Effect of interactions between Mip and PrtA on the full extracellular protease activity of Xanthomonas campestris pathovar campestris

Authors

  • Qing-Lin Meng,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Dong-Jie Tang,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Ying-Yuan Fan,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Zhen-Jiang Li,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Hui Zhang,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Yong-Qiang He,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Bo-Le Jiang,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Guang-Tao Lu,

    1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author
  • Ji-Liang Tang

    Corresponding author
    • State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, The Key Laboratory of Ministry of Education for Microbial and Plant Genetic Engineering, College of Life Science and Technology, Guangxi University, Guangxi, China
    Search for more papers by this author

Correspondence: Ji-Liang Tang, College of Life Science and Technology, Guangxi University, 100 Daxue Road, Nanning, Guangxi 530004, China. Tel.: +86 771 3233650; fax: +86 771 3239401; e-mail: jltang@gxu.edu.cn

Abstract

Mip (macrophage infectivity potentiator) and Mip-like proteins have been demonstrated to be involved in virulence of several animal pathogens, but as yet none of their native bacterial targets has been identified. Our previous work demonstrated that the Mip-like protein found in the plant pathogen Xanthomonas campestris pv. campestris (Xcc) (hereafter called MipXcc) is also involved in virulence. Inactivation of the mipXcc gene leads to a significant reduction in exopolysaccharide production and extracellular protease activity via an unknown mechanism. The Xcc genome encodes six extracellular proteases, all of which are secreted via the type II secretion system. The serine protease PrtA makes the largest contribution to Xcc's total extracellular proteolytic activity. In this study, Western blotting analysis demonstrated that MipXcc was located in the periplasm. Bacterial two-hybrid and far-Western analysis indicated that MipXcc interacted with PrtA directly. Purified MipXcc was found to be able to rescue the protease activity of periplasmic proteins extracted from the mipXcc mutant. These findings show that MipXcc plays a role in the maturation of PrtA, which is the novel native target for at least one Mip or Mip-like protein.

Introduction

Mip (macrophage infectivity potentiator) and Mip-like proteins make up a family of bacterial proteins that comprises two domains: an N-terminal dimerization region and a C-terminal PPIase (peptidyl prolyl cis/trans isomerase) region exhibiting similarity to the human FK506-binding protein (Riboldi-Tunnicliffe et al., 2001). In 1989, Mip was first identified as an important virulence factor in Legionella pneumophila (Cianciotto et al., 1989). Since then, Mip and Mip-like proteins have been found to be associated with the virulence of several other animal pathogens, such as Chlamydia trachomatis, Trypanosoma cruzi, Neisseria gonorrhoeae, and Chlamydophila pneumoniae, as well as the plant pathogen Xanthomonas campestris pv. campestris (Xcc) (Lundemose et al., 1993; Moro et al., 1995; Leuzzi et al., 2005; Herrmann et al., 2006; Zang et al., 2007). Although it seems clear that the PPIase activity of Mip and Mip-like proteins has a lot to do with microbial pathogenesis, exactly how relevant it is to Mip and Mip-like proteins’ role in virulence remains unclear. One basic hypothesis states that either the PPIase activity or some chaperone activity of Mip and Mip-like proteins might be involved in the maturation and trafficking of proteins derived from pathogens. It goes on to add that these activities may also allow Mip and Mip-like proteins to recognize host receptors and inhibit the host's defense response. Despite studies performed in numerous laboratories, none of Mip's substrates or molecular targets has yet been discovered.

Xcc, a Gram-negative Gammaproteobacterium, is the causal agent of black rot disease in cruciferous crops worldwide (Hayward, 1993). Our own recent studies have shown that a mip-like gene (here called mipXcc) exists within Xcc and encodes a protein, MipXcc, which exhibits a PPIase activity specifically inhibited by FK-506 (Zang et al., 2007). Mutagenesis analysis revealed that Xcc requires a functional MipXcc for full virulence and proliferation in host plants. Further study showed that, in mutants lacking a working mipXcc, Xcc was unable to produce its usual amounts of exopolysaccharide and its extracellular proteases were significantly less active (Zang et al., 2007). Although the mechanism by which MipXcc affects the activity of extracellular proteases remains unclear, we have made an effort to address this issue. In this study, we provide evidence that MipXcc interacts with the major Xcc protease PrtA and assists its maturation in the periplasm.

