SEARCH

SEARCH BY CITATION

Keywords:

  • rhamnolipids;
  • secretion stress;
  • cell envelope stress;
  • two-component system;
  • ECF σ factor

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

Rhamnolipids are biosurfactants produced by the soil bacterium Pseudomonas aeruginosa. In addition to their high industrial potential as surface-active molecules, rhamnolipids also have antimicrobial properties. In densely populated habitats, such as the soil, production of antimicrobial compounds is important to inhibit growth of competitors. For the latter, it is crucial for survival to sense and respond to the presence of those antibiotics. To gain a first insight into the biological competition involving biosurfactants, we investigated the cellular response of the model organism Bacillus subtilis upon exposure to rhamnolipids by genome-wide transcriptional profiling. Most of the differentially expressed genes can be assigned to two different regulatory networks: the cell envelope stress response mediated by the two-component system LiaRS and the extracytoplasmic function σ factor σM and the CssRS-dependent secretion stress response. Subsequent phenotypic analysis demonstrated a protective function of LiaRS and σM against cell lysis caused by rhamnolipids. Taken together, we present the first evidence that a single antimicrobial compound can simultaneously induce genes from two independent stress stimulons.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

The soil is a complex habitat characterized by high population density and nutrient limitation. To survive in such a competitive environment, bacteria developed a number of different strategies. One such strategy is the production of antimicrobial compounds to inhibit growth of competitors (Paul & Clark, 1996; Tate, 2000). In addition to classical antibiotics that target essential structures or processes within the bacterial cell, antimicrobial activities, often based on biophysical effects, can also be assigned to ionophores, ion-channel forming agents or biosurfactants (Berdy, 2005).

Biosurfactants are surface-active molecules synthesized by microorganisms. They consist of a hydrophilic and a hydrophobic part and are able to reduce surface tension and enhance the emulsification of hydrocarbons. Biosurfactants are commercially used for bioremediation processes as well as the pharmaceutical, cosmetics, and food industries (Banat et al., 2000). Rhamnolipids are biosurfactants produced by the soil bacterium Pseudomonas aeruginosa. These surface-active molecules are glycolipids composed of one or two l-rhamnose moieties and one or two β-hydroxydecanoic acid residues (Soberon-Chavez et al., 2005). The synthesis from rhamnose and fatty acid precursors is catalyzed by the products of three genes, rhlABC, and regulated in a cell density-dependent manner by quorum sensing. The amount and composition of synthesized rhamnolipids depends on growth conditions and available carbon source (Soberon-Chavez et al., 2005).

Rhamnolipids have been shown to exhibit antimicrobial activity against Gram-positive bacteria and, but to a much lesser extent, also against Gram-negative species (Itoh et al., 1971; Lang et al., 1989). They modify the cell surface by increasing its hydrophobicity and membrane permeability (Vasileva-Tonkova et al., 2011). Although the production of rhamnolipids by P. aeruginosa is well understood (Soberon-Chavez et al., 2005), only little is known about the physiological reaction to the presence of this biosurfactant.

The response to antimicrobial compounds that interfere with the cell envelope integrity has been extensively studied in the model organism Bacillus subtilis. Here, the regulatory network of the cell envelope stress response is mediated by two regulatory principles: two-component systems (TCS) and extracytoplasmic function (ECF) σ factors. Four TCS (BceRS, LiaRS, PsdRS and YxdJK) and at least three ECF σ factors (σM, σW and σX) have been described to respond to cell wall antibiotics, such as vancomycin, bacitracin, or cationic antimicrobial peptides (Jordan et al., 2008). Bacillus subtilis inhabits the same environment as the rhamnolipid-producing species P. aeruginosa. Therefore, we decided to investigate the response of B. subtilis to rhamnolipids by genome-wide DNA microarray analysis followed by hierarchical clustering of differentially expressed genes and phenotypic characterization to gain a first insight into this interspecies competition.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

Bacterial strains and growth conditions

Bacillus subtilis and Escherichia coli were routinely grown in LB medium at 37 °C with aeration. All strains and plasmids used in this study are listed in Table 1. Standard cloning techniques were applied (Sambrook & Russell, 2001) and transformation was carried out as described (Harwood & Cutting, 1990). Ampicillin (100 μg mL−1) was used for selection of E. coli, kanamycin (10 μg mL−1) and erythromycin (1 μg mL−1) plus lincomycin (25 μg mL−1) for macrolide-lincosamide-streptogramin B (MLS) resistance were used for selection of B. subtilis mutants. Rhamnolipids were isolated from P. aeruginosa as a mixture of mono- and di-rhamnolipid (Müller et al., 2010), dissolved in ethanol and used at the indicated concentrations. All experiments were performed with rhamnolipids from the same purification, as the composition and biological activity varies between different cultivations of P. aeruginosa (R. Hausmann, pers. commun.).

