SEARCH

SEARCH BY CITATION

Keywords:

  • biofilm;
  • planktonic cell;
  • antibiotic resistance;
  • gene expression;
  • Staphylococcus aureus;
  • SalmonellaTyphimurium

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was designed to evaluate gene expression patterns of the planktonic and biofilm cells of Staphylococcus aureus and SalmonellaTyphimurium in trypticase soy broth adjusted to pH 5.5 and pH 7.3. The planktonic and biofilm cells of multiple antibiotic-resistant S. aureus (S. aureusR) and S. Typhimurium (S. TyphimuriumR) were more resistant to β-lactams than those of antibiotic-susceptible S. aureus (S. aureusS) and S. Typhimurium (S. TyphimuriumS) at pH 5.5 and pH 7.3. The relative gene expression levels of norB, norC, and mdeA genes were increased by 7.0-, 4.7-, and 4.6-fold, respectively, in the biofilm cells of S. aureusS grown at pH 7.3, while norB, norC, mdeA, sec, seg, sei, sel, sem, sen, and seo genes were stable in the biofilm cells of S. aureusR. This study provides useful information for understanding gene expression patterns in the planktonic and biofilm cells of antibiotic-resistance pathogens exposed to acidic stress.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Over the last decades, the prevalence of antibiotic-resistant bacterial infections has been rapidly increased because of the repeated and prolonged use of antibiotics, leading to a serious health problem worldwide (Wegener, 2003; Gootz, 2010). The emergence of antibiotic-resistant bacteria has become of great concern for public health, which widely appears as frequent outbreaks in recent years (Boonmar et al., 1998; Van et al., 2007). Therefore, prevention strategies for antibiotic resistance are essential to control the spread of antibiotic-resistant pathogens. However, the discovery and development of novel antibiotics has lagged behind the emergence of antibiotic-resistant pathogens because of the lengthy and expensive processes, requiring phases of clinical investigation trials to obtain approval, and the lack of information on the antibiotic resistance mechanisms (Yineyama & Katsumata, 2006). Therefore, understanding the molecular properties of strains that are antibiotic-resistant is vital for the treatment of diseases associated with antibiotic-resistant pathogens.

In the natural environments, most bacteria can form biofilms, embedded within a self-produced extracellular polymeric matrix consisting mainly of polysaccharide groups (Flemming & Wingender, 2010). The biofilm formation as a bacterial survival strategy leads to increased resistance to heat, acid, preservatives, and antibiotics (Stewart & William Costerton, 2001; Chmielewski & Frank, 2003; Van Houdt & Michiels, 2010). Bacterial infections can mainly occur after consumption of contaminated foods. The ingested bacteria are exposed to acidic stress and bile salt under oxygen-limited conditions during transit through the stomach, the small intestine, and the colon. These stress conditions can influence antibiotic resistance patterns, biofilm-forming abilities, and virulence properties (Riesenberg-Wilmes et al., 1996; Gahan & Hill, 1999; Schobert & Tielen, 2010). Moreover, antibiotic-resistant bacteria can possibly reside in biofilms and lead to enhanced tolerance to adverse environmental conditions, causing serious infectious diseases (Gustafson et al., 2001; Langsrud et al., 2004; Ngwai et al., 2006; Kim & Wei, 2007). However, there is a lack of information on the biofilm-associated infections involved in altered virulence properties of antibiotic-resistant bacteria. Therefore, the objective of this study was to evaluate the gene expression patterns of biofilm and planktonic cells of antibiotic- resistant foodborne pathogens, Salmonella Typhimurium and Staphylococcus aureus, when exposed to acidic stress under anaerobic condition.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains and culture conditions

Strains of S. aureus KACC13236 and S. Typhimurium KCCM 40253 were obtained from the Korean Agricultural Culture Collection (KACC, Suwon, Korea) and the Korean Culture Center of Microorganisms (KCCM, Seoul, Korea), respectively. Strains of S. aureus CCARM 3080 and S. Typhimurium CCARM 8009 were purchased from the Culture Collection of Antibiotic Resistant Microbes (CCARM, Seoul, Korea). All strains were cultured in trypticase soy broth (TSB; BD, Becton, Dickinson and Co., Sparks, MD) at 37 °C for 20 h. The cultured cells were collected by centrifuged at 3000 g for 20 min at 4 °C, washed twice with 0.1% sterile buffered peptone water (BPW), and then used to prepare biofilm cells for assays.

