Preliminary molecular identification of cylindrospermopsin-producing Cyanobacteria in two Polish lakes (Central Europe)

Authors


Correspondence: Joanna Mankiewicz-Boczek, European Regional Centre for Ecohydrology a/u UNESCO Polish Academy of Sciences, 3 Tylna Str., 90-364 Łódź, Poland. Tel.: +48 42 681 70 07; fax: +48 42 681 30 69; e-mail: j.mankiewicz@erce.unesco.lodz.pl

Abstract

The presence of toxigenic cyanobacteria capable of biosynthesis of cylindrospermopsin (CYN) was measured in 24 water samples collected from the lakes Bytyńskie (BY) and Bnińskie (BN) in the Western Poland. The study also covered analysis of toxigenicity and production of CYN by the culture of Cylindrospermopsis raciborskii isolated from BY. The cyrJ gene associated with CYN production was identified in 22 water samples collected in the summer seasons of 2006 and 2007. The presence of CYN was confirmed in 16 samples. The homology searches revealed that amplified sequences of four water samples, which were selected from among all the samples, displayed a strong 99% homology to cyrJ gene of Aphanizomenon sp. 10E6. The culture of C. raciborskii did not contain the cyrJ gene nor the CYN. The specificity of C. raciborskii was confirmed by application of a fragment of the rpoC1. These first genetic analyses have shown that Aphanizomenon seems to be the main cyanobacterial genus responsible for the production of CYN in the Polish lakes. The lack of toxigenicity of the isolated C. raciborskii suggests that it is possible that this invasive species does not demonstrate toxigenic activity in Polish water bodies.

Introduction

Climate change increases water temperatures and nutrient concentration and hence the intensity of eutrophication. In consequence, global warming causes massive cyanobacteria bloom in many water bodies (Delpla et al., 2009; Nõges et al., 2011). Ultimately, cyanobacterial blooms and their toxins pose a serious threat to public health through water supply systems, recreation or agriculture, and to the natural environment. The problem of cyanobacteria responsible for the production of microcystins (MCs) belonging to the cyanobacterial hepatotoxins is common. In Poland, regular blooms with domination of microcystin-producing cyanobacteria Planktothrix agardhii or Microcystis aeruginosa and MCs concentration reaching 212.7 μg L−1 have been documented well (Pawlik-Skowrońska et al., 2008; Mankiewicz-Boczek et al., 2006; Mazur-Marzec et al., 2010). Recently, the occurrence of other cyanotoxin (representing the group of cytotoxins), cylindrospermopsin (CYN), with maximum 1.8 μg L−1, has been reported in the Western Poland (Kokociński et al., 2009). CYN is a stable alkaloid, which is able to inhibit synthesis of proteins. Liver is the main target of the CYN activity; however, other organs, such as kidneys, lungs, thymus, spleen, adrenal glands, intestinal tract, immune system and heart, might also be affected (Falconer, 1999; Carmichael, 2001; van Apeldoorn et al., 2007; Žegura et al., 2011). Moreover, CYN is genotoxic and probably more hazardous to human and animal health than MCs (Žegura et al., 2011). Therefore, it seems to be important not only to estimate the concentration of CYN in the water but also to determine the source of CYN to identify early warning signals and better prevention against the CYN-producing cyanobacteria.

