SEARCH

SEARCH BY CITATION

Keywords:

  • SOF;
  • Streptococcus dysgalactiae;
  • fish

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Lancefield group C Streptococcus dysgalactiae (GCSD) is known as a causative agent of bovine mastitis and cardiopulmonary diseases in humans. Recently, GCSD has been isolated from diseased fish in Japan. Almost all culture supernatants and sodium dodecyl sulfate extracts obtained from GCSD isolated from farmed fish possessed serum opacity activity. Serum opacity factor (SOF) is a bifunctional cell-associated protein that causes serum opacification. In this study, a gene coding SOF, which was named sof-FD, was identified from GCSD isolated from fish. The amino acid sequence of sof-FD showed 40.1–46.5% identity to those of other SOFs from mammalian strains of S. dysgalactiae and Streptococcus pyogenes. Repetitive fibronectin binding domains were also observed in sof-FD, the structures of which were similar to those of other SOFs, as previously reported. The amino acid sequence of SOF was identical among fish isolates. A primer set targeting the sof-FD gene was designed and applied to a PCR assay for discriminating fish isolates from mammalian isolates.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Lancefield group C Streptococcus dysgalactiae ssp. dysgalactiae (GCSD) has been reported as a causative agent of mastitis in cattle, endocarditis in domestic animals and cardiopulmonary diseases or adenoiditis in humans (Efstratiou et al., 1994). GCSD has also been isolated from farmed amberjack (Seriola dumerili) and yellowtail (Seriola quinqueradiata) in Japan (Nomoto et al., 2004, 2006). Fsh GCSD infection is characterized by pericarditis and severe necrotic lesions in the caudal peduncle (Hagiwara et al., 2010). A previous study indicated that fish isolates were genetically close to each other and that clonal expansion had occurred, and also that these were different from mammalian isolates in genetic and biochemical properties (Nishiki et al., 2010). Although this fish pathogen has been studied epidemiologically, its virulence factors have received little attention.

In a previous study, two distinct fibronectin binding proteins, FnBA and FnBB, were identified in S. dysgalactiae strain S2 isolated from bovine mastitis (Lindgren et al., 1993). FnBA was reported to characteristically possess serum opacification activity (Courtney et al., 1999). Serum opacification activity has been observed in other streptococci, such as Streptococcus pyogenes and S. suis (Ward & Rudd, 1938; Baums et al., 2006). Serum opacity factor (SOF) is a bifunctional protein consisting of highly conserved C-terminal repetitive sequences, and the N-terminal serum opacification domain (Rakonjac et al., 1995; Courtney et al., 2002). SOF caused S. pyogenes to invade and adhere to cells, and was demonstrated to be a virulence determinant of S. pyogenes using a murine infection model (Timmer et al., 2006; Gillen et al., 2008). The repetitive C-terminal fibronectin-binding domains and high similarity in part of the N-terminal domain between serum opacity genes were observed in FnBA of S. dysgalactiae strain S2 and several SOFs from S. pyogenes strains (Courtney et al., 1999; Katerov et al., 2000). Although many variable sequences of sof genes exist in S. pyogenes, only a few genes coding SOF were reported to exist in S. dysgalactiae isolates from mammals.

GCSD isolated from fish also possesses serum opacification activity. However, the gene encoding activity has been not identified. The aim of this study was to identify the sof gene, named sof-FD, and to determine its distribution in GCSD isolated from farmed fish. The designed oligonucleotides targeting sof-FD were applied to a PCR assay to discriminate between fish GCSD and mammalian S. dysgalactiae.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains

A total of 316 GCSD strains, isolated from farmed fish (amberjack, 276; yellowtail, 40) between 2002 and 2008 in Japan, were used to detect SOF. Streptococcus dysgalactiae isolated from pigs (= 17) diagnosed with endocarditis in the Kumamoto Prefectural Meat Inspection Office was used as the source of mammalian isolates. Lancefield streptococcal grouping (Lancefield, 1933) was performed for these isolates using a Pastorex Strep test (Bio-Rad, Marnes-la-Coquette, France). The fish and mammalian isolates were identified using a PCR assay targeting the 16S–23S rRNA spacer region (Forsman et al., 1997; Hassan et al., 2003). Streptococcus dysgalactiae ssp. dysgalactiae ATCC 43078 and S. dysgalactiae ssp. equisimilis ATCC 35666 were used as reference strains. All the isolates were cultured on Todd-Hewitt (TH) agar (Difco, Sparks, MD) at 37 °C for 24 h.