Biofilm formation assay

The biofilm formation was evaluated based on the ability of strains to adhere to the surface of polystyrene Petri dishes. The strains of S. aureus KACC13236, S. Typhimurium KCCM 40253, S. aureus CCARM 3080, and S. Typhimurium CCARM 8009 were inoculated at approximately 106 CFU mL−1 in TSB adjusted to a sub-lethal pH of 5.5 using 1 M HCl and TSB at pH 7.3 as the control. The inoculated strains were anaerobically cultured without mechanical agitation at 37 °C for 48 h in a GasPak anaerobic system (BBL, Cockeysville, MD) with AnaeroGen (Oxoid Ltd, Hampshire, UK).

Antibiotic susceptible assay

The antibiotic susceptibility of planktonic and biofilm cells was determined according to the Clinical Laboratory Standards Institute (CLSI) procedure (CLSI, 2009). The antibiotic stock solutions were prepared by dissolving them in sterile distilled water at concentrations of 256 μg mL−1 (ampicillin, aztreonam, cefotaxime, cefoxitin, ceftazidime, cephalothin, oxacillin, and piperacillin) and serial dilution (1 : 2) with TSB (pH 7.3). The strains of S. aureus KACC13236, S. aureus CCARM 3080, S. Typhimurium KCCM 40253, and S. Typhimurium CCARM 8009 were anaerobically cultured in TSB at pH 5.5 and 7.3 to obtain planktonic and biofilm cells. In accordance with the CLSI procedure, the planktonic and biofilm cells grown in TSB at pH 5.5 and 7.3 were incubated in the diluted antibiotic solutions for 18 h at 37 °C to evaluate the susceptibility of cells to antibiotics. Minimum inhibitory concentrations (MICs) were determined at concentrations at which there was no visible growth. The susceptible (S), intermediate (I), and resistant (R) strains were defined based on MIC values of < 4 μg mL−1, between 4 and 8 μg mL−1, and more than 16 μg mL−1, respectively (Hamilton-Miller & Shah, 1996).

Microbiological analysis

The numbers of planktonic and biofilm cells were estimated using the plate count method. For planktonic cell counts, the cell suspensions were collected and the remaining non-adherent cells were rinsed by flooding the plate surface with 10 mL of 0.1% sterile BPW. For biofilm cell counts, the attached cells were collected with a cell scraper (Thermo Scientific Nunc, Rochester, NY) and suspended by sonication at 20 kHz for 10 min in 20 mL of 0.1% sterile BPW. The collected cells were serially diluted (1 : 10) with 0.1% sterile BPW and the proper dilutions were plated on trypticase soy agar (TSA). The agar plates were incubated at 37 °C for 48 h for enumeration of planktonic and biofilm cells.

RNA extraction

Each planktonic or biofilm culture (0.5 mL) was mixed with 1 mL of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and centrifuged at 5000 g for 10 min. The collected cells were used for RNA extraction according to the RNeasy® Mini Handbook (Qiagen). The collected cells were disrupted in a buffer containing guanidine isothiocyanate and lysozyme, mixed with ethanol to adjust proper binding conditions, and then loaded into an RNeasy mini column for RNA isolation.