Table 1. Strains, vectors, and plasmids used in this study
StrainGenotype or characteristic(s)aReference, source or construction
  1. chrom. DNA, chromosomal DNA.

  2. a

    Resistance cassettes: kan, kanamycin; MLS, macrolide-lincosamide-streptogramin B; spec, spectinomycin.

E. coli strains
DH5αrecA1 endA1 gyrA96 thi hsdR17rK- mK+relA1 supE44 Φ80ΔlacZΔM15 Δ(lacZYA-argF)U169Laboratory stock
B. subtilis strains
W168Wild type, trpC2Laboratory stock
TMB149W168 sigW::MLSLFH-PCR[RIGHTWARDS ARROW]W168
TMB329W168 ΔliaFWolf et al. (2010)
TMB589W168 ΔliaRpMAD-based clean deletion
TMB1003W168 sigM::kanHB0829 chrom. DNA[RIGHTWARDS ARROW]W168
TMB1070W168 cssRS::kanLFH-PCR[RIGHTWARDS ARROW]W168
TMB1392W168 ΔliaR sigM::kan sigW::MLSHB0829 chrom. DNA[RIGHTWARDS ARROW]TMB589
TMB1393W168 sigM::kan sigW::MLSHB0829 chrom. DNA[RIGHTWARDS ARROW]TMB1003
HB0829NCIB3610 sigM::kan sigW::MLSMascher et al. (2007)
Vectors or plasmids
pMADbgaB, ermC, bla, MCSArnaud et al. (2004)
pDG780pBluescriptKS+ kan, source of resistance cassette for LFH-PCRGuerout-Fleury et al. (1995)
pDG647pSB119, MLS, source of resistance cassette for LFH-PCRGuerout-Fleury et al. (1995)
pDW104pMAD ΔliaRThis study

Preparation of total RNA

Bacillus subtilis W168 was grown aerobically in LB medium at 37 °C until an OD600 nm of c. 0.5. The culture was split and one sample was induced with sublethal concentrations (50 μg mL−1) of rhamnolipids, leaving the other sample as uninduced control. After 10 min, 30 mL culture were mixed with 15 mL cold killing buffer (20 mM Tris–HCl, pH 7.0, 0.5 mM MgCl2, 20 mM NaN3), harvested by centrifugation and frozen in liquid nitrogen, before the pellets were stored at −80 °C. Total RNA was isolated as described previously (Wolf et al., 2010). Contaminating DNA was removed using the RNase-free DNase kit (Qiagen) and quality control of the RNA was performed with an RNA 6000 Nano LabChip Kit (Agilent Technologies) on an Agilent 2100 Bioanalyzer according to the manufacturer's instructions.

DNA microarray analysis

RNA samples from three independent cultivations were used for cDNA synthesis and hybridized with dye-swap to Agilent custom DNA microarrays. Synthesis of fluorescently labeled cDNA, hybridization and scanning of the microarrays were performed as described previously (Otto et al., 2010). Data were extracted and processed using the feature extraction software (version 10.5; Agilent Technologies). For each gene on the microarray, the error-weighted average of the log ratio values of the individual probes was calculated using the rosetta resolver software (version 7.2.1; Rosetta Biosoftware). The complete dataset containing induction ratios for all genes is available at http://www.syntheticmicrobe.bio.lmu.de/publications/supplemental/index.html.

Measurement of induction by quantitative real-time RT-PCR

Measurement of transcript abundance was performed in duplicate by quantitative real-time RT-PCR using the QuantiFast SYBR Green RT-PCR Kit (Qiagen) according to the manufacturer's protocol, with minor modifications. In brief, 100 ng of DNA-free RNA were used in a total reaction volume of 20 μL with 0.3 μM of each primer (Table 2). The reaction was carried out in a MyiQ Cycler (BioRad). Expression of rpsJ and rpsE was monitored as constitutive reference. Relative induction levels were calculated as fold changes using the formula: Fold change = inline image; with −ΔΔCt = (Ct,gene x − Ct,constitutive gene)condition I − (Ct,gene x − Ct,constitutive gene)condition II (Talaat et al., 2002).

Table 2. Oligonucleotides used in this study
NrNameSequence
  1. Restriction sites for cloning are highlighted in bold, linker regions for joining reactions are underlined.

