Expression of tmRNA in mycobacteria is increased by antimicrobial agents that target the ribosome

Authors

  • Nadya Andini,

    1. Department of Pathology and Laboratory Medicine, Saban Research Institute of Children's Hospital Los Angeles, Los Angeles, CA, USA
    2. Department of Pathology, University of Southern California, Los Angeles, CA, USA
    Search for more papers by this author
  • Kevin A. Nash

    1. Department of Pathology and Laboratory Medicine, Saban Research Institute of Children's Hospital Los Angeles, Los Angeles, CA, USA
    2. Department of Pathology, University of Southern California, Los Angeles, CA, USA
    Search for more papers by this author

  • Editor: Rustam Aminov

Correspondence: Kevin A. Nash, Department of Pathology and Laboratory Medicine, Saban Research Institute of Children's Hospital Los Angeles, 4650 Sunset Blvd., Mailstop 103, Los Angeles, CA 90027, USA. Tel.: +1 323 361 5670; fax: +1 323 361 7989; e-mail: kanash@usc.edu

Abstract

The specialized RNA, tmRNA, is a central component of prokaryote trans-translation; a process that salvages stalled translational complexes. Evidence from other bacteria suggested that exposure to ribosome inhibitors elevated tmRNA levels, although it was unclear whether such changes resulted from increased tmRNA synthesis. Consequently, this study was initiated to determine the effect of ribosome inhibitors on the expression of tmRNA in mycobacteria. Exposure of Mycobacterium smegmatis to ribosome-targeting antimicrobial agents was associated with increased levels of the tmRNA precursor, pre-tmRNA, and mature tmRNA. For example, exposure to 16 μg mL−1 erythromycin for 3 h increased pre-tmRNA and tmRNA by 18- and 6-fold, respectively. Equivalent results were found following exposure of Mycobacterium bovis BCG to streptomycin. Exposure to antimicrobial agents with nonribosome targets did not affect tmRNA levels. The increased tmRNA levels were associated with increased output from the ssrA promoter, which controls tmRNA transcription, without evidence of a change in tmRNA degradation. These results suggest that the upregulation of tmRNA expression was an important response of bacteria to exposure to ribosome-inhibiting antimicrobial agents.

Introduction

Prokaryotes and some eukaryotic mitochondria possess a specialized process, trans-translation, which rescues ribosomes that have stalled during translation of a transcript. This process is the subject of several recent reviews (Moore & Sauer, 2007; Keiler, 2008). The ribosome states that can lead to the triggering of trans-translation include encountering a rare codon when the ribosome has to wait for a low abundance tRNA (Roche & Sauer, 1999) and when the end of a transcript is reached without an in-frame stop codon (Keiler et al., 1996). Rescue by trans-translation provides a stalled ribosome with an alternate coding region permitting normal termination of translation and dissociation of the translation complex.

Central to trans-translation is a specialized RNA species, tmRNA, which has properties comparable to both tRNA and mRNA (Komine et al., 1994; Ushida et al., 1994; Tu et al., 1995). The tRNA-like domain is aminoacylated by alanyl-tRNA synthetase (Komine et al., 1994; Barends et al., 2000) and the mRNA-like domain provides a short coding region with a stop codon; the amino acid sequence of this coding region tags polypeptides for rapid degradation by the ClpXP and ClpAP proteases (Sauer et al., 2004). The tmRNA molecule is transcribed from the ssrA gene as a precursor tmRNA (pre-tmRNA), which becomes processed at the 5′ and 3′ ends by RNases including RNase P and possibly RNase E (Lin-Chao et al., 1999; Withey & Friedman, 2003). The tmRNA binds to the protein SmpB (Karzai et al., 1999) and this complex is believed to be the unique functional unit of trans-translation.