RT-PCR amplification

The cDNA was synthesized as described previously (Xu et al., 2010), according to the QuantiTect Reverse Transcription protocol (Qiagen). In brief, the RNA sample was mixed with a master mixture containing Quantiscript Reverse Transcriptase, Quantiscript RT Buffer, RT Primer Mix and RNase-free water, incubated at 42 °C for 15 min, and then immediately incubated at 95 °C for 3 min to inactivate the Quantiscript Reverse Transcriptase. The custom-synthesized oligonucleotide primers using IDT (Integrated DNA Technologies Inc., Coralville, IA) were used in this study (Tables 1 and 2). The PCR mixture (20 μL) containing 2× QuantiTect SYBR Green PCR Master (10 μL), 60 pmol primer (0.6 μL), cDNA (2 μL), and RNase-free water (6.8 μL) was amplified using an iCycler iQ™ System (Bio-Rad Laboratories, Hemel Hempstead, UK) and denatured initially for 15 min at 95 °C, followed by 45 cycles of 94 °C for 15 s, 59 °C for 20 s, and 72 °C for 15 s. The melt-curve analysis was performed immediately after the amplification protocol with 0.4 °C increments per 10 s for 85 cycles from 65 to 97 °C. The PCR products were visualized and analyzed using the iQ5 real-time PCR detection system (Bio-Rad Laboratories). The comparative Ct method (Livak & Schmittgen, 2001; Xu et al., 2010) was used to analyze the relative expression of targeted genes. The untreated cells were cultured anaerobically in TSB (pH 7.3) at 37 °C for 20 h.

Table 1. Primer sequences used in RT-PCR analysis for Staphylococcus aureus
GeneMolecular functionPrimer sequenceSize (bp)
  1. F, forward; R, reverse.

secEnterotoxin CF: TGTACTTRTAAGAGTTTATGAAAATA104
R: TCCTAGCTTTTATGTCTAGTTCTTGAG
segEnterotoxin GF: TTACAAAGCAAGACACTGGCTCA73
R: TCCAGATTCAAAYGCAGAACMAT
seiEnterotoxin IF: GGTAYCAATGATTTGATCTCAGAAT147
R: GTATTGTCCTGATAAAGTGGCC
selEnterotoxin LF: TAGATTCGCCAAGAATAATACC176
R: CTTTACCAGTATCATTGTGTCC
semEnterotoxin MF: TCATATCGCAACCGCTGATGATG150
R: TCAGCWGTTACTGTCGAATTAT
senEnterotoxin NF: GATGAAGAGARAGTTATAGGCGT167
R: ATGTTACCGGTATCTTTATTGTAT
seoEnterotoxin OF: GTGTAAGAAGTCAAGTGTAGAC163
R: CAGCAGATWTTCCATCTAACC
norBEfflux transporter proteinF: AGCGCGTTGTCTATCTTTCC213
R: GCAGGTGGTCTTGCTGATAA
norCEfflux transporter proteinF: AATGGGTTCTAAGCGACCAA216
R: ATACCTGAAGCAACGCCAAC
mdeAMultidrug efflux AF: GTTTATGCGATTCGAATGGTTGGT155
R: AATTAATGCAGCTGTTCCGATAGA
Table 2. Primer sequences used in RT-PCR analysis for SalmonellaTyphimurium
GeneMolecular functionPrimer name and sequenceSize (bp)
  1. F, forward; R, reverse.

acrAMultidrug efflux systemF: AAAACGGCAAAGCGAAGGT64
R: GTACCGGACTGCGGGAATT
acrBMultidrug efflux systemF: TGAAAAAAATGGAACCGTTCTTC69
R: CGAACGGCGTGGTGTCA
tolCMultidrug efflux systemF: GCCCGTGCGCAATATGAT67
R: CCGCGTTATCCAGGTTGTTG
ompDOuter membrane protein DF: GCAACCGTACTGAAAGCCAGGG239
R: GCCAAAGAAGTCAGTGTTACGGT
hilAInvasion gene activatorF: TATCGCAGTATGCGCCCTT50
R: TCGTAATGGTCACCGGCAG
fimAMajor fimbrial subunitF: TTGCGAGTCTGATGTTTGTCG62
R: CACGCTCACCGGAGTAGGAT
lpfEFimbrial proteinF: GGTCAGTCGGGTCCGGA61
R: GATTGCGCGTATGCCACA
invAInvasion proteinF: ACAGTGCTCGTTTACGACCTGAAT454
R: AGACGACTGGTACTGATCGATAAT
stnSalmonella enterotoxinF: GCCATGCTGTTCGATGAT467
R: GTTACCGATAGCGGGAAAGG