Materials and methods

Bacterial strains and growth conditions

The bacterial strains and plasmids used in this project are listed in Table 1. The primers used are listed in Table 2. Escherichia coli strains JM109 and M15 (Qiagen, Germany) were grown in LB medium at 37 °C. The bacterial two-hybrid reporter strain (here named BTHrst) (Stratagene, La Jolla, CA) was grown in M9 His-dropout medium at 30 °C. Xcc strains were grown in NYG medium at 28 °C. Antibiotics were used at the following final concentrations: rifampicin, 50 μg mL−1; kanamycin, 25 μg mL−1; ampicillin, 100 μg mL−1; chloramphenicol, 34 μg mL−1; gentamicin, 10 μg mL−1; streptomycin, 12.5 μg mL−1; and tetracycline, 15 μg mL−1 for E. coli and 5 μg mL−1 for Xcc.

Table 1. Bacterial strains and plasmids used in this worka
Strains or plasmidRelevant characteristicsReference or source
  1. a

    Rifr, Kanr, Spcr, Ampr, Cmr, Gmr, and Tcr = rifampicin, kanamycin, spectinomycin, ampicillin, chloramphenicol, gentamicin and tetracycline resistant, respectively.

Escherichia coli
Reporter strain (BTHrst)Δ(mcrA)183Δ(mcrCB-hsdSMR-mrr)173 endA1 hisB supE44 thi-1 recA1 gyrA96 relA1 lac [F′ lacIqHIS3 aadA Kanr]Stratagene
M15derived from E.coli K12 harboring pREP4, KanrQiagen
JM109RecA1 endA1 gyrA96 thi supE44 relA1Δ(lac-proAB)/F′ [traD36 lacIqlacZ ΔM15]Laboratory collection
M15/pQEMipM15 harboring pQEMip, Kanr, AmprThis study
JM109/pHATPrtAJM109 harboring pHATPrtA, AmprThis study
BTHrst/(pBT-pTRG)Reporter strain harboring pBT and pTRG, Kanr, Cmr, TcrThis study
BTHrst/(pBTPrtA-pTRGMip)Reporter strain harboring pBTPrtA and pTRGMip, Kanr, Cmr, TcrThis study
Xanthomonas campestris pv. campestris
8004Wild type, RifrDaniels et al. (1984)
NK2699as 8004, but mipXcc::pK18mob, Rifr, KanrZang et al. (2007)
001F10as 8004, but prtA::Tn5gusA5, Rifr, Kanr, Gmr, SpcrLaboratory collection
258D12as 8004, but xpsD::Tn5gusA5, Rifr, Kanr, Gmr, Spcr,Laboratory collection
NK2699/pR3MipH6NK2699 harboring pR3MipH6, Rifr, Kanr,TcrThis study
001F10/pR3PrtA001F10 harboring pR3PrtA, Rifr, Kanr,TcrThis study
NK2699/pR3PrtANK2699 harboring pR3PrtA, Rifr, Kanr,TcrThis study
Plasmids
pLAFR3Broad-host range cloning vector, TcrDaniels et al. (1984)
pQE30Expression vector, N-terminal 6xHis-tagged sequences, AmprQiagen
pHAT10Expression vector, N-terminal HAT-tagged sequences, AmprClontech
pHATDHFRControl vector, expressing dihydrofolate reductase with HAT tag in N-terminal, AmprClontech
pBTBacterioMatch® II two-hybrid system Bait plasmid, CmrStratagene
pTRGBacterioMatch® II two-hybrid system Target plasmid, TcrStratagene
pR3MipH6pLAFR3 containing the mipXcc coding sequence with 6xHis tag in its C-terminal, TcrThis study
pR3PrtApLAFR3 containing a DNA fragment including a promoter-less prtA gene, TcrThis study
pQEMippQE30 with an in frame insertion of the mipXcc coding sequence in the MCS, AmprThis study
pHATPrtApHAT10 with an in frame insertion of the prtA coding sequence in the MCS, AmprThis study
pBTprtApBT with an in frame fusion of the prtA coding sequence with lambda-cI, CmrThis study
pTRGMippTRG with an in frame fusion of the mip coding sequence with RNAP-alpha, TcrThis study
Table 2. Primers used in this studya
Primers and their purposeSequence (5′ to 3′)b
  1. a

    These primers were designed according to the genomic sequence of X. campestris pv. campestris strain 8004, and were synthesized by Sangon Biological Engineering Technology & Services Co., Ltd (Shanghai, China).