In 1992, the strain of Cylindrospermopsis raciborskii from Australia was characterized as potent producer of CYN (Ohtani et al., 1992). So far the CYN-producing C. raciborskii strains have been isolated from Australian and Asian water bodies (Carmichael, 2001; Schembri et al., 2001; Fergusson & Saint, 2003; Mihali et al., 2008; Stüken & Jakobsen, 2010). Previous studies of the CYN producers conducted in Europe have not confirmed the presence of toxigenic strains of C. raciborskii capable of the CYN synthesis (Neilan et al., 2003; Haande et al., 2008; Antal et al., 2011). However, CYN was detected in Finland (Spoof et al., 2006), Germany (Fastner et al., 2007; Wiedner et al., 2008), the Czech Republic (Bláhová et al., 2008, 2009), Poland (Kokociński et al., 2009), France (Brient et al., 2009) and Italy (Messineo et al., 2010). In these cases, microscopic analysis indicated that suggested species of cyanobacteria that could produce CYN included: Anabaena lapponica in Finland (Spoof et al., 2006); Aphanizomenon sp., Aphanizomenon gracile, Aphanizomenon flos-aque and/or Anabaena sp. in Germany (Fastner et al., 2007; Wiedner et al., 2008); Aphanizomenon sp. including Aph. klebahnii in the Czech Republic (Bláhová et al., 2008, 2009); Aph. gracile and/or C. raciborskii in Poland (Kokociński et al., 2009); Aph. flos-aque and Anabaena planctonica in France (Brient et al., 2009); Aphanizomenon ovalisporum and/or C. raciborskii in Italy (Messineo et al., 2010). In further research, the possibility of using molecular analysis has allowed to determine toxigenic strains of cyanobacteria responsible for CYN production (Haande et al., 2008; Stüken & Jakobsen, 2010). However, in Europe, this information is still poor. Preußel et al. (2006) determined three single filaments of toxigenic Aph. flos-aque in two German lakes based on the presence of ps gene sequences. Description of the toxigenic strain of Oscillatoria from the Tarn River in France was based on the presence of cyrJ gene (Mazmouz et al., 2010). Additionally, that study indicated a high homology to cyr genes previously identified for C. raciborskii strains isolated from Australian water bodies (Mihali et al., 2008). The presence of cyr genes (cyrA/aoaA and cyrB/aoaB) was also confirmed for the strains of Aphanizomenon sp. in Germany (Stüken & Jakobsen, 2010). Recently, CYN synthetase gene (pks) was detected in one of the samples contained C. raciborskii from the Vela Lake in Portugal (Moreira et al., 2011). However, the presence of CYN was not described.

In Poland, as it has already been mentioned, the presence of CYN was described in two shallow eutrophic lakes: Bytyńskie (BY) and Bnińskie (BN) located in the western part of the country (Kokociński et al., 2009). Microscopic analysis indicated Aph. gracile and/or C. raciborskii as potential producers of CYN in the studied water samples. In the present study, in which the genetic analyses were used for the first time (to the best of our knowledge), the previous research has been followed up to confirm and develop this theory. The possibility of using cyrJ gene for early warning of CYN-producing cyanobacteria was also tested. Moreover, the objective of the study included an analysis of genetic identity of Polish cyanobacterial samples with known genomic sequences of CYN-producing cyanobacteria based on cyrJ gene product and characterization of the strain of C. raciborskii, which was isolated from the Polish lake for the first time, with respect to its toxigenicity and ability to produce CYN.

Materials and methods

Study site and sampling

The studies were conducted in two lakes: Bytyńskie (BY) and Bnińskie (BN). These water bodies are shallow, polymictic and highly eutrophic and are located in the Wielkopolska Region (in the Western Poland). The BN and BY lakes are large water bodies with the surface of 225 and 308 ha, respectively. They are surrounded by agricultural catchment areas and used for recreational purposes. In total, 24 samples containing cyanobacteria were collected for further genetic analyses. They were obtained from the surface water layer of the BY and BN lakes between July and October in 2006 and 2007.

Cyanobacterial culture

The C. raciborskii strain was isolated from the water sample collected in Bytyńskie Lake in September 2007. Using a micropipette, single filaments of C. raciborskii were collected from the phytoplankton sample and transferred to culture flasks containing sterile BG-11 media. This procedure was repeated until monoculture of this cyanobacteria was obtained. The isolates were incubated at 21 °C under 80 μmol photon m−2 s−1 irradiance using cool white fluorescent light with a photoperiod of 12 h dark and 12 h light. The strains are maintained in the culture collection at the Department of Hydrobiology of Adam Mickiewicz University in Poznań.

CYN analysis by HPLC-diode-array UV detection

The chromatographic separation was done using an Agilent (Waldbronn, Germany) 1100 series HPLC system consisting of degasser, quaternary pump, autosampler, thermostated column and a diode-array detector according to Kokociński et al. (2009). The CYN occurred in the sample that was identified by retention time and UV spectrum with reference to the pure CYN standard (certified reference material from NCR-IMB, Halifax, Canada) and quantified based on a calibration curve prepared with nine different concentrations of the standard (0.049–9.1 μg mL−1). The detailed description of CYN concentration in 24 water samples taken from BY and BN lakes, with exception of the C. raciborski culture from BY, has been presented in our previous publication (Kokociński et al., 2009).