Statistical analysis

All experiments were conducted in duplicate for three replicates. Data were analyzed using statisticalanalysissystem software (SAS). The general linear model (GLM) and least significant difference (LSD) procedures were used to determine significant mean differences among strains and culture conditions at P < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Planktonic and biofilm growths of selected foodborne pathogens in different pH levels under anaerobic conditions

The planktonic and biofilm cell growths of S. aureus KACC13236, S. aureus CCARM 3080, S. Typhimurium KCCM 40253, and S. Typhimurium CCARM 8009 were evaluated in TSB at pH 5.5 and 7.3 under anaerobic conditions (Table 3). At pH 5.5, the planktonic cell growths of antibiotic-susceptible strains S. aureus KACC13236 and S. Typhimurium KCCM 40253 were inhibited during the 48-h incubation, showing a decrease in cell counts to 5.59 and 6.25 log CFU mL−1, respectively. However, at pH 5.5 the planktonic cells of antibiotic-resistant strains S. aureus CCARM 3080 and S. Typhimurium CCARM 8009 increased to 6.78 and 7.47 log CFU mL−1, respectively (Table 3). At pH 7.3, the planktonic cell populations of S. Typhimurium KCCM 40253, and S. Typhimurium CCARM 8009 increased to approximately 9 log CFU mL−1 after 48-h incubation, while the number of planktonic S. aureus KACC13236 cells was reduced by 0.6 log CFU mL−1, compared to the initial number (6.24 log CFU mL−1). The highest biofilm cell numbers were 8.26 and 8.32 log CFU mL−1 for S. aureus CCARM 3080 in TBS at pH 5.5 and pH 7.3 after 48-h cultivation, respectively, while the fewest biofilms were formed by S. Typhimurium KCCM 40253 in TSB at pH 5.5.

Table 3. Viability of planktonic and biofilm cells grown at 37 °C for 48 h in TSB adjusted to pH 5.5 and 7.3
TreatmentStrainaPlanktonic cell (log CFU mL−1)Biofilm cell (log CFU mL−1)
0 h48 h0 h48 h
  1. n.d., not detected; S, antibiotic-sensitive; R, antibiotic-resistant.

  2. a

    Staphylococcus aureus KACC13236, S. aureusS; S. aureus CCARM 3080, S. aureusR; Salmonella Typhimurium KCCM 40253, S. TyphimuriumS; and S. Typhimurium CCARM 8009, S. TyphimuriumR.

  3. a–e Means with different subscripts within a column are significantly different at P < 0.05.

pH 5.5S. aureusS6.515.59en.d.7.02cd
S. aureusR6.626.78cdn.d.8.26a
S. TyphimuriumS6.976.25den.d.5.48e
S. TyphimuriumR6.927.47bcn.d.6.67d
pH 7.3S. aureusS6.545.64en.d.7.77ab
S. aureusR6.647.83bn.d.8.32a
S. TyphimuriumS6.838.96an.d.7.88ab
S. TyphimuriumR6.848.91an.d.7.45bc

Antibiotic susceptibility of planktonic and biofilm cells anaerobically grown in different pH levels