Previous studies demonstrated that disrupting trans-translation increased susceptibility to protein synthesis inhibitors in Escherichia coli, Salmonella typhimurium, and Synechocystis sp. (de la Cruz & Vioque, 2001; Abo et al., 2002; Vioque & de la Cruz, 2003; Luidalepp et al., 2005). This suggested that trans-translation is important to bacteria for overcoming the effects of ribosome-targeting antimicrobial agents, although it was not clear whether ribosome inhibition by antimicrobial agents altered the rate of trans-translation. Evidence that such agents may affect trans-translation came from previous studies reporting that ribosome inhibitors caused an increase in the levels of tmRNA in Thermotoga maritima (Montero et al., 2006) and Streptomyces aureofaciens (Paleckova et al., 2006). However, these studies did not determine whether the changes in tmRNA levels were the result of decreased tmRNA degradation and/or increased synthesis. Therefore, this study was initiated to investigate the effect of ribosome inhibitors on the level of tmRNA in mycobacteria, and to determine whether any changes were associated with an increase in synthesis of this RNA molecule.

Materials and methods

Experimental organisms

The experimental organisms were Mycobacterium smegmatis ermKO4 (Nash, 2003) and Mycobacterium bovis BCG (Pasteur). The broth medium was 7HSF (Nash, 2003), a modified Middlebrook 7H9 broth supplemented with 10% oleic acid–albumin–dextrose–catalase (BD Diagnostic Systems, Sparks, MD). Drug susceptibility was by broth microdilution assay conforming to CLSI guidelines (CLSI, 2003).

Expression analysis

Extraction of mycobacterial RNA and real-time reverse transcriptase quantitative PCR (RT-qPCR) was as described elsewhere (Nash et al., 2005, 2009). The basic RT-qPCR reaction conditions were 50 °C for 10 min, then 95 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The primer combinations used are given in Table 1. The standard reference gene was sigA, and normalization was based on algorithms outlined by Vandesompele et al. (2002). The PCR efficiencies and amplification kinetics for each assay were normalized to a standard dilution series of genomic DNA.

Table 1.   Primer combinations used in this study
TargetSpecies*Upper primerLower primer
NameSequenceNameSequence
  • *

    M. smeg. - M. smegmatis; M.tb. - M. tuberculosis; NA - not applicable.

Pre-tmRNAM. smeg.SSRA-1GCCGATTCCAATCAGCGCGACTACSSRA-2GCATCCTGCGGCCCTTCTACTGGT
Mature tmRNAM. smeg.MSTSSRA-5TGCAGGCAAGAGACCACCGTAMSSSRA-6CCGGTCACACGAACAAGCCGAGA
Pre-tmRNAM.tb.MTSSRA-9ATCCGAGCAGAGGCATAGCGAACMTSSRA-11GCAAATGGGCCACCGACCTG
Mature tmRNAM.tb.MSTSSRA-5TGCAGGCAAGAGACCACCGTAMTSSRA-6CCGGTCACGCGAACTAGCCGAGA
ssrA promoterM. smeg.TMRNA-1bglGATGGAGATCTGAGGCGACCGAGGAAGCGATCATMRNA-2GATGGAGATCTGGCACCGGCGAACTCAAGCAG
sigAM. smeg.MSSIGA-1CGTCCGGCGACTTCGTGTMSSIGA-2CCTTGCCGATCTGCTTGAGGTA
sigAM.tb.MTSIGA-1GGGCATGGCGTTTCTCGACCTGMTSIGA-2CGGGTGATGGCCTGGCGAATC
23S rRNA geneGenericMS23-1CGAATGGCGTAACGACTTCTCAMS23-3GTAGTGAAGGTCCCGGGGTC
GFPNAGFP-10TGGAAGCGTTCAACTAGCAGACCATGFP-11CATCCATGCCATGTGTAATCCCAG
GFPNAGFP-1GGAGAAGAACTTTTCACTGGAGGFP-4TGTAGTTCCCGTCATCTTTG

Cloning of the ssrA gene promoter

Genomic DNA was amplified by PCR with primers TMRNA-1bgl and TMRNA-2 (Table 1), using Herculase II Fusion DNA polymerase (Stratagene). The resulting amplimer was restriction digested with BglI and BamHI and the 432-bp fragment ligated to the green fluorescent protein (GFP) reporter vector, pFPV27 (Barker et al., 1998). The resulting plasmid, pFPSSRA-1, was transformed to M. smegmatis ermKO4 by electroporation. An organism transformed with pFPV27 was used as a vector control.