  2. b

    Bases underlined are the restriction endonuclease sites used for cloning into the multiple cloning sites of vectors.

For pBTPrtA construction
BTrtA-F/BTprtA-RCCGAATTCC ACCTCGCTGCTGCTCGC/TTGGATCCTTAGTAGCTGGCGCGCA
For pTRGMip construction
TRGMip-F/TRGMip-RTTTGGATCC GACACAACGTCCGAGAAG/CCCGAATTC TTACTTGACGCTGACCAG
For RT-PCR analysis
16s rDNA-F/16s rDNA-RGACTTGCTGGCCTGGTATCGCG/TGCGCCACTGTGGTTGCACAG
RTprtA-F/RTprtA-RCAACGATGCGTCCAATGTGTC/CAAGGTTTCCACCGCTGCTG
For pQEMip construction
QEMip-F/QEMip-RTTTGGATCC GACACAACGTCCGAGAAG/CCCGGTACC TTACTTGACGCTGACCAG
For pHATPrtA construction
HATPrtA-F/HATPrtA-RGGGGATCC CTGACCTCGCTGCTGCTCGC/CCGGTACC TTAGTAGCTGGCGCGCA
For pR3MipH6 construction
MipC6H-F/MipC6H-RCGGAATTCG ATGAAGTTGCGTTCGATC/CGGGATCC TTAATGGTGATGGTGATGGTGCTTGACGCTGACCAG
For pR3PrtA construction
PrtA-F/PrtA-RTCTGAATTCC ATGTCGACTGCGTCTCTC/GGGGATCC TTAGTAGCTGGCGCGCA

DNA manipulations

Standard DNA manipulation was performed as described by Sambrook & Russell (2001). The conjugation of Xcc to E. coli was performed as described by Turner et al. (1985). Restriction enzymes and DNA ligase were purchased from Promega (Madison, WI) and used in accordance with the manufacturer's instructions. All clones were confirmed by sequencing.

Construction of the Xcc strains: NK2699/pR3PrtA, 001F10/pR3PrtA, and NK2699/pR3MipH6

Fragment of prtA was PCR-amplified and cloned into pLAFR3. The resulting plasmid pR3PrtA was introduced into the mipXcc mutant NK2699 and the prtA mutant 001F10 by triparental conjugation. Fragment of mipXcc was conjugated at the 3′ end with 6xHis coding sequences, then PCR-amplified and cloned into pLAFR3. The derived plasmid pR3MipH6 was introduced into NK2699.

Construction of expression strains: M15/pQEMip and JM109/pHATPrtA

Fragments of mipXcc and prtA lacking any signal peptide (the N terminus 1–21 residues and 1–32 residues, respectively) coding sequence were PCR-amplified and cloned into pQE30 (Qiagen) and pHAT10 (Clontech). The resulting plasmid pQEMip was introduced into the M15 strain by electroporation. The pHATPrtA (Table 1) and pHATDHFR (Clontech) plasmids were introduced into the JM109 strain.

Preparation of total, extracellular, periplasmic, and outer membrane fraction proteins

The total, extracellular and periplasmic proteins of strains NK2699/pR3MipH6 and NK2699/pR3PrtA were prepared using the method described previously (Zang et al., 2007). The outer membrane fraction proteins were prepared as described (Leuzzi et al., 2005).

Bacterial two-hybrid analysis

The BacterioMatch® II two-hybrid system (Stratagene) was used according to manufacturer's instructions. The two plasmids, pBT and pTRG, containing the fusional prtA and mipXcc genes without signal peptide coding sequences, were used to simultaneously transform BTHrst (reporter strain). Within the reporter gene cassette, protein-protein interactions were screened for activation of addA and HIS3 genes. This resulted in resistance to streptomycin (12.5 μg mL−1) and 5 mM 3-amino-1,2,4-triazole (3-AT).