The MICs of the antibiotics ampicillin, aztreonam, cefotaxime, cefoxitin, ceftazidime, cephalothin, oxacillin, and piperacillin against S. aureus KACC13236, S. aureus CCARM 3080, S. Typhimurium KCCM 40253, and S. Typhimurium CCARM 8009 were determined as shown in Tables 4 and 5. As shown in Table 4, the planktonic and biofilm cells of S. aureus CCARM 3080 were more resistant to most antibiotics than those of S. aureus KACC13236. Compare to S. aureus planktonic cells, the biofilm cells were highly resistant to most antibiotics. The MIC values for ampicillin, cefotaxime, cefoxitin, ceftazidime, oxacillin, and piperacillin were ≥ 256 μg mL−1 against the biofilm cells of S. aureus CCARM grown in TSB at pH 5.5 and 7.3. The planktonic and biofilm cells grown in TSB at pH 5.5 were more susceptible to antibiotics than those grown in TSB at pH 7.3. The differences in antibiotic susceptibility between pH 5.5 and 7.3 were especially noticeable for the biofilm cells of S. aureus KACC13236. However, the antibiotic resistance patterns of S. aureus CCARM 3080 were not significantly different between the biofilm cells at pH 5.5 and 7.3, showing MIC values of 128 μg mL−1 to more than 256 μg mL−1. As shown in Table 5, the planktonic and biofilm cells of S. Typhimurium CCARM 8009 were more likely to be resistant to most antibiotics when compared to S. aureus KACC13236. Similarly, the biofilm cells of S. Typhimurium were more resistant to antibiotics compared with the planktonic cells. According to the results of the susceptibility of selected foodborne pathogens, the strains of S. aureus KACC13236, S. aureus CCARM 3080, S. Typhimurium KCCM 40253, and S. Typhimurium CCARM 8009 were assigned to antibiotic-susceptible S. aureus (S. aureusS), multiple antibiotic-resistant S. aureus (S. aureusR), antibiotic-susceptible S. Typhimurium (S. TyphimuriumS), multiple antibiotic-resistant S. Typhimurium (S. TyphimuriumR), respectively.

Table 4. MIC (μg mL−1)a of selected antibiotics against Staphylococcus aureus strains grown in TSB adjusted to pH 5.5 and 7.3 at 37 °C
AntibioticS. aureus KACC13236S. aureus CCARM 3080
PlanktonicBiofilmPlanktonicBiofilm
pH 5.5pH 7.3pH 5.5pH 7.3pH 5.5pH 7.3pH 5.5pH 7.3
  1. a

    S, susceptible; I, intermediate; R, resistant.

Ampicillin< 0.25 (S)< 0.25 (S)< 0.25 (S)> 256 (R)4 (S)32 (R)> 256 (R)> 256 (R)
Aztreonam> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)
Cefotaxime< 0.25 (S)2 (S)2 (S)256 (R)64 (R)> 256 (R)> 256 (R)> 256 (R)
Cefoxitin0.5 (S)4 (S)2 (S)> 256 (R)8 (S)> 256 (R)> 256 (R)> 256 (R)
Ceftazidime4 (S)16 (I)16 (I)256 (R)64 (R)> 256 (R)> 256 (R)> 256 (R)
Cephalothin< 0.25 (S)< 0.25 (S)< 0.25 (S)> 256 (R)16 (I)128 (R)128 (R)128 (R)
Oxacillin< 0.25 (S)< 0.25 (S)< 0.25 (S)> 256 (R)16 (I)> 256 (R)> 256 (R)> 256 (R)
Piperacillin< 0.25 (S)1 (S)0.5 (S)> 256 (R)4 (S)256 (R)256 (R)> 256 (R)
Table 5. MIC (μg mL−1)a of selected antibiotics against SalmonellaTyphimurium strains grown in TSB adjusted to pH 5.5 and 7.3 at 37 °C
AntibioticS. Typhimurium KCCM 40253S. Typhimurium CCARM 8009
PlanktonicBiofilmPlanktonicBiofilm
pH 5.5pH 7.3pH 5.5pH 7.3pH 5.5pH 7.3pH 5.5pH 7.3
  1. a

    S, susceptible; I, intermediate; R, resistant.