Assessing RNA stability and Northern blot analysis

Organisms were grown to an OD600 nm of 0.1 and rifabutin added (final concentration 100 μg mL−1). RNA was isolated from samples taken at time 0 and up to 60 min after addition of the rifabutin. Stability of tmRNA was assessed by Northern blotting with nonradioactive probe detection by the Chemiluminescent Nucleic Acid Detection kit (Thermo Fisher Scientific, Rockford, IL). The tmRNA and 23S rRNA gene probes (biotinylated) were generated by PCR using primers MSSSRA-6/MSTSSRA-5 and MS23-1/MS23-3 (Table 1), respectively. Stability of GFP mRNA was assessed by real-time RT-qPCR using two sets of primers, GFP-10/GFP-11 and GFP-1/GFP-4 (Table 1). Real-time RT-qPCR has been used by others as a means of assessing RNA stability in mycobacteria (Sala et al., 2008).

Results

Effect of erythromycin on the level of pre-tmRNA

The level of tmRNA was assessed by targeting pre-tmRNA and total tmRNA (Fig. 1). Preliminary experiments indicated that pre-tmRNA represented <5% of total tmRNA (data not shown); thus, total tmRNA was considered indicative of mature tmRNA (henceforth referred to as ‘tmRNA’). As pre-tmRNA represented the initial ssrA gene transcript, it was expected to be the most sensitive measure of tmRNA synthesis.

Figure 1.

 Diagram showing the locations of the primers (arrowheads) for amplifying the pre-tmRNA and total tmRNA encoded by the ssrA genes of Mycobacterium smegmatis and Mycobacterium bovis BCG.

The level of pre-tmRNA was monitored for up to 4 h in M. smegmatis after addition of erythromycin at concentrations spanning the minimum inhibitory concentration (MIC) of 4 μg mL−1 (Fig. 2a). Incubation with erythromycin resulted in increased pre-tmRNA levels reaching a steady-state level after 1–2 h. At steady state, the change in pre-tmRNA level correlated significantly (R2=0.93, P<0.05) with erythromycin concentration. As pre-tmRNA levels remained in a steady state up to 4 h, a 3-h sampling time was chosen for future experiments.

Figure 2.

 (a) Changes in the level of pre-tmRNA in Mycobacterium smegmatis relative to baseline (time 0) after addition of erythromycin at 2 μg mL−1 (triangle), 4 μg mL−1 (diamond), 8 μg mL−1 (inverted triangle), and 16 μg mL−1 (square). The no-drug control (circle) contained 0.3% methanol, equivalent solvency to the highest erythromycin concentration. (b) Changes in the level of pre-tmRNA in M. smegmatis relative to baseline after 3-h exposure to erythromycin at concentrations between 2 and 64 μg mL−1. (c) Changes in the level of pre-tmRNA in M. smegmatis relative to baseline (time 0) after 3-h exposure to erythromycin at 8 μg mL−1 (ERY), clarithromycin at 0.25 μg mL−1 (CLR), chloramphenicol at 1 μg mL−1 (CHL), streptomycin at 0.25 μg mL−1 (STR), tetracycline at 1 μg mL−1 (TET), ampicillin at 16 μg mL−1 (AMP), ethambutol at 0.5 μg mL−1 (EMB), isoniazid 16 μg mL−1 (INH), ofloxacin at 0.25 μg mL−1 (OFX), and rifabutin at 0.25 μg mL−1 (RBT).

Extending the erythromycin concentration range up to 64 μg mL−1 demonstrated that the pre-tmRNA expression showed a significant dose response with erythromycin concentrations between 2 and 32 μg mL−1 (Fig. 2b), with a correlation coefficient of 0.99 (P<0.001), as demonstrated in previous analyses. A peak increase in pre-tmRNA expression (31-fold) was found in 32 μg mL−1 erythromycin, i.e. eight times the MIC. The apparent increase in pre-tmRNA level was not caused by a significant decrease in the level of the reference gene, sigA. Normalized to total RNA and to 23S rRNA gene, the levels of sigA mRNA after a 3-h exposure to 2 and 16 μg mL−1 erythromycin were, respectively, 92 ± 5% and 93 ± 4% of control cells incubated without erythromycin (P=0.8).