Detection of serum opacification activity

Serum opacification activity was detected using the microtitre plate method (Johnson & Kaplan, 1988) with minor modifications. Bacterial strains were cultured in TH broth at 37 °C for 24 h. The supernatants or 0.5% (sodium dodecyl sulfate) SDS extracts of bacterial cells were filtered using a 0.45-μm filter (Sartorius Stedim Japan K. K., Japan). Fish serum was obtained from healthy amberjacks (average weight 1250 g, = 15). Briefly, fish were anaesthetized using FA-100 (Tanabe Pharma, Osaka, Japan), then bled from the caudal peduncle. After clotting of blood, the serum was separated by centrifugation for 20 min at 5000 g. The serum was then pooled and filtered using a 0.45-μm filter. Ten microlitres of culture supernatant or SDS extract was added to 100 μL of the fish serum. Subsequently, the mixture was incubated at 37 °C for 24 h. Serum opacification was determined on the basis of OD measured using a microplate reader at 405 nm. When the OD value exceeded 0.1 compared with control (TH broth with serum, 0.5% SDS with serum), opacification activity was considered to be positive. Horse, pig, cow (GIBCO/Invitrogen, USA) and human sera (TaKaRa Bio, Inc., Japan) were also used for opacification tests with culture supernatant of fish isolate 12-06 as described above. To visualize opacification activity, 5 μL of cell cultures adjusted to an OD660 of 1.0 from strain 12-06 was dropped onto TH agar containing 10% of fish, horse, pig, cow or human sera, then incubated at 37 °C for 24 h. All used sera were heat-inactivated at 55 °C for 30 min.

Cloning and sequencing of the sof-FD gene

Genomic DNA from the representative fish isolate 12-06 was used in this study (Nomoto et al., 2004, 2006; Nishiki et al., 2010). DNA techniques were performed as described previously (Nishiki et al., 2010). Table 1 lists the primers used in this study. PCR amplification of the sof-FD gene was performed using degenerate primers SOF-d1 and SOF-d2, which were designed on the basis of several sof genes and fnbA (accession number Z22150). The PCR products amplified with SOF-d1 and SOF-d2 were then extended by 5′- and 3′-rapid amplification of cDNA ends (RACE) PCR with the primer sets RACE SOF-fd1 and RACE SOF-fd2. The RACE-PCR was performed using the SMART RACE cDNA amplification kit according to the manufacture's protocol (TaKaRa Bio). The entire sof-FD gene was amplified, and subsequently TA-cloning and sequencing were performed as described previously (Nomoto et al., 2008). The amino acid sequence of sof-FD was analysed using bioedit version 7.0 (Hall, 1999) with the reference sequences of other SOFs obtained from GenBank. The signal peptide and structural domains were predicted using the signalp program (http://www.cbs.dtu.dk/services/SignalP/) and the simple modular architecture research tool (smart) version 4.0 (http://www.smart.enblheidelbergde/).

Table 1. PCR primers used in this study
PrimerSequence (5′–3′)
SOF-d1GGMGTWGATTTACARGGWGC
SOF-d2CTGCMGCTCCAATAAYWGTTA
RACE SOF-fd1GCCAGAAAGAAACGTTCAGCAGCCACG
RACE SOF-fd2TGGTTGAGGAACCTCGTTTGCCAGA
SOF-OFD1GCCGCATATGGTTTCTCAGCAACCTCAA
SOF-OFD2GCCGCTCGAGGCAGTTGATTGACTGTAT
SOF-fish1AGAAAGCAGTGAAGTACCTC
SOF-fish2TCTTGACCATCTGACATGGC