Ampicillin4 (S)2 (S)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)
Aztreonam1 (S)< 0.25 (S)32 (I)> 256 (R)< 0.25 (S)1 (S)> 256 (R)> 256 (R)
Cefotaxime1 (S)0.25 (S)0.5 (S)8 (S)< 0.25 (S)< 0.25 (S)2 (S)128 (R)
Cefoxitin8 (S)32 (R)8 (S)128 (R)4 (S)64 (R)16 (I)64 (R)
Ceftazidime2 (S)0.5 (S)2 (S)8 (S)1 (S)0.5 (S)8 (S)64 (R)
Cephalothin8 (S)16 (I)16 (I)32 (R)16 (I)32 (R)256 (R)256 (R)
Oxacillin> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)
Piperacillin4 (S)16 (I)8 (S)> 256 (R)> 256 (R)> 256 (R)> 256 (R)> 256 (R)

Gene expression patterns of selected foodborne pathogens anaerobically grown at different pH levels

The gene expression patterns were evaluated in the antibiotic-susceptible (S. aureusS and S. TyphimuriumS) and multiple antibiotic-resistant strains (S. aureusR and S. TyphimuriumR) anaerobically cultured in TSB adjusted to pH 5.5 and 7.3 during the planktonic-to-biofilm transition for 48 h at 37 °C (Figs 1 and 2). The relative expression of norB, norC, mdeA, sec, seg, sei, sel, sem, sen, and seo genes was observed in the planktonic and biofilm cells of S. aureusS and S. aureusR (Fig. 1). The norB and mdeA genes were overexpressed at the planktonic cells of both S. aureusS and S. aureusR grown in TSB at pH 5.5 after 48-h incubation (Fig. 1a). The relative expression level of norC gene was increased 2.8-fold in S. aureusS. The relative gene expression levels of sel and sem were increased 5.0- and 3.0-fold, respectively, in the planktonic cells of S. aureusR grown in TSB at pH 5.5. As shown in Fig. 1b, the relative gene expression of norC and mdeA was stabilized in the planktonic cells of both S. aureusS and S. aureusR grown in TSB at pH 7.3. The relative expression levels of norB, seg, and sei genes were increased 52.6-, 2.6-, and 5.9-fold, respectively, in the planktonic cells of S. aureusR grown in TSB at pH 7.3. Unlike the planktonic cells, all genes were stable in the biofilm cells of S. aureusR grown in TSB at pH 5.5 and pH 7.3, except for the sec gene in S. aureusR biofilm cells formed in TSB at pH 5.5 (Fig. 1c,d). The relative gene expression levels of norB and mdeA were increased 1.9- and 2.0-fold, respectively, in the biofilm cells of S. aureusS grown in TSB at pH 5.5 (Fig. 1c). The highest expression level (116.6-fold) was observed at the norB gene in the S. aureusR biofilm cells grown in TSB at pH 5.5. As shown in Fig. 1d, the norB, norC, and mdeA genes were stable in the biofilm cells of both S. aureusS and S. aureusR grown in TSB at pH 7.3.

image

Figure 1. Relative gene expression in Staphylococcus aureus planktonic cells grown in TSB adjusted to pH 5.5 (a) and pH 7.3 (b) and S. aureus biofilm cells grown in TSB adjusted to pH 5.5 (c) and pH 7.3 (d). Means with different uppercase letters (A–E) within S. aureusKACC13236 (■, S. aureusS) and lowercase letters (a–d) within S. aureusCCARM 3080 (□, S. aureusR) are significantly different at P < 0.05. Asterisk (*) indicates significant difference between S. aureusKACC13236 (S. aureusS) and S. aureusCCARM 3080 (S. aureusR) at P < 0.05.

Download figure to PowerPoint

image

Figure 2. Relative gene expression in SalmonellaTyphimurium planktonic cells grown in TSB adjusted to pH 5.5 (a) and pH 7.3 (b) and S. Typhimurium biofilm cells grown in TSB adjusted to pH 5.5 (c) and pH 7.3 (d). Means with different uppercase letters (A–E) within S. Typhimurium KCCM 40253 (■, S. TyphimuriumS) and lowercase letters (a–d) within S. Typhimurium CCARM 8009 (□, S. TyphimuriumS) are significantly different at P < 0.05. Asterisk (*) indicates significant difference between S. Typhimurium KCCM 40253 (S. TyphimuriumS) and S. Typhimurium CCARM 8009 (S. TyphimuriumR) at P < 0.05.