DNA extraction

The total genomic DNA was extracted from 24 water samples and the C. raciborski culture from BY according to the methodology by Giovannoni et al. (1990), with some modifications. For the centrifugation, the speed of 13 000 g instead of 10 000 g was used. For the enzymatic lysis step, a final concentration of proteinase K (Fermentas, Lithuania) of 275 μg mL−1 was used instead of 160 μg mL−1. During the phenol/chloroform step, a volume of chloroform/isoamyl alcohol (24 : 1) equal to the volume of supernatant was used.

CyrJ gene PCR amplification

The fragment of sulfotransferase gene cyrJ (578 bp) was amplified in 22 water samples with the primer pair cynsulfF (5′-ACTTCTCTCCTTTCCCTATC-3′) and cylnamR (5′-GAGTGAAAATGCGTAGAACTTG-3′) described previously by Mihali et al. (2008) (Table 1). The PCR was performed in a 20-μL reaction mix containing 1× PCR buffer (Qiagen), 2.5 mM MgCl2, 0.2 mM dNTPs (Qiagen), 10 pmol μL−1 of each primer, 0.2 μL of DNA (DNA concentration was in the of 24–187 ng) and 0.8 U of Taq DNA polymerase (Qiagen). The initial denaturation step at 94 °C for 3 min was followed by 30 cycles of DNA denaturation at 94 °C for 10 s, primer annealing at 57 °C for 20 s, strand extension at 72 °C for 1 min and final extension step at 72 °C for 7 min. PCR products were separated by 1.5% agarose gel electrophoresis. The presence of the cyrJ gene was checked in all 24 water samples collected from BY and BN, and the C. raciborski culture from BY.

Table 1. List of primers used in this study
Name of determinant PrimerSequence (5′–3′)Size (bp)References
Sulfotransferase genecyrJcynsulfFACTTCTCTCCTTTCCCTATC578Mihali et al. (2008)
cylnamRGAGTGAAAATGCGTAGAACTTG
C. raciborski-specific generpoC1cyl2GGCATTCCTAGTTATATTGCCATACTA308Yilmaz et al. (2008)
cyl4GCCCGTTTTTGTCCCTTTGCTGC
Internal control fragmentICFcyl-intTATTGCCATACTACCTGGTAATGCTGACACACTCG247Yilmaz et al. (2008)
cyl2GGCATTCCTAGTTATATTGCCATACTA
cyl4GCCCGTTTTTGTCCCTTTGCTGC

CyrJ gene sequence analysis

PCR-generated fragment of cyrJ from four of 24 water samples (BY 18 August 2006; BN 18 August 2006 and BY 30 August 2007; BN 30 August 2007) was used for sequencing. Although PCR and amplification conditions were different than described in subchapter 2.5., the PCRs were performed in 50-μL reaction volumes containing 1× Pfu polymerase buffer with 2 mM MgCl2, 0.2 mM dNTPs, 10 pmol μL−1 each of the forward cynsulfF and reverse cylnamR primers, 1 μL of DNA (DNA concentration was in the of 319–934 ng) and 1.25 U of thermostable Pfu DNA polymerase (Fermentas). Cycling began with a denaturing step at 95 °C for 3 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s and extension at 72 °C for 1 min. Amplification was completed by a final extension step at 72 °C for 7 min. Purified PCR products were cloned into a pJET1.2/blunt vector (Fermentas). Expected length of the PCR products cloned was confirmed by restriction analysis using BglII restriction enzyme and agarose gel electrophoresis. The constructs prepared were then subjected to a sequence analysis. The homology searches were performed using the National Center for Biotechnology Information microbial and nucleotide blast network service (http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Zhang et al., 2000).

Cylindrospermopsis raciborskii-specific PCR

A modified protocol of PCR based on amplification of C. raciborskii-specific rpoC1 gene fragment, developed by Wilson et al. (2000), was used for the specific identification of C. raciborskii in two of 24 water samples from BY and BN lakes (BY 18 August 2006; BN 18 August 2006) and the C. raciborskii culture from BY. The cyl2, cyl4 and cyl-int primers as well as the preparation of internal control fragment (ICF) were described previously by Wilson et al. (2000) (Table 1). The ICF was constructed by performing PCRs with cyl-int and cyl4, and the PCR product was used in a final PCR with cyl2 and cyl4 to give a 247-bp ICF (Table 1). PCRs were performed in 50-μL reaction volumes containing 1× AccuPrime PCR Buffer II with 2 mM MgCl2 and 0.2 mM dNTPs, 10 pmol μL−1 of cyl2 and cyl4 primers, genomic DNA and 1 U of AccuPrime Taq High Fidelity DNA polymerase (Invitrogen) and 200 fg of ICF. Cycling began with a denaturing step at 94 °C for 1 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s and extension at 68 °C for 30 s. Amplification was completed by the final extension step at 68 °C for 2 min. PCR products were separated by 1.5% agarose gel electrophoresis.