Chloroform treatment

Release of periplasmic proteins in situ was achieved using the chloroform vapor treatment method described by Ames et al. (1984) with minor modification. After removing the cap, the plate with grown Xcc colonies was laid upside down above a disk containing 2 mL chloroform and incubated for 1 min.

Western blot and far-Western assays

In vitro Western blot and far-Western blot assays were performed as described by He et al. (2006). The preparation of recombinant (His)6-MipXcc, HAT-PrtA and HAT-HDFR protein was performed as described previously (Zang et al., 2007).

Rescue of protease activity

A quantity of 10 μg (His)6-MipXcc and 100 μL of periplasmic fraction (or extracellular fraction) were added into 10 mL of 50 mM Tris–HCl (pH 8.0). The solution was mixed well and incubated at 28 °C for 4 h. The protease activity of the mixture was measured by azocasein assay (Charney & Tomarelli, 1947). First, azocasein (Sigma) was dissolved in 100 mM Tris–HCl (pH 8.0) and used as a substrate. Then 100 μL of the rescue mixture was mixed with an equal volume of the substrate in a 1.5-mL EP tube. After incubation at 28 °C for 1 h, 800 μL of ice-cold 5% trichloracetic acid was added. The tube was then centrifuged for 15 min at 20 800 g. Meanwhile, 500 μL of supernatant was mixed with equal volume of 0.5 M NaOH, and A440 nm. One unit of protease activity was defined as an increase of 1 OD unit at 440 nm in 30 min. The whole experiment was repeated three times.

Results

Effect of mipXcc mutation on the transcription of prtA

The Xcc strain 8004 genome contains six ORFs encoding extracellular proteases such as XC_1514, XC_1515, XC_3376, XC_3377, XC_3378, and XC_3379 (Qian et al., 2005). One of them, XC_3379, has already been characterized as prtA, which encodes the major extracellular protease PrtA (also known as Prt1). This enzyme is responsible for almost all extracellular protease activity of Xcc strain 8004. Inactivation of prtA leads to almost complete loss of extracellular protease activity (Tang et al., 1987; Dow et al., 1990; Barber et al., 1997). In our previous article, we speculated that the expression of extracellular protease genes may be affected by mipXcc mutation (Zang et al., 2007). However, our microarray hybridization analysis revealed that the mRNA level of the prtA in the mipXcc mutant NK2699 is similar to that in the wild-type strain 8004 (NK2699/8004 = 0.89) (data not shown). This was confirmed by semi-quantitative RT-PCR (Fig. 1a). We also constructed strain mip/pR3PrtA, in which a constitutively expressed prtA was found unable to restore extracellular protease activity. It was, however, able to restore activity in 001F10/pR3PrtA (Fig. 1b).

Figure 1.

Effect of mipXcc mutation on the transcription of prtA. (a) Detection of prtA mRNA level in Xcc strains by semi-quantitative RT-PCR. RNA was isolated from cultures of the Xcc wild-type strain 8004 and the mipXcc mutant NK2699 grown in NYG medium. Equal amounts of RNA from 8004 and NK2699 were converted to cDNA using a TaKaRa RNA PCR Kit. The cDNA was used as template for amplification in PCR with Taq polymerase using prtA-specific primers (Table 2). The resulting amplification products were analyzed in 1.2% agarose gels. The 16S rRNA gene of Xcc was used as an internal control. (b) The extracellular protease activity of Xcc strains. Two microliters of overnight culture (OD600 nm ≈ 1.0) of an Xcc strain was spotted onto an NYG plate containing 0.5% (w/v) skimmed milk and incubated at 28 °C for 48(h). Zone of clearance around a colony is due to the degradation of the skimmed milk by proteases, and the relative activity of the protease was indicated by the diameter of the clear zone. Three plates were inoculated in each experiment, and each experiment was repeated three times.

Absence of accumulation of active PrtA in the periplasm of the mipXcc mutant

The second possibility suggested in our previous article was that MipXcc may be required for the secretion of extracellular proteases (Zang et al., 2007). Other studies have shown that Xcc's extracellular enzymes are secreted via the type II secretion system (T2SS) (Hu et al., 1992; Lee et al., 2004). They acquire their native conformations in the periplasmic space before crossing the outer membrane. As shown in Fig. 2a, mature proteases accumulated in the periplasm of the T2SS-deficient mutant strain 258D12. In contrast, no mature protease was accumulated in the periplasm of the mipXcc mutant. In addition, the prtA mutant did not display any significant protease activity after it was treated with chloroform (Fig. 2a). This indicates that proteases other than PrtA contribute little to the proteolytic activity of Xcc strain 8004. In addition, the portraits of wild-type 8004 and NK2699/pR3MipH6 suggest that not all active protease proteins are secreted immediately after maturation.