Induction of pre-tmRNA by other antimicrobial agents

To investigate whether other antimicrobial agents affected tmRNA, changes in pre-tmRNA levels were assessed after 3-h incubation in selected agents at three concentrations spanning their respective MIC. Figure 2c shows the relative pre-tmRNA levels associated with each agent at its MIC. Like erythromycin, other agents that target the ribosome (clarithromycin, streptomycin, chloramphenicol, and tetracycline) increased pre-tmRNA levels. In contrast, cell wall synthesis inhibitors (ampicillin, ethambutol, and isoniazid) and other agents with nonribosome targets (rifabutin and ofloxacin) did not increase pre-tmRNA levels at their MIC (Fig. 2c) or twofold above and below MIC (data not shown). These results indicate that inhibition of the ribosome was important for the induction of pre-tmRNA, rather than a general stress response to antimicrobial agents.

Effect of erythromycin on the level of mature tmRNA

To compare the changes in pre-tmRNA with concomitant changes in tmRNA, the levels of the two tmRNA species were assessed in the same RNA preparations, which were isolated from organisms exposed to erythromycin at 4, 8, and 16 μg mL−1 for up to 3 h (Fig. 3a). Pre-tmRNA was affected by exposure to erythromycin in a manner similar to that described above; by 3 h, the RNA levels had increased 11-, 18-, and 23-fold in 4, 8, and 16 μg mL−1 erythromycin, respectively. Erythromycin also raised the level of tmRNA (Fig. 3a); at 3 h, tmRNA levels had increased 6-, 6-, and 12-fold in 4, 8, and 16 μg mL−1 erythromycin, respectively. Thus, overall the erythromycin-induced changes in pre-tmRNA were more rapid and by 3 h showed a significantly greater magnitude of change compared with tmRNA for each drug concentration (P<0.05). These results were consistent with our initial assumption that pre-tmRNA levels would be a more sensitive measure than tmRNA levels for changes in tmRNA expression. However, the absolute levels of tmRNA were at least an order of magnitude higher than the corresponding levels of pre-tmRNA. The ratio of tmRNA : pre-tmRNA was 38 : 1 before the addition of erythromycin. A comparison of tmRNA with rRNA demonstrated that mature tmRNA levels were 7.2 ± 0.5% of 23S rRNA gene levels, increasing to 32.8 ± 5.6% following 3-h incubation in 16 μg mL−1 erythromycin. Thus, mature tmRNA was one of the most abundant non-rRNA RNA species in M. smegmatis.

Figure 3.

 (a) Effect of erythromycin at 4 μg mL−1 (diamond), 8 μg mL−1 (inverted triangle), and 16 μg mL−1 (square) at the level of total tmRNA (open symbols) and pre-tmRNA (closed symbols) in Mycobacterium smegmatis relative to baseline (time 0). (b) Northern blot analysis of total RNA isolated from organisms at baseline (T0) and after 3-h incubation with 0 and 2 μg mL−1 erythromycin (E0 and E2). The order of the lanes (left to right) is T0, E0, and E2. The probes were specific for tmRNA and 23S rRNA gene. (c) The columns represent the change in expression relative to baseline, normalized to 23S rRNA gene, derived from the blot shown in (b).

Increased levels of pre-tmRNA and tmRNA were also found in M. bovis BCG (a representative of the Mycobacterium tuberculosis complex) incubated for 24 h in the presence of streptomycin (Supporting Information, Fig. S1).