Expression and purification of recombinant proteins

To construct a recombinant plasmid, primer sets SOF-OFD1 and SOF-OFD2 were designed to contain an opacification domain referring to SOF2 (AAC32596) obtained from S. pyogenes (Courtney et al., 1999). The amplified product was then ligated into the pBAD TOPO vector system (Invitrogen Japan K. K., Japan) and transformed into Escherichia coli TOP10 following the manufacturer's protocols. The recombinant protein, amino acid residues 115–780 of sof-FD is referred to as rSOF-OFD. Expression of His-tagged rSOF-OFD was induced following the manufacturer's protocol. The lysates of the recombinant E. coli TOP10 were purified by His Trap affinity columns (GE Healthcare) according to the user's manual. The purified His-tagged rSOF-OFD was separated using SDS-polyacrylamide gel electrophoresis (PAGE) and detected by Western blotting using anti-His (Ctem) AP (Invitrogen).

Serum agar overlay method

The opacity factor activity of rSOF-OFD was confirmed by the serum agar overlay method. The purified rSOF-OFD was loaded by native-PAGE or SDS–PAGE, and the gel was overlaid to 0.5% agarose containing the fish serum at a final concentration of 50%. After incubating at 37 °C for 72 h, the opacification activity was determined as opaque bands.

PCR assay targeting the sof-FD opacification domain

Sixteen fish isolates having different genotypes, which were defined by biased sinusoidal field gel electrophoresis analysis, were selected as test strains (Nishiki et al., 2010). These fish isolates and mammalian isolates (= 19), including S. dysgalactiae ssp. dysgalactiae and S. dysgalactiae ssp. equisimilis, were used for the PCR assay. The primers SOF-fish1 and SOF-fish2 were designed to discriminate fish isolates from mammalian isolates. The amplification conditions were 95 °C for 3 min, 30 cycles of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s, and finally 72 °C for 10 min. The PCR products were confirmed by electrophoresis on a 1% agarose gel containing ethidium bromide.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Detection of SOF

Table 2 shows the results of tests for opacification activity. Almost all of the fish isolates showed serum opacification activity in both culture supernatants and SDS extracts. Courtney et al. (1999) reported that serum opacification activity of S. dysgalactiae S2 obtained from mastitis was sufficient in SDS extracts but insufficient in culture supernatants. In the present study, culture supernatants obtained from 314 of 316 fish isolates possessed opacification activity with various OD values (0.1–0.6). Two strains were considered to be SOF-negative. Although the fish isolates used in this study were obtained from diseased fish in different fish farms and years, almost all of the fish isolates possessed SOF activity against fish serum. For a comparison of opacification activity, opacified circles on agar plates containing each serum are shown in Fig. 1. Culture supernatant of fish isolate 12-06 showed strong activity with amberjack serum compared with other mammalian sera. The opaque circle on fish serum agar plate was wider than on other serum agar plates.

image

Figure 1. (a) Opacification activity in culture supernatant of strain 12-06 against fish (amberjack), horse, pig, cow and human serum. Mean values with standard deviations of five separate experiments are shown. (b) Opacification activities of fish strain 12-06 on agar plates containing 10% fish (amberjack), horse, pig, cow or human serum.

Download figure to PowerPoint

Table 2. Distribution of serum opacification activity in GCSD isolates
 Positive reaction to the opacification activity
Culture supernatantSDS-extract
  1. ND, not done.

Fish isolates314/316314/316
Mammalian isolates
S. dysgalactiae ssp. dysgalactiaeND12/13
S. dysgalactiae ssp. equisimilisND4/6

Sequencing of sof-FD and other SOFs

The gene coding sof-FD was determined by 5′ and 3′ RACE PCR. Sequences of the sof-FD gene and its putative amino acids were registered in GenBank with accession number AB627015. Figure 2 shows the amino acid sequences of FnBA (CAA80121) from S. dysgalactiae strain S2, SOF (EFY3765) from S. dysgalactiae strain ATCC 27957, SOFVT3.1 (AAK52966) from an S. pyogenes strain and OFS obtained from an S. suis strain. The level of identity between SOF sequences was 45.9% between sof-FD and FnBA (CAA80121), 46.5% between sof-FD and SOF ATCC 27957 (EFY3765), 40.1% between sof-FD and SOFVT3.1 (AAK52966), and 25.0% between sof-FD and OFS (AAX56334). The signal sequences (1–32 residues), fibronectin binding repeats (767–930), and LPXTG Gram-positive anchor motif (951–955) were also conserved in SOF from fish GCSD.