Figure 2.

(a) The extracellular protease activity of Xcc strains after chloroform treatment. Two microliters of overnight culture (OD600 nm ≈ 1.0) of Xcc strains were spotted onto an NYG plate containing 0.5% (w/v) skimmed milk and incubated at 28 °C for 48(h). After being photographed, the plate lid was removed and the plate was inverted over a disk containing 2 mL chloroform for 1 min. The plate was then removed from the chloroform-containing disk, the lid was replaced, and the plate was incubated at 28 °C for another 24(h) before being photographed again. (b) Subcellular localization of the MipH6 as determined by Western blot analysis. 10 μg of protein sample was separated by SDS-PAGE electrophoresis and transferred to a PVDF membrane. The presence of MipH6 was detected by anti-6His monoclonal antibody, and the presence of the Zur protein was detected by anti-Zur polyclonal rabbit antisera.

Location of MipXcc in the periplasm of Xcc cells

Our previous observation that PPIase activity was much less intense in the periplasm of the mipXcc mutant strain than in the wild type suggested that MipXcc might be located in the periplasm of Xcc cells (Zang et al., 2007). In this study, we constructed a complementary strain, NK2699/pR3MipH6, which expressed MipXcc with a 6xHis tag on its C-terminus (MipH6). As shown in Fig. 2a, the addition of the 6xHis tag to the C-terminus of MipXcc did not affect its function. We prepared the total, periplasmic, outer membrane and extracellular protein fractions of NK2699/pR3MipH6 during the late log phase. Western blot analysis revealed MipH6 in the total-protein and periplasmic protein fractions but not in the outer membrane or extracellular protein fractions (Fig. 2b). In a parallel experiment, the Zur protein, a transcriptional regulator localized in the cytoplasm of Xcc cells (Huang et al., 2008), was detected only in the total protein fraction but not in the periplasmic and extracellular fractions (Fig. 2b). These results indicate that no cytoplasmic protein was released into the periplasmic or extracellular space. They also demonstrate that MipXcc is located in the periplasm.

Interaction of MipXcc with PrtA

To determine whether or not MipXcc interacts with PrtA directly, we constructed pTRGMip and pBTPrtA without leader peptides and co-introduced them into BTHrst to create the strain BTHrst/(pBTPrtA-pTRGMip). As shown in Fig. 3a, BTHrst/(pBTPrtA-pTRGMip) grew well on a medium containing 5 mM 3-AT and streptomycin (12.5 μg mL−1). The control, BTHrst/(pBT-pTRG), was unable to grow. This implies some physical interaction between MipXcc and PrtA. To further validate this physical interaction, we employed far-Western blotting analysis using unrelated protein HAT-DHFR as negative control (Fig. 3b1). Western blotting showed that the anti-6His monoclonal antibody detected (His)6-MipXcc only (Fig. 3b2). However, after incubating the membrane with (His)6-MipXcc solution, probing with the anti-6His antibody revealed that HAT-PrtA was capable of forming stable complex with (His)6-MipXcc (Fig. 3b3). The results of this analysis showed that MipXcc bind specifically to PrtA in vitro.

Figure 3.

Detection of the physical interaction between MipXcc and PrtA by bacterial two-hybrid and far-Western blot analysis. (a) Growth of recombinant bacterial two-hybrid reporter strains on screening medium. One microliter of overnight culture (OD600 nm ≈ 1.0) of each strain grown in M9 His-dropout liquid medium at 30 °C was spotted onto a plain M9 His-dropout plate and another M9 His-dropout plate supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT) and streptomycin. The photographs were taken after the plates had been incubated at 30 °C for 24(h). Three plates were inoculated in each experiment, and each experiment was repeated three times. (b) Detection of in vitro binding of (His)6-MipXcc to the HAT-PrtA as determined by far-Western blot analysis. 1. SDS-PAGE electrophoresis separation of (His)6-MipXcc, HAT-PrtA and HAT-HDFR proteins. 2. Western blot analysis using anti-6His monoclonal antibody. 3. Far-Western blot detection of (His)6-MipXcc capable of binding to HAT-PrtA using anti-6His monoclonal antibody.

