SEARCH

SEARCH BY CITATION

Keywords:

  • catR promoter;
  • AlX reporter gene;
  • Aspergillus niger

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References

Aspergillus niger represents a promising host for the expression of recombinant proteins, but only a few expression systems are available for this organism. In this study, the inducible catalase promoter (PcatR) from A. niger was characterized. For this, constructs were developed and checked for the expression of the alkaline xylanase gene transcriptionally fused under the cat R promoter. Two versions of the catalase (catR) promoter sequence from A. niger (Pcat300,Pcat924) were isolated and tested for their ability to drive expression of the alkaline xylanase (alx) gene. Pcat924 showed better efficiency (more than 10-fold increase in AlX activity compared to Pcat300) under the optimized culture conditions. Induction of the catR promoter with 0.20% H2O2 and 1.5% CaCO3 in the culture medium, further increased expression of AlX 2.61- and 2.20-fold, respectively, clarifying its inducible nature. Specific induction or repression of the catR promoter provides the possibility for utilization of this promoter in heterologous protein production.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References

Filamentous fungi have been used for decades as major producers in the pharmaceutical, food, and food processing industries because of their GRAS (‘generally recognized as safe’ in the terminology of the US Food and Drug Administration) status, and their ability to secrete large amounts of protein. Previous studies suggested that Aspergillus niger is an ideal host organism for production of recombinant proteins (Roberts et al., 1992; Tellez-Jurado et al., 2006; Karnaukhova et al., 2007; Zhang et al., 2008). For the efficient production of the recombinant protein, strong promoter sequences are required. Various promoters of different categories have been reported from many filamentous fungi. Inducible promoters which are not affected by catabolite repression include endoxylanase (exl A) from Aspergillus awamori (Gouka et al., 1996) and TAKA amylase (amyA) from Aspergillus oryzae (Tsuchiya et al., 1992). Among the strongest inducible promoters regulated by carbon catabolite repression are the glucoamylase A promoter (glaA) of A. niger var. awamori (Ward et al., 1990) and the Trichoderma reesei cellobiohydrolase 1 (cbh1) promoter (Ilmen et al., 1996). A constitutive promoter used across fungal species is the Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase gpdA (Punt et al., 1992). Till 2007, only the glucoamylase A promoter (glaA) from A. niger has been used for the expression of heterologous proteins. Recently, a new inducible promoter Psuc1 from A. niger AB1.13 was characterized (Roth et al., 2007). To obtain a new, promising promoter for the expression of heterologous protein production, we targeted promoter of catR gene from A. niger because some strains of A. niger are efficient producers of catalase. It is anticipated that a high catalase producer might have a strong promoter and as such, there are no reports on the use of catR promoter in expression systems. Hence it is a legitimate target for cloning and exploitation. In this attempt, we developed the constructs and checked the expression of alkaline xylanase gene transcriptionally fused under the catR promoter from A. niger and also addressed the length and nature of the catR promoter.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References

Extraction of genomic DNA

Aspergillus niger taken from the culture collection of IIIM, Jammu, was used throughout the study (Traeger et al., 1991). The strain of A. niger used in the study was maintained on potato dextrose agar (PDA). For extraction of total genomic DNA, the fungus was grown for 3 days in Sabouraud's broth at 28 °C. DNA was isolated from A. niger using a modified TES method (Mahuku, 2004).

Construction of promoter-less xylanase/pAN56-1 plasmid vector

Promoter-less xylanase/pAN56-1 plasmid vector was developed in the following steps.