Real-time RT-PCR
0125liaH-RT fwdTGAAACAGCACACGATTGCC
0126liaH-RT revGTTTGCCTGTTCATAGGAAGC
1890cssR-RT fwdTGGATTCTCGATATCATGCTG
1891cssR-RT revTAGTCATTGCTGCCAATCTC
1886htrA-RT fwdAACGAGGATTCGGATGGTTC
1887htrA-RT revTGTAACAGATTGCGTTTGCTG
1888htrB-RT fwdGCCTTATCTGCCGTCAGAC
1889htrB-RT revATTCCGACAATCGTAGGCTC
0826sigM-RT fwdGTTTACAGGTTCCTGCTCTC
0827sigM-RT revATGAAGGCGTTTCGCGCCA
0156rpsJ-RT fwdGAAACGGCAAAACGTTCTGG
0157rpsJ-RT revGTGTTGGGTTCACAATGTCG
0158rpsE-RT fwdGCGTCGTATTGACCCAAGC
0159rpsE-RT revTACCAGTACCGAATCCTACG
LFH-PCR
0342sigW up fwdCCGAGAAGTTCAGGGCAAGCC
0343sigW up revCCTATCACCTCAAATGGTTCGCTGCGATGTCCGCAAATGCATCC
0344sigW do fwdCGAGCGCCTACGAGGAATTTGTATCGCGGATTCACAGAGGCAGAGAGC
0345sigW do revGCTGAACCGCTTTCGTGCC
1793cssR up fwdTTTCACTTTCTGAGCTGGAG
1794cssR up revCCTATCACCTCAAATGGTTCGCTGTTCATTCAGGTTATCCTCATC
1795cssS do fwdCGAGCGCCTACGAGGAATTTGTATCGGGTGTATCATACCGCATAGC
1796cssS do revATTGAGACGGCTTCACAGTG
0137kan fwdCAGCGAACCATTTGAGGTGATAGG
0138kan revCGATACAAATTCCTCGTAGGCGCTCGG
0139mls fwdCAGCGAACCATTTGAGGTGATAGGGATCCTTTAACTCTGGCAACCCTC
0140mls revCGATACAAATTCCTCGTAGGCGCTCGGGCCGACTGCGCAAAAGACATAATCG
0147kan check revCTGCCTCCTCATCCTCTTCATCC
0056kan check fwdCATCCGCAACTGTCCATACTCTG
0148mls check revGTTTTGGTCGTAGAGCACACGG
0057mls check fwdCCTTAAAACATGCAGGAATTGACG
ΔliaR deletion mutant
1060liaR up fwd (BamHI)AGCCGGATCCGACAACGGGAATCAGCCTGC
1120liaR up revCGAGATGATTTCGGTGTGCGCTGACCATTTCATGATCATC
1059liaR do fwdCGCACACCGAAATCATCTCG
1061liaR do rev (NcoI)TATACCATGGGCTGACACAGCAAATTCTCG

Hierarchical clustering analysis

Clustering was performed using the program cluster 3.0 (de Hoon et al., 2004). Transcriptome data were derived from this work or published studies (Cao et al., 2002a; Mascher et al., 2003; Lulko et al., 2007; Wecke et al., 2009). The datasets represent the following conditions: 50 μg mL−1 rhamnolipids (10 min), 1 μg mL−1 daptomycin (10 min), 1 μg mL−1 friulimicin (10 min), 2 μg mL−1 vancomycin (10 min), 100 μg mL−1 bacitracin (5 min) and secretion stress caused by overexpression of the α-amylase AmyQ. For reasons of clarity, cluster analysis was restricted to genes induced ≥threefold and repressed ≥fivefold by rhamnolipids.

Allelic replacement mutagenesis using long-flanking homology PCR

The long-flanking homology (LFH) PCR is derived from a published procedure (Wach, 1996) and performed as previously described (Mascher et al., 2003). In brief, resistance cassettes were amplified from suitable vectors as template (Guerout-Fleury et al., 1995). About 1000-bp DNA fragments flanking the region to be deleted were amplified by PCR using chromosomal DNA of B. subtilis W168 as template. These fragments are here called up- and do-fragments. The up-reverse and do-forward primers carry c. 25-bp nucleotides complementary to the sequence of the resistance cassettes. All obtained fragments were purified and used as template in a second PCR with the corresponding up-forward and do-reverse primers. The PCR products were directly used to transform B. subtilis W168. Transformants were screened by colony PCR using the up-forward and do-reverse primers with check primers annealing within the resistance cassette. Integrity of the regions flanking the resistance cassette was verified by sequencing of PCR products. The resulting strains are listed in Table 1, the oligonucleotides in Table 2.