To rule out the possibility that the real-time RT-qPCR analysis biased the analysis of tmRNA levels, RNA samples were also analyzed by Northern blot (Fig. 3b); these RNA preparations had not previously been tested by real-time RT-qPCR. From the Northern blot analysis, exposure to 2 μg mL−1 erythromycin increased tmRNA levels 2.3-fold (Fig. 3c); this correlated exactly with the 2.3 ± 0.2-fold increase determined by RT-qPCR analysis. Thus, real-time RT-qPCR analysis was deemed equivalent to Northern analysis.

ssrA promoter activity and the effect of erythromycin

The results described above suggested that the mycobacterial ssrA promoter (which drives tmRNA synthesis) was upregulated in the presence of ribosome inhibitors. However, the changes in tmRNA levels could be explained by changes in the rate of tmRNA degradation. Following inhibition of RNA synthesis with 100 μg mL−1 rifabutin, the mature tmRNA half-life was 50 min, which did not change following 3-h exposure to 16 μg mL−1 erythromycin (slopes and intercepts of degradation vs. time lines were not significantly different; P=0.6). Thus, exposure to erythromycin did not lead to a change in tmRNA degradation.

The activity of the ssrA promoter was assessed using plasmid pFPSSRA-1, which carried this promoter driving expression of GFP as a transcriptional reporter. The cloned DNA spanned from 254 bp upstream from the ssrA gene (141 bp into the upstream gene, dmpA) through the first 178 bp of the ssrA gene. Mycobacterium smegmatis FPSSRA-1 (i.e. carrying plasmid pFPSSRA-1) showed constitutive high-level GFP fluorescence, which increased approximately twofold when the organisms were grown in the presence of 2 μg mL−1 erythromycin. This was consistent with the ssrA promoter being constitutively active and inducible with macrolides. However, as erythromycin inhibits protein synthesis, it was felt that using GFP fluorescence would underestimate promoter activity. To validate the assumption that GFP mRNA levels represented the output of the ssrA promoter and not the accumulation of a stable transcript, the rate of degradation of this mRNA species was determined in M. smegmatis FPSSRA-1. The half-life of the GFP mRNA was deemed to be 2.5 min, i.e. sufficiently rapid to justify using this RNA species as the measure of ssrA promoter activity.

The effect of erythromycin on the levels of GFP mRNA, pre-tmRNA, and tmRNA in M. smegmatis FPSSRA-1 was assessed in two independent experiments, which gave equivalent results. Representative data from one experiment are shown in Table 2. The marginal change in GFP mRNA and pre-tmRNA between the baseline and 3-h zero-erythromycin samples was similar to the previously observed fluctuations in pre-tmRNA levels in cells under normal culture conditions (Fig. 2a). The levels of GFP mRNA, pre-tmRNA, and tmRNA increased after 3-h exposure to erythromycin, with the largest relative change being in the pre-tmRNA levels (consistent with previous experiments). Although the erythromycin-associated changes in GFP mRNA levels relative to baseline (time 0) were greater than the changes in tmRNA relative to the 3-h zero-erythromycin samples, the changes in the two RNA species were equivalent; for example 6.8- and 6.6-fold increase in 16 μg mL−1 erythromycin for GFP mRNA and tmRNA, respectively. This indicated that the changes in ssrA promoter output were equivalent to the changes in tmRNA.

Table 2.   Effect of erythromycin on expression of GFP mRNA (as reporter for the ssrA promoter), pre-tmRNA, and tmRNA in Mycobacterium smegmatis carrying plasmid pFPSSRA-1*
Erythromycin concentration (μg mL−1)Relative expressionAbsolute expression§
GFPpre-tmRNAtmRNAGFPpre-tmRNAtmRNA
  • *

    Plasmid pFPSSRA-1 carries the ssrA promoter driving expression of a GFP reporter gene.

  • Bacteria incubated for 3 h in 0, 2, and 16 μg mL−1 erythromycin; baseline sample taken at time 0.

  • Relative expression is the change in RNA levels relative to baseline (time 0).

  • §

    Absolute expression is the number of target molecules per sigA mRNA molecule (sigA was the internal reference gene). The GFP RNA levels are corrected for the mean pFPSSRA-1 plasmid copy number of 4.9 per genome.