Results and discussion

CyrJ screening confirmed the presence of CYN-producing cyanobacteria in the Polish lakes

The sulfotransferase cyrJ gene required for tailoring reaction to complete the biosynthesis of the CYN was applied to assess the toxigenic potential of 24 water samples collected from Bytyńskie (BY) and Bnińskie (BN) lakes. The cyrJ gene was identified in 10 water samples from BY, and only two water samples collected at the beginning of the monitoring period in 2007 did not contain cyrJ gene (Table 2). However, in both samples, no CYN was found in the cells. In BN, the cyrJ gene was identified in all 12 water samples (Table 2). The presence of toxigenic cyanobacteria capable of producing cytotoxin throughout the season corresponded with the occurrence of CYN in 11 samples, with one exception, at the beginning of the monitoring period, that is, in the samples collected on 25 July 2007 (Table 2). Summing up the cyrJ gene was detected in 22 of 24 investigated water samples. That observation indicated that the producers of CYN appear to be widespread in both lakes in the Western Poland (Table 2). The PCR analysis of the water samples confirmed that cyrJ, which was originally recommended by Mihali et al. (2008) as a good candidate for determination of the toxin probe, can also be used for early detection of CYN-producing cyanobacteria in Polish lakes. In the study of Mihali et al. (2008), the screening of CYN-producing and nonproducing strains of C. raciborskii, Anabaena circinalis and Aph. ovalisporum revealed that the cyrJ sulfotransferase gene was present only in CYN-producing strains (Mihali et al., 2008). Mihali et al. (2008) emphasized that cyrJ gene is more specific than common cyanobacterial genes of NRPS (nonribosomal peptide synthetase) and PKS (polyketide synthase) and therefore can give fewer cross-reactions with other gene clusters. The results described, represent the first, to our best knowledge, genetic evidence for the occurrence of the CYN-producing cyanobacteria in Polish water bodies and the second, after German lakes, in the Central Europe.

Table 2. Occurrence of cylindrospermopsin-producing cyanobacteria and CYN concentration
Year LakeDateCylindrospermopsin-producing cyanobacteriaacyrJ (578 bp)CYN [μg L−1]a
  1. CYN, cylindrospermopsin; +, CYN-producing/gene present; −, CYN-non-producing/gene absent; S, gene sequences.

  2. a

    Data described in detail in our earlier publication (Kokociński et al., 2009).

2006Bnińskie (BN)26 JulyAphanizomenon aphanizomenoides, Aphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
7 AugustAphanizomenon flos-aquae, Aphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
18 AugustAphanizomenon flos-aquae, Aphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+ S+
13 SeptemberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
2 OctoberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
16 OctoberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
Bytyńskie (BY)26 JulyAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+
7 AugustAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
18 AugustAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+ S+
13 SeptemberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
2 OctoberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
16 OctoberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
2007Bnińskie (BN)25 JulyPlanktothrix agardhii+
16 AugustAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
30 AugustAphanizomenon aphanizomenoides, Aphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+ S+
18 SeptemberAphanizomenon aphanizomenoides, Aphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
30 SeptemberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+ +
18 OctoberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii++
Bytyńskie (BY)25 JulyAphanizomenon gracile, Planktothrix agardhii
16 AugustAphanizomenon gracile, Planktothrix agardhii
30 AugustAphanizomenon gracile, Planktothrix agardhii+ S
18 SeptemberAphanizomenon gracile, Planktothrix agardhii+
30 SeptemberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+
18 OctoberAphanizomenon gracile, Cylindrospermopsis raciborskii, Planktothrix agardhii+
Laboratory culture (BY)2007Cylindrospermopsis raciborski

Aphanizomenon sp. participate in CYN production in the Polish lakes

To identify the source of cyrJ gene detected in our water samples, the PCR products from two samples from BY and two samples from BN, collected on 18 August 2006 and 30 August 2007, were subjected to cloning and sequencing. All the PCR products had the same nucleotide sequence. The blast homology search revealed that this sequence is in 99% similar to cyrJ gene of C. raciborskii and Aphanizomenon sp. However, all the sequenced samples carry the 6-nucleotide fragment, specific for cyrJ gene of Aphanizomenon sp., which is not present in relevant sequence in C. raciborskii genome (Fig. 1). Therefore, it may be concluded that all the PCR products were amplified based on cyrJ gene of Aphanizomenon sp.