image

Figure 2. ClustalW alignment of amino acid sequences of SOF-FD (BAK19916) in fish Streptococcus dysgalactiae 12-06, FnBA (CAA80121) in S. dysgalactiae S2, SOFATCC 27957 (EFY3765) in S. dysgalactiae, SOFVT3.1 (AAK52966) in S. pyogenes, and OFS (AAX56334) in S. suis. Identical residues are shaded and written with white letters. The putative signal sequence (1–32 residues), fibronectin binding repeats (767–930) and LPXTG Gram-positive anchor motif (951–955) of SOF-FD are shown by black arrows.

Download figure to PowerPoint

Detection of the serum opacification activity of rSOF-OFD

To determine the opacification activity of sof-FD and rSOF-OFD, the opacification domain of sof-FD was expressed in E. coli TOP10. The recombinant E. coli TOP10 lysates showed opacification activity in the fish serum. Figure 3 shows the results obtained by Western blotting using the His antibody and serum agar overlay method for purified rSOF-OFD. An immune-stained band at c. 70 kDa was observed. Meanwhile, the serum overlay agar with a native PAGE gel showed an opaque band at c. 150 kDa. When an SDS-PAGE gel was used on agarose containing fish serum, the opaque band was not observed.

image

Figure 3. (a) Native-PAGE gel serum agar overlay method and (b) Western-blotting analysis with anti-His tag. Lanes 1 and 4 are lysates of Escherichia coli TOP10 transformed by the pBAD vector as negative control. Lanes 2 and 3 are lysates of E. coli TOP10 transformed by pBAD (rSOF-OFD).

Download figure to PowerPoint

PCR assay targeting the sof-FD opacification domain

To discriminate between the mammalian and fish isolates, a primer set for PCR targeting the sof-FD gene was determined. Although bands of c. 400 bp were observed in the 16 fish isolates with different genotypes, no bands were observed in the mammalian isolates (Fig. 4). One of the two fish isolates lacking SOF activity was PCR-positive. This could be due to a putative insertion sequence into the sof-FD gene (data not shown). However, another SOF-negative strain did not harbour the sof-FD gene when other primers targeting other regions of the sof-FD gene were used.

image

Figure 4. The PCR products of GCSD strains using a fish isolate-specific primer set, SOF-fish1 and SOF-fish2. Lane M, 100-bp ladder DNA; lanes 1–16, fish isolates; lanes 17–33, clinical isolates from mammals; 34, reference strain Streptococcus dysgalactiae ssp. dysgalactiaeATCC 43078; 35, reference strain S. dysgalactiae ssp. equisimilisATCC 35666.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Beall et al. (2000) and Goodfellow et al. (2000) reported that about half of clinical isolates of S. pyogenes possessed the sof gene and opacification activity. In the present study, almost all of the fish isolates showed serum opacification activity in both culture supernatants and SDS extracts. Moreover, the PCR assay targeting the sof-FD gene showed high sequence identity. This study also determined sequences of the entire sof-FD gene from fish isolates with varying degrees of opacification activity (OD660 = 0.1–0.6). The determined sequences included entire SOF-FD amino acid sequences with 100% identity to each other. These results suggested the clonal expansion and homogeneity of S. dysgalactiae isolated from farmed fish in Japan (Nishiki et al., 2010). Further studies are in progress to reveal the mechanism of variations in the SOF activity in fish GCSD isolates.

Recently, GCSD was isolated from blood culture of a patient who had handled raw fish, and the characteristics of the GCSD were the same as those of isolates from farmed fish in Japan (Koh et al., 2008). To discriminate between fish and mammalian isolates is important to protect the public from the potential threat of zoonosis. The primer set targeting the sof-FD gene discriminated between mammalian and fish isolates. However, at least one PCR-negative strain was determined in this study and such PCR-negative strains could increase in future. A previous study demonstrated that PCR targeting the sodA gene was able to discriminate between mammalian and fish isolates (Nomoto et al., 2008). Because there were only a few nucleotide differences in the sodA gene between mammalian and fish isolates, the PCR assay could be used to discriminate between fish and mammalian isolates under strict annealing conditions. Therefore, it is possible that nonspecific reactions occurred. For more reliable discrimination between mammalian and fish isolates, both primer sets targeting sodA and sof-FD could be applied.