Download figure to PowerPoint

The relative expression patterns of acrA, acrB, filmA, hilA, invA, lpfE, ompD, stn, and tolc genes were observed in the planktonic and biofilm cells of S. TyphimuriumS and S. TyphimuriumR (Fig. 2). The relative gene expression levels of hilA and lpfE were increased in the planktonic cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 5.5 after 48-h incubation (Fig. 2a). The highest expression level (46.4-fold) was observed at the lpfE gene in S. TyphimuriumR grown in TSB at pH 5.5. The relative gene expression levels were higher in S. TyphimuriumR than in S. TyphimuriumS. The relative expression levels of acrB and tolC genes were increased 1.8- and 1.5-fold, respectively, in S. TyphimuriumR (Fig. 2a). As shown in Fig. 2b, the relative gene expression levels of hilA and lpfE were increased more than fivefold in the planktonic cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 7.3 after 48-h incubation. The greatest changes in gene expression, 18.8- and 18.1-fold, were observed at the lpfE gene in S. TyphimuriumS and S. TyphimuriumR, respectively. The relative expression levels of acrB, filmA, invA, and tolC genes were increased 2.3-, 2.9-, 1.8-, and 1.4-fold, respectively, in S. TyphimuriumS grown in TSB at pH 7.3. Similar to the planktonic cells, the relative expression of lpfE gene was increased more than twofold in the biofilm cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 5.5 after 48-h incubation (Fig. 2c). The relative expression level of hilA gene was increased 1.1-fold in the biofilm cells of S. TyphimuriumR at pH 5.5. As shown in Fig. 2d, the acrA, acrB, lpfE, stn, and tolC genes were stable in the biofilm cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 7.3. The relative expression levels of all genes were increased in the biofilm cells of S. TyphimuriumS grown in TSB at pH 7.3, except for the ompD gene (Fig. 2d).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study describes the gene expression dynamics of planktonic and biofilm-associated foodborne pathogens with multiple antibiotic resistance profiles when grown at different acidic pH ranges under anaerobic conditions. As antibiotic resistance is one of the major public health problems worldwide, this study sheds light on new approaches to the understanding of virulence properties of antibiotic-resistant pathogens exposed to stress conditions.

The antibiotic-resistant strains S. aureusR and S. TyphimuriumR grew well in TSB at pH 5.5 compared to the antibiotic-susceptible strains (Table 3), suggesting that the antibiotic-resistant strains can adapt better to acidic conditions than the antibiotic-susceptible strains can. The acid-adapted cells provide cross-protection against heat, pH, osmolarity, and antibiotics (Leyer & Johnson, 1993; Lee et al., 1994; Greenacre & Brocklehurst, 2006). The biofilm formation by antibiotic-susceptible strains (S. aureusS and S. TyphimuriumS) was significantly inhibited by pH 5.5 compared to the antibiotic-resistant strains (S. aureusR and S. TyphimuriumR) (Table 3). The results imply that acidic pH can negatively influence biofilm formation (Salsali et al., 2006). However, acid-adapted antibiotic-resistant bacteria can be more resistant to other environmental stresses (Leyer & Johnson, 1993; Lee et al., 1994; Greenacre & Brocklehurst, 2006; McKinney et al., 2009). The MIC values of biofilm cells of S. aureus KACC13236 grown in TSB at pH 5.5 and 7.3 were relatively greater for all antibiotics than the values for planktonic cells (Table 4), indicating that biofilm cells were significantly more resistant to antibiotics compared with the planktonic cells. The results are in good agreement with previous reports that biofilm formation was directly associated with the significant increase in antibiotic resistance of bacteria (Donlan & Costerton, 2002; Kim & Wei, 2007; Cho et al., 2008; Kwon et al., 2008). The antibiotic resistance of biofilm cells might be attributed to their structural and physiological properties, leading to the changes in membrane permeability and metabolic activity (Costerton et al., 1999; Donlan & Costerton, 2002; Stewart, 2002). Compared to pH 7.3, the planktonic and biofilm cells grown in TSB at pH 5.5 were highly susceptible to the antibiotics used in this study (Table 5). Acid stress can cause the changes in cellular membrane permeability, leading to increased susceptibility to antibiotics (Alakomi et al., 2000; Delcour, 2009).