Baseline1.0 ± 0.11.0 ± 0.11.0 ± 0.133.6 ± 2.30.35 ± 0.0417.6 ± 0.51
01.6 ± 0.11.7 ± 0.30.9 ± 0.153.4 ± 2.60.59 ± 0.0916.0 ± 1.4
27.0 ± 0.16.5 ± 0.33.5 ± 0.1237.8 ± 4.82.3 ± 0.1562.1 ± 2.4
1610.7 ± 0.418.3 ± 1.76.2 ± 0.4361.0 ± 1.46.4 ± 0.53109.1 ± 5.9

Further evidence that the ssrA promoter output could account for the drug-associated changes in tmRNA came from the finding that the absolute levels of GFP mRNA and tmRNA were of the same order of magnitude. Moreover, tmRNA and GFP mRNA levels were at least an order of magnitude higher than levels of pre-tmRNA; the mean ratio of tmRNA : pre-tmRNA was 39 : 1 in the absence of erythromycin (equivalent to previous experiments). These results indicated that the ssrA promoter was highly active constitutively and showed increased activity in the presence of erythromycin. The magnitude of the promoter output appeared sufficient to account for the increased in tmRNA levels following exposure to erythromycin.

Although the results were consistent with an increased synthesis of tmRNA in the presence of erythromycin, the ratio GFP mRNA : tmRNA was 1 : 0.3 in the 3-h samples, irrespective of erythromycin exposure. This suggested that erythromycin did not lead to an increase in rate of tmRNA loss, a result consistent with the lack of effect of erythromycin on tmRNA half-life described previously.

Discussion

Increased tmRNA levels were described previously for other bacteria exposed to antimicrobial agents. Montero et al. (2006) reported that chloramphenicol increased tmRNA levels up to 40-fold in the extremophile T. maritima, and Paleckova et al. (2006) reported that streptomycin increased tmRNA levels by 2.6-fold in S. aureofaciens. However, it was not clear from these studies whether the increased tmRNA levels were the result of increased tmRNA synthesis or of a reduction in tmRNA degradation, or both. Consistent with these studies, M. smegmatis and M. bovis BCG showed elevated tmRNA levels following exposure to ribosome-inhibiting antimicrobial agents. Moreover, in mycobacteria, the increased tmRNA levels were associated with an increase in ssrA promoter activity, and hence, an increase in tmRNA synthesis without a change in the rate of tmRNA degradation.

Although only the protein synthesis inhibitors resulted in increased tmRNA expression, a study by Luidalepp et al. (2005) indicated that disruption of trans-translation increased susceptibility to inhibitors of cell wall synthesis as well as to ribosome inhibitors. It was speculated that this reflected an impaired stress response in the trans-translation-deficient organism. However, the lack of a change in tmRNA expression in mycobacteria exposed to cell wall synthesis inhibitors suggested that any stress response elicited by these agents in mycobacteria did not include trans-translation.

The observed changes in tmRNA expression following ribosome inhibition with antimicrobial agents conflict somewhat with the findings of Moore & Sauer (2005), who reported that an increased requirement for trans-translation did not increase expression of tmRNA in E. coli. This suggested that bacteria have a significant tmRNA-SmpB reserve capacity. However, there was a key difference between the Moore & Sauer (2005) study and the antimicrobial agents studies presented here and elsewhere (Montero et al., 2006; Paleckova et al., 2006). In the Moore & Sauer (2005) study, an increase in trans-translation was directly, and canonically, triggered by overexpression of a transcript lacking a stop codon. In the other studies, the primary effect of the antimicrobial agents was inhibition of ribosome function, most likely including inhibition of trans-translation. This suggested that the changes in tmRNA expression following exposure to ribosome inhibitors may not have been in response to increased trans-translation.