Effect of MipXcc on the protease activity of periplasmic proteins extracted from the mipXcc mutant

Ruling out the above two possibilities, our findings seemed to suggest that MipXcc is required for the correct folding of PrtA in the periplasm (Zang et al., 2007). We postulated that, in the absence of MipXcc, unfolded and inactive PrtA would accumulate in the periplasm. If this were the case, the addition of MipXcc to the periplasmic proteins isolated from mipXcc mutants would show the presence of active PrtA. We assayed the protease activity of the periplasmic proteins extracted from the mipXcc mutant with and without the addition of purified (His)6-MipXcc. Weak protease activity was detected in the sample to which purified (His)6-MipXcc had been added, but no protease activity was detected in the sample without (His)6-MipXcc (data not shown). The fact that only weak protease activity was detected might have been due to the small amount of PrtA precursor in the periplasmic protein sample. To increase the level of periplasmic PrtA precursor in the mipXcc mutant, we tried again with the strain NK2699/pR3PrtA. Strong protease activity was detected in the periplasmic protein sample to which (His)6-MipXcc was added, but no protease activity was detected in the periplasmic protein sample without (His)6-MipXcc (Fig. 4). These results demonstrate that MipXcc promotes the maturation of PrtA protease in vitro.

Figure 4.

Rescue of protease activity in the periplasmic proteins extracted from the NK2699/pR3PrtA by purified (His)6-MipXcc. The protease activity of each mixture was measured by azocasein assay. The results are representative of three independent tests. Error bars indicate standard deviation.

Discussion

This study shows that MipXcc is not required for either the transcription or the secretion of PrtA. It also reveals that MipXcc specifically binds to PrtA and promotes its maturation in vitro. These findings suggest that MipXcc may act as a factor (PPIase/chaperone) for the maturation of the major extracellular protease PrtA in the periplasm. Although Mip and Mip-like proteins were defined as members of the FKBP-type PPIase family some time ago, this is the first report to identify a native bacterial target for any Mip or Mip-like protein. Another well studied Mip protein is a certain cell surface protein found in L. pneumophila (Cianciotto et al., 1989). A number of reports have shown that it contributes to virulence and infection. It has been demonstrated that the L. pneumophila Mip can promote the presence of phospholipase-C-like activity in culture supernatants and bind to both the extracellular matrix of NCI-H292 lung epithelial cells and the collagen of guinea pigs (Debroy et al., 2006; Wagner et al., 2007). However, the molecular mechanism by which L. pneumophila Mip acts on these substrates remains unclear.

The data obtained from Western blotting analysis show that MipXcc is localized in the periplasmic space. In contrast, the Mips and Mip-like proteins of L. pneumophila, N. gonorrhoeae, and C. trachomatis are located on the cell surface (Cianciotto et al., 1989; Leuzzi et al., 2005; Neff et al., 2007). The Mip-like proteins of T. cruzi and C. pneumoniae are secreted into the extracellular environment (Moro et al., 1995; Herrmann et al., 2006). It may be that Mips and Mip-like proteins that have different locations may influence virulence via different mechanisms. The role of the periplasmic MipXcc in pathogenesis may be quite different from those of the cell surface and extracellular Mips and Mip-like proteins. The latter may interact directly with host substrates in ways that a periplasmic protein could not. The results presented herein demonstrate that at least one of the major roles of the periplasmic Mip protein of Xcc in pathogenesis is assisting the maturation of proteins required for virulence. They also show that this process takes place in the periplasm. The Mip-like protein FkpA is also located in the periplasm, and it has been suggested that it may be involved in the stress response or serve as a heat-shock protein that functions as a chaperone for envelope proteins (Missiakas et al., 1996; Arie et al., 2001).

Acknowledgements

We are grateful to J. Maxwell Dow and Robert P. Ryan for helpful discussions and critical reading of the manuscript. This work was supported by the National Natural Science Foundation of China (30730004).

Authors’ contribution

Q.-L.M. and D.-J.T. contributed equally to this work.

Ancillary