Construction of a markerless ΔliaR deletion mutant

A markerless ΔliaR deletion strain was constructed using the vector pMAD (Arnaud et al., 2004) and the oligonucleotides listed in Table 2. The procedure has been described previously (Wolf et al., 2010). In brief, about 1000-bp regions upstream and downstream of liaR were amplified using PCR, thereby introducing a 20-bp extension to the 3′-end of the up-fragment, which is complementary to the 5′-end of the do-fragment. The fragments were fused by a second PCR and the resulting product was cloned into pMAD, generating pDW104. Bacillus subtilis W168 was transformed with pDW104 and incubated at 30 °C with MLS selection on LB agar plates containing 100 μg mL−1 X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside). Blue colonies were selected and incubated for 6–8 h at 42 °C in LB medium with MLS selection, which results in the integration of the plasmid into the chromosome. Again, blue colonies were selected and incubated for 6 h at 30 °C in LB medium without selection. Subsequently, the culture was shifted to 42 °C for 3 h, before the cells were plated on LB agar plates without selection. White colonies were picked and checked for MLS sensitivity, indicating the loss of the plasmid. Those harboring a clean deletion of liaR were identified using PCR.

Concentration-dependent lysis curve experiments

Bacillus subtilis wild-type and mutant strains were inoculated from fresh overnight cultures and grown aerobically in LB medium until an OD600 nm of c. 0.5. The cultures were split into 1 mL samples and different concentrations of rhamnolipids were added. The effect of rhamnolipids on cell density of each sample was monitored over a period of 7 h.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

The transcriptional response to rhamnolipids

Genome-wide expression profiling is a powerful approach to characterize the response to a certain stimulus, such as the presence of antimicrobial compounds. It has also been used to gain insights into inhibitory mechanisms and to differentiate between different modes of action of novel antibiotics (Hutter et al., 2004; Fischer & Freiberg, 2007; Wecke et al., 2009). We used genome-wide DNA microarray analysis to investigate the response of the model organism B. subtilis to the presence of rhamnolipids, which have been shown to affect cell envelope integrity (Vasileva-Tonkova et al., 2011). B. subtilis was treated with sublethal concentrations (50 μg mL−1) of rhamnolipids, which is sufficient to induce a transcriptional response, but does not impair growth of the culture, as can be demonstrated by concentration-dependent lysis curve experiments (see below and Fig. 3). After 10 min of induction, total RNA was prepared and DNA microarray analysis performed. Expression of 40 loci was ≥fivefold increased by rhamnolipids compared with the mRNA levels of an uninduced culture (Table 3 and Fig. 1a). Almost half of these loci can be assigned to known regulons of TCS or ECF σ factors. The most strongly induced locus was the liaIHGFSR operon (c. 640-fold), which is autoregulated by the LiaRS TCS (Mascher et al., 2004). The first two genes of this locus, liaIH, represent the main targets of LiaRS-dependent signal transduction and liaH encodes a phage-shock protein homolog. The LiaRS TCS is activated by cell wall antibiotics, especially lipid II-interacting compounds, but it does not mediate resistance against most of its inducers (Mascher et al., 2004; Wolf et al., 2010). Strong expression of the lia locus also resulted in significant read-through transcription of the downstream located gerAAABAC operon, which has been observed previously for both B. subtilis and Bacillus licheniformis (Mascher et al., 2003; Wecke et al., 2006).

image

Figure 1. The transcriptional response to rhamnolipids. (a) Scatter plot of DNA microarray analysis. The average signal intensities for each gene are shown from cells induced with 50 μg mL−1 rhamnolipids for 10 min (y-axis) and uninduced control (x-axis). The pyr operon (▲), pstSCABABB (Δ), des (●) and genes regulated by LiaRS (□), CssRS (♦) and σM (■) are highlighted; all other genes are represented as gray squares. (b) Verification of the transcriptome data by real-time RT-PCR. Real-time RT-PCR was performed as described in 'Materials and methods' with the same RNA as used for DNA microarray analysis. Induction ratios for each gene were calculated based on the uninduced control, as described previously (Talaat et al., 2002). Each value is the average of two microarray hybridizations or real-time RT-PCR experiments, the error bar indicating the standard deviation.

Download figure to PowerPoint

Table 3. Genes significantly induced or repressed by rhamnolipids
Gene(s)aFold changesbRegulatorscHomology, (putative) function, remarks
  1. a

    Only genes that were induced or repressed ≥fivefold on average are listed.

  2. b

    Highest induction ratios for each locus (usually the first gene in an operon) and the corresponding standard deviation are given.

  3. c

    Assignment of regulators is based on (Turner et al., 1994; Qi et al., 1997; Huang & Helmann, 1998; Huang et al., 1999; Aguilar et al., 2001; Hyyryläinen et al., 2001; Wiegert et al., 2001; Cao et al., 2002a,b; Darmon et al., 2002; Cao & Helmann, 2004; Zellmeier et al., 2005; Jordan et al., 2006; Eiamphungporn & Helmann, 2008).