In general, opacification activity was evaluated using horse serum (Rakonjac et al., 1995; Courtney et al., 1999; Gillen et al., 2002). We also investigated serum opacification using sera obtained from other sources (horse, pig, cow and human). In the culture supernatants of fish isolates, the strongest reaction was observed when fish serum was used as the substrate. In the opacity reaction, SOF targeted high-density lipoprotein (HDL) particles as the substrate (Courtney et al., 2006). Therefore, the turbidity, which may be attributed to the number of HDL particles, was higher in fish serum than in other sera.

Previous studies demonstrated that when the serum agar overlay method using SDS–PAGE was adopted, an opaque band appeared on the serum agar (Rakonjac et al., 1995; Courtney et al., 1999; Gillen et al., 2002). The present study was able to detect no band on the serum agar with SDS-PAGE. Sufficient SOF activity of rSOF-OFD could be determined even if the rSOF-OFD sample was heated for 5 min at 100 °C. Meanwhile, addition of SDS to the sample solution apparently attenuated the opacification reaction in fish serum (data not shown). Labile apoA-1 of HDL has been shown to be required for the opacification reaction in serum (Han et al., 2009). In this study, although we have not determined whether SDS is acting directly on SOF or on fish HDL, it is possible that SDS affects apoA-1 of fish HDL and then prevents the opacification reaction. In addition, apoA-1 of fish HDL could be more labile and sensitive to SDS than that of human or other mammals. The expected size of the immune stained band detected by the Western blotting with the anti-His tag was approximately half that of the opaque band detected by the serum agar overlay method with a native-PAGE gel. Previous studies reported that the molecular mass of recombinant SOF was much larger than predicted and might be responsible for a dimer of SOF (Courtney et al., 1999; Katerov et al., 2000). Therefore, rSOF-OFD may also form a dimer, and the SDS disassociated the rSOF-OFD molecules. Further studies are in preparation to investigate the different molecular sizes.