The norB and mdeA genes were stable in S. aureusS and S. aureusR planktonic cells cultured at pH 5.5 (Fig. 1a). The enhanced resistance to multiple antibiotics is mediated by the relative gene expression associated with norB, norC, and mdeA genes in S. aureus (Huang et al., 2004; Truong-Bolduc et al., 2006; Ding et al., 2008). The gene expression stability of norB, norC, and mdeA in S. aureus planktonic cells may play an important role in antibiotic resistance under anaerobic conditions, resulting in an increased virulence in S. aureus exposed to the gastrointestinal tract. Staphylococcal enterotoxins, a family of pyrogenic toxin superantigen-carrying staphylococcal pathogenicity island, are the major causative agents of staphylococcal food poisoning (Lowry, 1998; Becker et al., 2003; Derzelle et al., 2009). The relative expression levels of norB, norC, mdeA, sec, seg, sei, sel, sem, sen, and seo genes were increased 23.9-, 7.7-, 2.8-, 3.4-, 4.5-, 6.6-, 16.4-, 36.4-, 6.3-, and 8.2-fold, respectively, in the biofilm cells of S. aureusR grown in TSB at pH 7.3 (Fig. 1d). The efflux pump and virulence-related gene expression may be changed during the biofilm formation by S. aureusR. This confirms a previous report that the antibiotic resistance of biofilm cells contributed to the enhanced virulence (Rajesh & Vandana, 2009; Hoiby et al., 2010). The hilA and lpfE genes were overexpressed in S. TyphimuriumS and S. TyphimuriumR planktonic cells cultured in TSB at pH 5.5 (Fig. 2a). This suggests that the adhesion and invasion ability of S. Typhimurium can be enhanced under acid stress conditions (Chowdhury et al., 1996). The acrB and tolC genes were stable in S. TyphimuriumR grown in TSB at pH 5.5 (Fig. 2a). The AcrAB-TolC system is responsible for the increased antibiotic resistance, invasion ability, and virulence (Piddock, 2006; Nikaido et al., 2008; Pages & Amaral, 2009). Therefore, the observations imply that S. TyphimuriumR can effectively extrude antibiotics under acidic stress conditions. The AcrAB-TolC pump system can lead directly to multiple antibiotic resistance in bacteria (Piddock, 2006). Salmonella Typhimurium cells causing foodborne salmonellosis can invade the small intestine, which plays a role in bacterial pathogenicity (Pfeifer et al., 1999). The stn gene in S. Typhimurium is responsible for the production of enterotoxin (Chopra et al., 1994, 1999).

In conclusion, this study highlights the differential gene expression of the planktonic and biofilm cells of S. aureus (S. aureusS and S. aureusR) and S. Typhimurium (S. TyphimuriumS and S. TyphimuriumR) exposed to acidic stress under anaerobic conditions. The most significant findings in this study were that (1) the biofilm cells of multiple antibiotic-resistant S. aureusR and S. TyphimuriumR were more resistant to acidic stress compared with the planktonic cells; (2) the biofilm-forming ability was increased in S. aureusR and S. TyphimuriumR grown in TSB at pH 5.5 and 7.3; and (3) the relative expression of toxin-, virulence-, efflux pump-related genes in the biofilm of S. aureusR and S. TyphimuriumR strains was distinct from that in the planktonic cells. The multiple antibiotic-resistant pathogens (S. aureusR and S. TyphimuriumR) were more likely to form the biofilm, possibly leading to cross-protection against environmental stresses and enhanced pathogenesis. Further study is needed taking molecular approaches to elucidate the relationship between biofilm formation ability and the virulence potential of antibiotic-resistant foodborne pathogens exposed to various environmental stress conditions.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (Grant No. 2011-0026113).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References