Genes induced ≥fivefold
liaIHGFSR640 ± 501LiaRSPhage-shock protein homolog, TCS, unknown
htrA58 ± 15CssRSSerine protease
htrB26 ± 6.6CssRSSerine protease
yuxN13 ± 4.5 Putative transcriptional regulator, TetR family
yqjL11 ± 1.2σMPutative hydrolase
pbpE-racX11 ± 5.2σWPenicillin binding protein 4, amino acid racemase
yhaSTU10 ± 4.4 Potassium efflux K+/H+ antiporter
yxeI9.4 ± 2.2 Similar to penicillin amidase
yraA8.6 ± 3.5 Similar to general stress protein
yuaE8.2 ± 2.8 Hypothetical protein with DUF1569 domain
yrhHIJ8.0 ± 3.5σM, σX, σVPutative methyltransferase, transcriptional regulator, and reductase
sigM-yhdLK7.8 ± 1.3σMECF σ factor
yebC7.8 ± 1.4σMPutative membrane protein
ybfO7.7 ± 3.3σWSimilar to erythromycin esterase
ylbP7.4 ± 2.1 Putative acetyltransferase, GNAT family
phoA7.2 ± 3.8 Alkaline phosphatase A
bcrC7.2 ± 2.7σV, σM, σW, σXUndecaprenyl pyrophosphate phosphatase
gabD7.1 ± 2.7 Succinate-semialdehyde dehydrogenase
ywrO7.0 ± 2.5 Similar to NAD(P)H oxidoreductase
ydaH6.9 ± 2.4σMPutative membrane protein with DUF2837 domain
opuCABCD6.8 ± 4.8 Osmoprotection
ypbGH6.7 ± 1.4σMPutative phosphoesterase and MecA paralog
yceB6.5 ± 2.8 Putative monooxygenase
yvrD6.5 ± 1.1 Similar to ketoacyl-carrier protein reductase
ywaC6.4 ± 2.8σW, σM, σVSimilar to GTP-pyrophosphokinase
yqjG6.2 ± 1.7 Similar to lipoprotein SpoIIIJ-like
yheCDE6.0 ± 1.1 Spore coat proteins
yhjN5.9 ± 0.8 Putative membrane-anchored ammonia monooxygenase
dhaS5.8 ± 1.4 Aldehyde dehydrogenase
yfjR5.8 ± 2.8 Similar to 3-hydroxyisobutyrate dehydrogenase
radC5.5 ± 1.8σMDNA repair protein
yvgP5.5 ± 0.9 Monovalent cation/H+ antiporter NhaK
trxA5.4 ± 1.2 Thioredoxin, putative monooxygenase
nfrA-ywcH5.2 ± 1.2 NADPH-linked nitro/flavin reductase, similar to monooxygenase
gerAABC5.2 ± 2.2 Germination, downstream of liaIHGFSR
ypuA5.2 ± 0.9σM, σVProtein of unknown function with DUF1002 domain
ywnJ5.2 ± 1.5σM, σW, σXPutative VanZ-like membrane protein
yrbC5.1 ± 2.5 Uncharacterized conserved protein with DUF28 domain
ycgJ5.0 ± 1.6 Putative methyltransferase
yfiBC5.0 ± 1.4 Similar to ABC transporter
Genes repressed ≥fivefold
cydABCD0.19 ± 0.09 Cytochrome bd ubiquinol oxidase
rbsRKDACB0.19 ± 0.07 Ribose transport
yuaJ0.19 ± 0.07 Putative thiamine transporter
yonPO0.18 ± 0.07 Hypothetical proteins (prophage SPβ)
narGHJI0.18 ± 0.05 Nitrate reductase
mtbP0.17 ± 0.06 Modification methylase
pur operon0.17 ± 0.08 Purine biosynthesis
yxaI0.17 ± 0.08 Putative membrane protein
yolJ0.15 ± 0.06 Similar to glycosyltransferase
xylAB0.13 ± 0.02 Xylose metabolism
sboAXablA-G0.13 ± 0.03 Bacteriocin subtilosin A
bdbA0.12 ± 0.06 Thiol-disulfide oxidoreductase
pyr operon0.07 ± 0.06PyrRPyrimidine biosynthesis
pstSCABABB0.07 ± 0.03PhoPRPhosphate ABC transporter
des0.06 ± 0.04DesKRFatty acid desaturase

The genes htrA (c. 60-fold) and htrB (c. 25-fold), both encoding serine proteases, were also strongly induced by rhamnolipids (Table 3 and Fig. 1a). Expression of both genes is controlled by the TCS CssRS, which is activated by heat and secretion stress. Expression of cssRS itself was not induced by rhamnolipids, similar to the effect of heat stress, although moderately increased expression of this operon can be observed under secretion stress conditions caused by overexpression of the secretory protein α-amylase (Darmon et al., 2002; Hyyryläinen et al., 2005).