The serum opacification activity in S. dysgalactiae has been reported only in strain S2 isolated from bovine (Courtney et al., 1999). In this study, a novel variation of the sof gene, sof-FD, and the SOF activity of GCSD strains isolated from farmed fish were determined. SOF was demonstrated to be a virulence determinant of S. pyogenes and S. suis (Baums et al., 2006; Timmer et al., 2006; Gillen et al., 2008). However, the role of SOF-FD in GCSD isolates was not clear. Further studies on SOF-FD may elucidate the mechanism of the virulence determinant in fish isolates.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Culture and Sports, Japan (21580229).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Baums CG, Kaim U, Fulde M, Ramachandran G, Goethe R & Valentin-Weigand P (2006) Identification of a novel virulence determinant with serum opacification activity in Streptococcus suis. Infect Immun 74: 61546162.
  • Beall B, Gherardi G, Lovgren M, Facklam RR, Forwick BA & Tyrrell GJ (2000) emm and sof gene sequence variation in relation to serological typing of opacity-factor-positive group A streptococci. Microbiology 146: 11951209.
  • Courtney HS, Hasty DL, Li Y, Chiang HC, Thacker JL & Dale JB (1999) Serum opacity factor is a major fibronectin-binding protein and a virulence determinant of M type 2 Streptococcus pyogenes. Mol Microbiol 32: 8998.
  • Courtney HS, Dale JB & Hasty DL (2002) Mapping the fibrinogen-binding domain of serum opacity factor of group A streptococci. Curr Microbiol 44: 236240.
  • Courtney HS, Zhang YM, Frank MW & Rock CO (2006) Serum opacity factor, a streptococcal virulence factor that binds to apolipoprpteins A-I and A-II and disrupts high density lipoprotein structure. J Biol Chem 281: 55155521.
  • Efstratiou A, Colman G, Hahn G, Timoney JF, Boeufgras JM & Monget D (1994) Biochemical differences among human and animal streptococci of Lancefield group C or group G. J Med Microbiol 41: 145148.
  • Forsman P, Tilsala-Timisjarvi A & Alatossava T (1997) Identification of staphylococcal and streptococcal causes of bovine mastitis using 16S–23S rRNA spacer regions. Microbiology 143: 34913500.
  • Gillen CM, Towers RJ, McMillan DJ et al. (2002) Immunologjcal response mounted by Aboriginal Australia against Streptococcus pyogenes serum opacity factor. Microbiology 148: 169178.
  • Gillen CM, Courtney HS, Schulze K et al. (2008) Opacity factor activity and epithelial cell binding by the serum opacity factor protein of Streptococcus pyogenes are functionally discrete. J Biol Chem 283: 63596366.
  • Goodfellow AM, Hibble M, Talay SR, Kreikemeyer B, Currie BJ, Sriprakash KS & Chhatwal GS (2000) Distribution and antigenicity of fibronectin binding proteins (SfbI and SfbII) of Streptococcus pyogenes clinical isolates from the northern territory, Australia. J Clin Microbiol 38: 389392.
  • Hagiwara H, Takano R, Nogushi M & Narita M (2010) Lesions induced in Seriola dumerili following exposure to Streptococcus dysgalactiae by oral treatment or immersion. J Comp Pathol 143: 262267.
  • Hall TA (1999) Bioedit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 9598.
  • Han M, Gillard BK, Courtney HS, Ward K, Rosales C, Khant H, Ludtke SJ & Pownall HJ (2009) Disruption of human plasma high density lipoproteins by streptococcal serum opacity factor requires labile apolipoprotein A-1. Biochemistry 48: 14811487.
  • Hassan AA, Khan IU & Lammler C (2003) Identification of Streptococcus dysgalactiae strains of Lancefield's group C, G and L by polymerase chain reaction. J Vet Med B Infect Dis Vet Public Health 50: 161165.
  • Johnson DR & Kaplan EL (1988) Microtechnique for serum opacity factor characterization of group A streptococci adaptable to the use of human sera. J Clin Microbiol 26: 20252030.
  • Katerov V, Lindgren PE, Totolian AA & Schalen C (2000) Streptococcal opacity factor: a family of bifunctional proteins with lipoproteinase and fibronectin-binding activities. Curr Microbiol 40: 149156.
  • Koh TH, Sng L-H, Yuen SM, Thomas CK, Tan PL, Tan SH & Wong NS (2008) Streptococcal cellulitis following preparation of fresh raw seafood. Zoonoses Public Health 56: 206208.
  • Lancefield RC (1933) A serological differentiation of human and other groups of hemolytic streptococci. J Exp Med 57: 571595.
  • Lindgren PE, McGavin MJ, Signas C, Guss B, Gurusiddappa S, Hook M & Lindberg M (1993) Two different genes coding for fibronectin-binding proteins from Streptococcus dysgalactiae. The complete nucleotide sequences and characterization of the binding domains. Eur J Biochem 214: 819827.
  • Nishiki I, Noda M, Itami T & Yoshida T (2010) Homogeneity of Streptococcus dysgalactiae from farmed amberjack Seriola dumerili in Japan. Fish Sci 76: 661668.
  • Nomoto R, Munasinghe LI, Jin DH et al. (2004) Lancefield group C Streptococcus dysgalactiae infection responsible for fish mortalities in Japan. J Fish Dis 27: 679686.
  • Nomoto R, Unose N, Shimahara Y et al. (2006) Characterization of Lancefield group C Streptococcus dysgalactiae isolated from farmed fish. J Fish Dis 29: 673682.
  • Nomoto R, Kagawa H & Yoshida T (2008) Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae ssp. dysgalactiae isolated from farmed fish. Lett Appl Microbiol 46: 95100.
  • Rakonjac JV, Robbins JC & Fischetti VA (1995) DNA sequence of the serum opacity factor of group A streptococci: identification of a fibronectin-binding repeat domain. Infect Immun 63: 622631.
  • Timmer AM, Kristian SA, Datta V et al. (2006) Serum opacity factor promotes group A streptococcal epithelial cell invasion and virulence. Mol Microbiol 62: 1525.
  • Ward HK & Rudd GV (1938) Studies on haemolytic streptococci from human sources. Aust J Exp Biol Med Sci 16: 181192.