Figure 1.

The 6-nucleotide sequence of cyrJ gene specific for Aphanizomenon sp. strain 10E6. Alignment of the DNA sequence fragment (24 bp) of the cyrJ gene amplified on DNA isolated from Bninskie lake on August 2006 (BN 18 August 2006) (shown as representative sequence of all four subjected to sequencing); the cylindrospermopsin gene cluster of Aphanizomenon sp. strain 10E6 (GenBank accession number GQ385961) and cyrJ gene of Cylindrospermopsis raciborskii strain CS-505 (GenBank accession number ACYA01000027.1).

The activity of Aphanizomenon genus in the production of CYN was previously observed in the sample containing Aph. ovalisporum (pks/ps and cyrJ genes) or Anabaena bergii (pks/ps genes) obtained from Australian cultures (Schembri et al., 2001; Fergusson & Saint, 2003; Mihali et al., 2008). In the Western Asia, India, the aoaA gene encoding an amidinotransferase from the CYN-producing Aph. ovalisporum strain isolated from Kinneret Lake (Shalev-Alon et al., 2002) was identified for the first time. Yilmaz et al. (2008) showed that Aph. ovalisporum isolated from a fishpond in Jacksonville, Florida (USA, North America), had genes (pks/ps) putatively associated with the CYN production. In European water bodies, the toxigenic activity and biosynthesis of CYN by Aphanizomenon sp. including Aph. flos-aque were confirmed in previous studies of German water bodies based on identification of ps gene (Preußel et al., 2006) or cyrA/aoaA gene (Stüken & Jakobsen, 2010). Additionally, significant correlations between the particulate CYN concentrations and species biovolume were found for Aph. gracile (rs = 0.803) in Langer See, a lake located in Northern Germany (Wiedner et al., 2008).

In the present research, Aph. gracile occurred in all the water samples containing cyrJ gene with one exception (BN, 25 July 2007) when the lowest total biomass of phytoplankton in both study periods was observed (Kokociński et al., 2009) (Table 2). However, other species of Aphanizomenon also occurred in the investigated lakes (Table 2). Therefore, to determine which of the species of Aphanizomenon, and among them, which of the strains participated in the production of CYN, it is necessary that further research based on genetic analyses and cyanobacterial cultures should be performed.

Nontoxic C. raciborskii collected from the Polish lake

The genetic analysis of DNA from culture of C. raciborskii from BY did not confirm the presence of cyrJ. HPLC analysis did not confirm the presence of CYN in the cells either (Table 1, Fig. 2). The specificity of the strain analysed was confirmed by application of C. raciborskii-specific PCR amplifying 305 bp fragment of rpoC1 (Fig. 2). These results indicated that the studied C. raciborskii culture had no toxic properties and CYN was not produced.

Figure 2.

Cylindrospermopsis raciborskii-specific PCR based on amplification of rpoC1 gene (305 bp) (a) and PCR amplification of cyrJ gene (578 bp) (b). Genomic DNA from C. raciborskii (C.r.) laboratory culture and environmental samples from Bytyńskie (BY) and Bnińskie (BN) lakes (18 August 2006) were used. M, marker ΦX174 DNA-HaeIII digest; NC, negative control.

Conclusions

The sulfotransferase cyrJ gene, which is an important part of the gene cluster responsible for the CYN biosynthesis, was detected almost in all the study water samples collected from two lakes: Bnińskie and Bytyńskie in the Western Poland. That result indicated a regular occurrence of potential producers of CYN in study lakes during the summer period. Production of CYN was a consequence of the occurrence of the CYN-producing cyanobacteria. This preliminary genetic research of Polish lakes, which represent only a few research of this type in Europe, indicated Aphanizomenon sp. as the main CYN producer. C. raciborskii isolated from Bytyńskie did not contain the cyrJ gene nor the CYN. Based on the data of strains analyses performed in Germany (Fergusson & Saint, 2003; Mihali et al., 2008; Stüken & Jakobsen, 2010), Hungary (Mihali et al., 2008; Stüken & Jakobsen, 2010; Vasas et al., 2010) and Poland, we may assume that the strains of C. raciborskii capable of biosynthesis of CYN do not appear in water bodies of temperate climate.

Acknowledgements

This research was funded by Polish Ministry of Science and Higher Education (Grant No. N304 020437).

Ancillary