Almost one-third of the remaining ≥fivefold induced loci represent target genes of ECF σ factors, predominantly σM, with its own autoregulated operon sigM-yhdLK being approximately eightfold induced (Table 3 and Fig. 1a). As a result of a previously described regulatory overlap between different ECF σ factors of B. subtilis (Qiu & Helmann, 2001; Mascher et al., 2007), expression of some genes, such as bcrC and ywaC, can be regulated by more than one ECF σ factor. But the autoregulated loci of the remaining six ECF σ factors of B. subtilis were not significantly induced (≤threefold), indicating that the ECF response to rhamnolipids is mediated mainly by σM. This ECF σ factor is activated by cell wall antibiotics like vancomycin, bacitracin, and phosphomycin, but also under acid, salt, and heat stress conditions (Cao et al., 2002ab; Mascher et al., 2003; Thackray & Moir, 2003).

Other genes significantly induced by rhamnolipids cannot be assigned to known cell envelope stress regulons. They often encode proteins of unknown function or proteins presumably involved in metabolic and redox processes (e.g. gabD encoding a succinate-semialdehyde dehydrogenase or trxA encoding thioredoxin).

We verified the main findings of our DNA microarray analysis, in particular the activation of the TCS LiaRS and CssRS as well as σM, independently by real-time RT-PCR and basically obtained the same results, albeit with an overall higher induction ratio (Fig. 1b). Such discrepancy was observed in numerous studies before and is attributed to the overall lower dynamic range of DNA microarrays compared with other methods such as real-time RT-PCR (Conway & Schoolnik, 2003; Pappas et al., 2004).

Treatment with rhamnolipids also led to decreased expression of a certain set of genes (Fig. 1a and Table 3). Among the ≥fivefold repressed loci are genes encoding proteins involved in purine and pyrimidine biosynthesis (pyr and pur operon), phosphate transport (pstSCABABB) and sugar metabolism (rbsRKDACB, xylAB) (Table 2). Differential expression of the pyr operon in response to cell envelope stress has been observed previously for B. licheniformis (Wecke et al., 2006).

With almost 20-fold repression, the most strongly downregulated gene is des, which encodes a fatty acid desaturase (Aguilar et al., 1998). Expression of des is controlled by the TCS DesRK and induced by cold shock. The desaturase is important for maintaining membrane fluidity at low temperature by introducing double bonds in phospholipids (Aguilar et al., 2001), indicating that rhamnolipid treatment at sublethal concentrations could interfere with membrane fluidity.

Hierarchical clustering analysis of genes differentially expressed in response to rhamnolipids

Our DNA microarray analysis clearly indicates that rhamnolipids induce both the cell envelope and the secretion stress response. To further validate this novel induction pattern, we performed hierarchical clustering analysis using transcriptome data of B. subtilis induced with different cell wall antibiotics (vancomycin, bacitracin, daptomycin and friulimicin) and exposed to secretion stress. For reason of clarity, we limited our analysis to genes induced ≥threefold and repressed ≥fivefold by rhamnolipids.

Genes controlled by the same regulator form discrete clusters based on their expression pattern under different stress conditions (Fig. 2a). Genes belonging to the cell envelope stress response of B. subtilis are grouped in three clusters and can be assigned to two regulators, σM and the LiaRS TCS (Fig. 2b). They are induced by cell wall antibiotics and rhamnolipids, but not by secretion stress (with the exception of liaH). One of these three clusters contains the target operon of the LiaRS TCS as well as the downstream genes gerAAAB. The other two clusters include mostly target genes of σM. Noteworthy, within the σM regulon, there is a subset of genes, including the mreBCDminCD operon involved in cell division, that is not induced by vancomycin (upper part of σM1 cluster in Fig. 2b). Differences in the induction profiles of subsets of σM-dependent genes have been observed previously (Eiamphungporn & Helmann, 2008).

image

Figure 2. Hierarchical clustering analysis of genes differentially expressed in response to rhamnolipids. The clustering analysis was performed using the software Cluster 3.0 (de Hoon et al., 2004). Transcriptome data for Bacillus subtilis treated with friulimicin (fri), vancomycin (van), rhamnolipids (rha), bacitracin (bac), daptomycin (dap) and exposed to secretion stress (sec) caused by overexpression of α-amylase were analyzed (see 'Materials and methods' for details). Green indicates induction of the corresponding gene, red repression under the designated condition. Cluster analysis was limited to genes induced ≥threefold and repressed ≥fivefold by rhamnolipids (a). Cluster containing target genes of σM, LiaRS and CssRS (b) and genes repressed by rhamnolipids (c) are shown in detail. A schematic representation of the network orchestrating the response to rhamnolipids summarizes the results of the cluster analysis (d). The thickness of the arrows corresponds to the induction of the given regulators. Sec, secretion stress; Rha, rhamnolipids; Ces, cell envelope stress.

