rpsL-WT and rpsL-WM DNA. (a) Streptomycin-resistant colonies with rpsL-WT and rpsL-WM transformation. (b) DNA sequence showing the silent and missense mutations (asterisk) in the rpsL gene of a rpsL-WM transformant.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Veillonellae bacteria have so far remained as one of the most prevalent yet least studied microorganisms in the human oral microbiome, largely due to our inability to genetically transform them. In this study, we set forth to test the transformability of V. parvula strain PK1910, inspired by the finding of multiple competence-related genes on its genome. To this end, we have generated a ‘watermarked’rpsL gene conferring streptomycin resistance and shown that V. parvula PK1910 is transformable by electroporation. To our knowledge, this is the first report of genetic transformation in veillonellae.

Electroporation has been successfully used for DNA transformation in a large number of bacteria, such as Lactococcus lactis, Clostridium perfringens, Propionibacterium acnes, and Fusobacterium nucleatum, with varying optimal conditions for each bacterium (McIntyre & Harlander, 1989; Jiraskova et al., 2005; Kinder Haake et al., 2006; Cheong et al., 2008). In our efforts to optimize the procedure for transformation, we identified several parameters important to V. parvula transformation. First, the culturing media and cell growth stage are important. Veillonella parvula could be reproducibly transformed only when cells were grown in ASSPL medium and harvested at the early exponential phase. Another parameter important to transformation is MgCl2 in the electroporation buffer. The incorporation of 1 mM MgCl2 in the electroporation buffer is required for the success of transformation. The pulse length and voltage of electroporation are also important. Success was repeatedly achieved with field strength of 20 kV cm−1, capacitance of 25 μF, and resistance setting of 200 Ω.

Because our goal in this study was to examine the possibility of using electroporation to introduce DNA into V. parvula, with the method presented here, this goal has been achieved. However, the transformation efficiency is still too low to be used routinely as a tool for generating mutations. The reason for such a low efficiency could be due to a number of factors. First, the restriction system could be an important barrier for transformation using foreign DNA. In our study, although we could obtain a similar number of transformants using equal amounts of genomic and PCR-generated DNA, on a molar basis, the molar concentration of the target DNA is ∼1000 times higher in the PCR amplicon than in the genomic DNA. Attempts to use equal molar concentration of the target DNA of the PCR amplicon as the chromosomal DNA did not yield any transformants, indicating that the putative restriction system in V. parvula is probably functioning. Another reason for the low transformation efficiency could be attributed to the presence of large amounts of slime [extracellular polysaccharide (EPS)] on the cell surface. This structure makes the cell aggregates during centrifugation and washing with 10% glycerol, an electroporation buffer used for many bacteria. Although inclusion of 1 mM MgCl2 in the electroporation buffer could disperse the cells, it probably could not remove all the slime on the cell surface. Excessive EPS could have an adverse effect on DNA entry and affect transformation efficiency.

Another barrier for further developing a robust genetic transformation system in veillonellae is the identification of an appropriate selective marker. This is limited so far by the fact that V. parvula PK1910 is insensitive to many of the antibiotics commonly used in genetic transformation with other bacteria, such as kanamycin, spectinomycin, tetracycline, erythromycin, and ampicillin. In this study, we used the mutant rpsL, which confers streptomycin resistance, as a selective marker for allelic replacement. Unfortunately this mutation is recessive to the wild-type rpsL (Drecktrah et al., 2010), and thus cannot be used as a selective marker for gene knock-out studies in V. parvula. In some bacteria, similar obstacles could be overcome using nonantibiotic selection markers or auxotrophic mutants as recipient strains for transformation (Morona et al., 1991; Goh & Good, 2008; Vidal et al., 2008; Norris et al., 2009). We are currently testing this possibility as well. Also, it has been reported that plasmids exist in many Veillonella isolates (Arai et al., 1984), which makes it possible to build a shuttle vector between E. coli and veillonellae. We have recently isolated a plasmid from a clinical strain of V. parvula, and are currently testing its utility as a shuttle vector.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We thank the Kolenbrander laboratory for providing V. parvula strain PK1910. This work was supported by NIH grant R15DE019940.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Aas JA, Griffen AL, Dardis SR, Lee AM, Olsen I, Dewhirst FE, Leys EJ & Paster BJ (2008) Bacteria of dental caries in primary and permanent teeth in children and young adults. J Clin Microbiol 46: 14071417.