Although ribosome inhibitors, such as erythromycin, cause ribosome stalling (Rogers et al., 1990; Min et al., 2008), there is evidence that the state of the ribosome is fundamentally different to the stalling associated with triggering of trans-translation. For instance, tRNA is believed to still be able to access the A-site of ribosomes inhibited by agents such as aminoglycosides and macrolides (Walsh, 2003), although the A-site is believed to be vacant when trans-translation is triggered canonically (Moore & Sauer, 2007). Furthermore, there is evidence that translation complexes inhibited by macrolides can dissociate (suggested by the release of peptidyl-tRNA) in the absence of trans-translation (Tenson et al., 2003). Triggering of trans-translation may occur as an indirect effect of drug-associated ribosome dysfunction. For example, aminoglycosides and macrolides can cause translation errors such as frameshifts and stop codon readthrough (Martin et al., 1989; Schroeder et al., 2000; Thompson et al., 2004), which could lead to ribosomes reaching the end of a transcript without encountering a translation termination signal. Another possibility is that ribosome stalling during translation may lead to increased degradation of the transcript; translation does provide some protection from degradation to mRNA (Carrier & Keasling, 1997). Furthermore, there is evidence that transcripts can be cleaved within the A-site of paused or stalled ribosome (Hayes & Sauer, 2003) and such cleavage may lead to the triggering of trans-translation (Moore & Sauer, 2007). Thus, the role of trans-translation in reducing the effects of antimicrobial agents may relate more to overcoming the consequences of translational errors and truncated mRNA than to the stalled state caused by direct ribosome inhibition.

As well as exposure to antimicrobial agents, there are several reports indicating that tmRNA levels can increase under other conditions. For instance, increased levels of tmRNA correlated with G1–S transition in the cell cycle in Caulobacter crescentus (Keiler & Shapiro, 2003; Hong et al., 2005) and in response to heat or chemical stress in Bacillus subtilis (Muto et al., 2000). In the former study (Keiler & Shapiro, 2003), the changing level of tmRNA was believed to be critical to the timing of the cell cycle.

In bacteria, mature tmRNA is one of the most abundant RNA species. tmRNA levels in M. smegmatis are equivalent to those reported for E. coli (Lee et al., 1978; Moore & Sauer, 2005). The abundance of tmRNA is a likely consequence of a high rate of trans-translation; for instance, approximately 0.4% of translation reactions in E. coli are terminated by trans-translation (Moore & Sauer, 2005). The abundance of tmRNA is also likely a consequence of its stability, which is believed to result from its binding to SmpB (Keiler et al., 2000; Moore & Sauer, 2005) and it is assumed that the majority of mature tmRNA and SmpB is in complex (Keiler, 2008). The half-life of mycobacterial tmRNA under conditions inhibiting RNA synthesis was similar to that reported for Caulobacter sp. swarmer cells and E. coli (Keiler & Shapiro, 2003).

The stability of mycobacterial tmRNA was somewhat paradoxical in light of the high level of ssrA promoter activity indicated by the results presented here. However, a previous study of the ssrA promoter of C. crescentus also indicated that it was one of the most active promoters even under conditions where tmRNA was highly stable (Keiler & Shapiro, 2003). Irrespective of whether high-level ssrA promoter activity maintains tmRNA levels in the absence of ribosome inhibition, the evidence indicated that drug-associated increased levels of tmRNA were the result of increased promoter activity. This interpretation was supported not only by the promoter analysis but also by the finding that tmRNA loss was not affected by the drug exposure.

The results presented here indicate that ribosome inhibitors, such as erythromycin, increase the synthesis of tmRNA in mycobacteria and thus provide an underlying mechanism for the increased levels of tmRNA following exposure to such agents. The change in ssrA promoter activity suggested that the increased synthesis and levels of tmRNA were an adaptive response to ribosome inhibition. Clearly, this expands on previous studies on the effect of ribosome inhibitors on tmRNA levels in other bacteria (Montero et al., 2006; Paleckova et al., 2006). To our knowledge, this is the first direct study of tmRNA in mycobacteria.

Acknowledgements

Funding for this study was provided by National Institutes of Health (NIH)/National Institute of Allergy and Infectious Diseases (NIAID) grant RO1-AI052291 and the Department of Pathology and Laboratory Medicine, Children's Hospital Los Angeles.

Ancillary