Download figure to PowerPoint

image

Figure 3. Growth of Bacillus subtilis wild-type and mutant strains exposed to different concentrations of rhamnolipids. Bacillus subtilis wild type (W168), TMB1070 (cssRS::kan), TMB589 (ΔliaR), TMB329 (ΔliaF), TMB1003 (sigM::kan), TMB149 (sigW::MLS), TMB1393 (sigM::kan sigW::MLS) and TMB1392 (ΔliaRsigM::kan sigW::MLS) were grown in LB medium to mid-logarithmic growth phase. The cultures were split into 1 mL samples and induced with increasing concentrations of rhamnolipids: 0 μg mL−1 (■), 50 μg mL−1 (□), 100 μg mL−1 (▲), 200 μg mL−1 (Δ) and 300 μg mL−1 (♦). Cell density was monitored by measuring OD600 nm over a time period of 7 h.

Download figure to PowerPoint

Genes mediating the secretion stress response also cluster together (Fig. 2b). The CssRS-dependent target genes htrA and htrB are not only induced by secretion stress and rhamnolipids, but also weakly by vancomycin and bacitracin.

Genes repressed by rhamnolipids show almost unchanged expression under the other conditions tested (Fig. 2c). One exception is the pyr operon, which is strongly repressed by rhamnolipids, but weakly induced by friulimicin and vancomycin.

Taken together, the hierarchical clustering analysis indicates that rhamnolipids induce a combination of two different stress responses: the cell envelope stress response represented by the LiaRS TCS and the ECF σ factor σM, and the heat and secretion stress response mediated by CssRS. Simultaneous induction of the LiaRS TCS and σM is common for cell wall antibiotics such as daptomycin, vancomycin, or bacitracin (Mascher et al., 2003; Hachmann et al., 2009; Wecke et al., 2009). But none of the σM-dependent target genes is induced by secretion stress, while both the CssRS and LiaRS TCS are induced by cell wall antibiotics, rhamnolipids, and secretion stress, but with different intensities (Fig. 2d).

The LiaRS TCS and σM protect cells from rhamnolipid-dependent lysis

Bacteria use signal transducing systems to detect harmful compounds and alter gene expression to protect the cell. We hypothesize that the signal transducing systems activated by rhamnolipids confer resistance and counteract cell damage caused by this antimicrobial compound. Therefore, we compared the growth behavior of B. subtilis wild-type cultures exposed to different rhamnolipid concentrations with strains carrying gene deletions leading to ‘ON’ or ‘OFF’ states of the induced signal transducing systems, which results either in no or constitutively high expression of the corresponding target genes. The strains were grown in LB medium to mid-logarithmic growth phase, the cultures were split and different concentrations of rhamnolipids were added. Subsequent lysis of each sample was monitored by measuring OD600 nm.

For the B. subtilis wild-type strain W168, a concentration of 50 μg mL−1 rhamnolipids did not affect growth (Fig. 3), but was sufficient to induce a transcriptional response as investigated using DNA microarray analysis (Fig. 1a and Table 3). Higher concentrations of rhamnolipids lead to rapid lysis of the culture within 1 h after addition (Fig. 3). Remarkably, even after severe lysis the cultures resumed growth.

To reveal a possible protective function of the LiaRS TCS, we compared the lysis in response to rhamnolipids of two strains carrying deletions in the lia locus: deletion of the response regulator LiaR results in a ‘Lia OFF’ mutant, while deletion of the inhibitory protein LiaF represents a ‘Lia ON’ strain with constitutive expression of the target genes liaIH (Jordan et al., 2006; Wolf et al., 2010). Behavior of the ΔliaR mutant was comparable to the wild-type strain, while the ΔliaF mutant clearly displayed recovery advantages and regained growth more quickly even after addition of high rhamnolipid concentrations (Fig. 3). We also investigated the effect of rhamnolipids on a mutant strain lacking the CssRS TCS that orchestrates the secretion stress response, but did not observe any differences compared with the wild type (Fig. 3).