  • Al-Ahmad A, Roth D, Wolkewitz M, Wiedmann-Al-Ahmad M, Follo M, Ratka-Kruger P, Deimling D, Hellwig E & Hannig C (2010) Change in diet and oral hygiene over an 8-week period: effects on oral health and oral biofilm. Clin Oral Invest 14: 391396.
  • Arai T, Kusakabe A & Komatsu S (1984) A survey of plasmids in Veillonella strains isolated from human oral cavity. Kitasato Arch Exp Med 57: 233237.
  • Barnard AM, Simpson NJ, Lilley KS & Salmond GP (2010) Mutations in rpsL that confer streptomycin resistance show pleiotropic effects on virulence and the production of a carbapenem antibiotic in Erwinia carotovora. Microbiology 156: 10301039.
  • Becker MR, Paster BJ, Leys EJ, Moeschberger ML, Kenyon SG, Galvin JL, Boches SK, Dewhirst FE & Griffen AL (2002) Molecular analysis of bacterial species associated with childhood caries. J Clin Microbiol 40: 10011009.
  • Bjorkman J, Hughes D & Andersson DI (1998) Virulence of antibiotic-resistant Salmonella typhimurium. P Natl Acad Sci USA 95: 39493953.
  • Cheong DE, Lee HI & So JS (2008) Optimization of electrotransformation conditions for Propionibacterium acnes. J Microbiol Meth 72: 3841.
  • Drecktrah D, Douglas JM & Samuels DS (2010) Use of rpsL as a counterselectable marker in Borrelia burgdorferi. Appl Environ Microb 76: 985987.
  • Goh S & Good L (2008) Plasmid selection in Escherichia coli using an endogenous essential gene marker. BMC biotechnol 8: 61.
  • Gronow S, Welnitz S, Lapidus A et al. (2010) Complete genome sequence of Veillonella parvula type strain (Te3). Stand Genomic Sci 2: 5765.
  • He X, Wu C, Yarbrough D, Sim L, Niu G, Merritt J, Shi W & Qi F (2008) The cia operon of Streptococcus mutans encodes a unique component required for calcium-mediated autoregulation. Mol Microbiol 70: 112126.
  • Hughes CV, Andersen RN & Kolenbrander PE (1992) Characterization of Veillonella atypica PK1910 adhesin-mediated coaggregation with oral Streptococcus spp. Infect Immun 60: 11781186.
  • Jakubovics NS & Kolenbrander PE (2010) The road to ruin: the formation of disease-associated oral biofilms. Oral Dis 16: 729739.
  • Jiraskova A, Vitek L, Fevery J, Ruml T & Branny P (2005) Rapid protocol for electroporation of Clostridium perfringens. J Microbiol Meth 62: 125127.
  • Kamma JJ, Nakou M & Manti FA (1995) Predominant microflora of severe, moderate and minimal periodontal lesions in young adults with rapidly progressive periodontitis. J Periodontal Res 30: 6672.
  • Kanasi E, Dewhirst FE, Chalmers NI, Kent R Jr, Moore A, Hughes CV, Pradhan N, Loo CY & Tanner AC (2010) Clonal analysis of the microbiota of severe early childhood caries. Caries Res 44: 485497.
  • Kinder Haake S, Yoder S & Gerardo SH (2006) Efficient gene transfer and targeted mutagenesis in Fusobacterium nucleatum. Plasmid 55: 2738.
  • Kraatz M & Taras D (2008) Veillonella magna sp. nov., isolated from the jejunal mucosa of a healthy pig, and emended description of Veillonella ratti. Int J Syst Evol Microbiol 58: 27552761.
  • Lima KC, Coelho LT, Pinheiro IV, Rocas IN & Siqueira Jr JF (2010) Microbiota of dentinal caries as assessed by reverse-capture checkerboard analysis. Caries Res 45: 2130.