As a large part of the induced genes are regulated by σM, we investigated how this ECF σ factor contributes to resistance against rhamnolipids. Compared with the wild type, a sigM::kan mutant strain showed an impaired growth phenotype (Fig. 3). While growth of the wild type was not affected at concentrations of 50 μg mL−1, growth of the sigM::kan mutant was clearly arrested. σM controls expression of at least 30 operons involved in cell division, DNA repair and cell envelope synthesis (Eiamphungporn & Helmann, 2008). Another ECF σ factor which controls a similar large regulon is σW (Helmann, 2006). Since expression of the sigW–rsiW operon was induced 2.8-fold by rhamnolipids (Table S1), we also included a sigW::MLS mutant strain in our lysis curve experiments. But this strain shows the same behavior as the wild type, indicating that σW is not responsible for resistance against rhamnolipids (Fig. 3). Therefore, the ECF response to rhamnolipids is mainly mediated by σM, which is in agreement with induction ratios of the sigM and sigW operons (eight- vs. threefold, respectively).

We also tested if a combined deletion of both σM and σW has an additive affect and leads to a more pronounced phenotype, as a functional overlap of ECF σ factors in response to different antimicrobial compounds has already been demonstrated (Mascher et al., 2007). Indeed, the double mutant shows an increased sensitivity compared with the sigM::kan strain, as it did not resume growth in the presence of 100 μg mL−1 rhamnolipid (Fig. 3). Additional deletion of liaR, resulting in inactivation of a third cell wall stress responsive system, did not lead to a stronger susceptibility phenotype (Fig. 3). Taken together, σM seems to play a central role in rhamnolipid resistance, while σW and the LiaRS TCS have only minor functions.

Summary and conclusions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

Here, we present the first investigation of the transcriptional response to rhamnolipids, industrially important surface-active molecules with antimicrobial properties. In B. subtilis, exposure to rhamnolipids provokes a complex reaction that combines the cell envelope and secretion stress response (Fig. 2d). The main regulators orchestrating this response are the TCS LiaRS and CssRS, as well as the ECF σ factor σM. In addition to the target genes of these regulators, a number of genes encoding either metabolic enzymes or hypothetical proteins of unknown functions are also induced. Our data show a protective role of LiaRS and σM against rhamnolipid damage, while the CssRS TCS has no effect on rhamnolipid sensitivity (Fig. 3).

As rhamnolipids alter the properties of membranes, induction of the cell envelope stress response could help to maintain cell envelope integrity. While the physiological role of most of the strongly induced genes has not been elucidated yet, some of them have known or assumed functions in counteracting membrane damage. The LiaR-controlled liaIH operon encodes a small membrane protein and a member of the phage-shock protein family, respectively. Their gene products have recently been linked to resistance against daptomycin, another membrane-perturbating agent (Hachmann et al., 2009; Wolf et al., 2010). Other genes, like the ECF-regulated bcrC gene and the pbpE-racX operon encode functions involved in cell envelope biogenesis, which might also help to stabilize the envelope against membrane damage. Moreover, and given the prominent role of σM in protecting cells from rhamnolipid damage (Fig. 3), it is noteworthy that some of the most strongly induced σM-target genes of unknown function, such as yebC, ywnJ or ydaH, encode putative membrane proteins (Table 3). A possible role of these proteins in counteracting membrane damage needs to be addressed in future studies.

In contrast, the physiological role of CssRS activation by rhamnolipids is not clear. Its induction could indicate severe changes of membrane protein composition and accumulation of misfolded secreted proteins in the cell envelope caused by rhamnolipid treatment. Alternatively, rhamnolipid-dependent interference with membrane integrity could affect functionality of the secretion machinery. The CssRS TCS has also been shown to be not only induced by mammalian peptidoglycan recognition proteins, but also seems to be required for the killing mechanism of these proteins (Kashyap et al., 2011).

Although the data presented here clearly indicates that rhamnolipids interfere with cell envelope integrity, future studies will be required to gain an understanding of the mode of action of rhamnolipids and its use as antimicrobial active compound. Taken together, this is the first analysis of a bacterial stress stimulon in response to rhamnolipids showing that a single antimicrobial compound induces a combination of two normally independent stress responses.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

We would like to thank Ieva Gailite and Diana Wolf for strain construction, Rudolf Hausmann (Karlsruhe Institute of Technology) for providing purified rhamnolipids, as well as Anja Wiechert and Marc Schaffer for excellent technical assistance. This work was supported by grants from the Deutsche Forschungsgemeinschaft (DFG-grant MA2837/2-1), the Fonds der Chemischen Industrie, and the Concept for the Future of the Karlsruhe Institute of Technology within the framework of the German Excellence Initiative (to T.M.), and the Federal Ministry of Education and Research SYSMO network (0315784A) (to U.M.). T.W. is the recipient of a Chemiefonds PhD scholarship of the Fonds der Chemischen Industrie.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Summary and conclusions
  7. Acknowledgements
  8. Authors’ contribution
  9. References
  10. Supporting Information
FilenameFormatSizeDescription
fml2367-sup-0001-TableS1.xlsapplication/msexcel372KTable S1. Complete dataset.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.