  • Ling Z, Kong J, Jia P et al. (2010) Analysis of oral microbiota in children with dental caries by PCR-DGGE and barcoded pyrosequencing. Microb Ecol 60: 677690.
  • Loesche WJ, Eklund S, Earnest R & Burt B (1984) Longitudinal investigation of bacteriology of human fissure decay: epidemiological studies in molars shortly after eruption. Infect Immun 46: 765772.
  • Marchandin H, Jean-Pierre H, Carriere C, Canovas F, Darbas H & Jumas-Bilak E (2001) Prosthetic joint infection due to Veillonella dispar. Eur J Clin Microbiol 20: 340342.
  • Marchant S, Brailsford SR, Twomey AC, Roberts GJ & Beighton D (2001) The predominant microflora of nursing caries lesions. Caries Res 35: 397406.
  • McIntyre DA & Harlander SK (1989) Improved electroporation efficiency of intact Lactococcus lactis subsp. lactis cells grown in defined media. Appl Environ Microb 55: 26212626.
  • Morona R, Yeadon J, Considine A, Morona JK & Manning PA (1991) Construction of plasmid vectors with a non-antibiotic selection system based on the Escherichia coli thyA+ gene: application to cholera vaccine development. Gene 107: 139144.
  • Norris MH, Kang Y, Lu D, Wilcox BA & Hoang TT (2009) Glyphosate resistance as a novel select-agent-compliant, non-antibiotic-selectable marker in chromosomal mutagenesis of the essential genes asd and dapB of Burkholderia pseudomallei. Appl Environ Microb 75: 60626075.
  • Periasamy S & Kolenbrander PE (2009) Aggregatibacter actinomycetemcomitans builds mutualistic biofilm communities with Fusobacterium nucleatum and Veillonella species in saliva. Infect Immun 77: 35423551.
  • Periasamy S & Kolenbrander PE (2010) Central role of the early colonizer Veillonella sp. in establishing multispecies biofilm communities with initial, middle, and late colonizers of enamel. J Bacteriol 192: 29652972.
  • Qi F & Ferretti J (2011) The streptococcus–veillonella community: how genome sequencing aids our understanding of interspecies interaction. Oral Microbial Communities: Genomic Inquiry and Interspecies Communication (KolenbranderPE, ed), ASM Press, Washington, DC, pp. 957972.
  • Rozkiewicz D, Daniluk T, Zaremba ML, Cylwik-Rokicka D, Luczaj-Cepowicz E, Milewska R, Marczuk-Kolada G & Stokowska W (2006) Bacterial composition in the supragingival plaques of children with and without dental caries. Adv Med Sci 51 (suppl 1): 182186.
  • Shima J, Hesketh A, Okamoto S, Kawamoto S & Ochi K (1996) Induction of actinorhodin production by rpsL (encoding ribosomal protein S12) mutations that confer streptomycin resistance in Streptomyces lividans and Streptomyces coelicolor A3(2). J Bacteriol 178: 72767284.
  • Socransky SS, Haffajee AD, Cugini MA, Smith C & Kent RL Jr (1998) Microbial complexes in subgingival plaque. J Clin Periodontol 25: 134144.
  • Strach M, Siedlar M, Kowalczyk D, Zembala M & Grodzicki T (2006) Sepsis caused by Veillonella parvula infection in a 17-year-old patient with X-linked agammaglobulinemia (Bruton's disease). J Clin Microbiol 44: 26552656.
  • Tanner A, Kent R, Maiden MF & Taubman MA (1996) Clinical, microbiological and immunological profile of healthy, gingivitis and putative active periodontal subjects. J Periodontal Res 31: 195204.
  • Valm AM, Welch JL, Rieken CW, Hasegawa Y, Sogin ML, Oldenbourg R, Dewhirst FE & Borisy GG (2011) Systems-level analysis of microbial community organization through combinatorial labeling and spectral imaging. P Natl Acad Sci USA 108: 41524157.
  • Vidal L, Pinsach J, Striedner G, Caminal G & Ferrer P (2008) Development of an antibiotic-free plasmid selection system based on glycine auxotrophy for recombinant protein overproduction in Escherichia coli. J Biotechnol 134: 127136.