  1. Construction of pAN7-1 (ClaI). A polylinker was designed to create a unique ClaI site in the EVpAN7-1 vector. The nucleotide sequence of the double stranded primer was: 5′-GCTCTAGAATCGATTCTAGAG C-3′. Two primers were annealed and digested with ClaI and cloned in XbaI site of EVPAN7-1 vector. The vector was now called pAN7-1 (ClaI) (Fig. 1).
  2. Construction of pAN56-1 (SalI-NcoI). A polylinker was designed to create multiple cloning sites (SalI-NotI-EcoRV and NcoI) to introduce the promoter 5′-ACGCGT CGACCCATCGATGGGCGGCCGCGATATCCCATGGCA TG 3′. Two primers were annealed and digested with SalI and NcoI, and then cloned into SalI- and NcoI-digested alkaline xylanase vector pAN56-1 (alx xylanase-truncat) to construct the pAN56-1 (SalI-NcoI) (Fig. 1). The alkaline xylanase is from Actinomadura sp.
  3. Construction of promoter-less xylanase/pAN56-1-vector. pAN7-1 (ClaI) and pAN56-1 (SalI-NcoI) were digested by SalI and ClaI separately. A smaller fragment (around 2121 bp) from plasmid pAN7-1 (ClaI) containing the selection marker, i.e. hygromycin gene, was ligated to the linearized pAN56-1 (SalI-NcoI) containing multiple cloning site (MCS), reporter gene (alkaline xylanase from Actinomorpha), gluco-amylase terminator, ampicillin gene, a selection marker for Escherichia coli and ori for replication in E. coli. Finally, the constructed vector was digested by various restriction enzymes (viz. SalI plus EcoRV, BamHI plus EcoRI, NcoI, ClaI, NotI) to confirm the availability and functionality of different restriction sites.
image

Figure 1. Construction of promoter-less xylanse/pAN56-1 vector. hyg, hygromycin resistance marker; AlX, alkaline xylanase gene; ori, Escherichia coli origin of replication.

Download figure to PowerPoint

Amplification, cloning and sequencing of catR promoters (Pcat300, Pcat924)

As the region between −562 and −318 regulates the high level expression of glaA (Fowler et al., 1990), catR promoter was also analyzed within 1000 bp upstream of the starting ATG. The effect of the CAAT motif was evaluated particularly with reference to Pcat300 and Pcat924 as the former does not contain the CAAT sequence (Pcat300), whereas Pcat924 has CAAT motifs. The catR promoters (Pcat300, Pcat924) were amplified from A. niger genomic DNA by PCR using the primers cat300F (5′-ACTTGTTGTGGTGATCTTGAGCA-3′) and cat300R (5′-GCATGGCGGAGTAAACGAA-3′) and cat924F (5′-AGGTTTAGTGAAGGAACACCCGTGGCGAGT-3′) and cat924R (5′-GCATGGCGGAGTAAACGAA-3′) synthesized by M/S Sigma USA. Primers were designed on the basis of the complete genome sequence of wild-type A. niger ATCC 1015 strain. For PCR amplification, 20 ng of DNA, 10 pmol of each primer, 200 μM dNTP mix, 1 U of Taq DNA polymerase (Bangalore Geneii, India) with reaction buffer supplied by the manufacturer were used. Amplification was performed in a 20-μL reaction volume in a Thermocycler (Eppendorf, Germany). Cycling parameters for Pcat300 were 3 min of denaturation at 95 °C followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min. Cycling conditions for Pcat924 were the same as Pcat300 except for the annealing temperature (60 °C). The PCR product was analyzed in a 2% agarose gel and purified from the gel using the gel extraction kit (Qiagen). The purified fragment was then inserted into the cloning vector (pGEMT; Promega) to confirm their identity. Plasmid isolation and purification were done using the Wizard plus SV Minipreps DNA purification system (Promega). The presence of insert in the plasmid was checked by double digestion with restriction enzymes NotI plus NcoI. Plasmid containing the insert was sequenced using an automatic DNA Sequencer (310 Genetic Analyser; Applied Biosystems, Foster City, CA).

Cloning of catR promoter fragments in promoter-less xylanase/pAN56-1

The catR promoters (Pcat300, Pcat924) were then inserted into the promoter-less xylanase/pAN56-1 plasmid to check their functionality. Pcat300 and Pcat924 were re-amplified using the above-mentioned primers and Pfu DNA polymerase to get blunt-ended amplified products. Promoter-less xylanase/pAN56-1 vector was digested with EcoRV and de-phosphorylated. Digested and de-phosphorylated vector was ligated to Pfu-amplified Pcat300 and Pcat924 promoter fragments. Both ligated mixtures were electroporated in JM110-competent cells using gene pulser (Bio-Rad). The plasmids were isolated with Qiagen's spin column according to the instructions of the manufacturer. The presence of insert in the plasmids and orientation of the Pcat300 and Pcat924 in promoter-less xylanase/pAN-56-1 was checked by digestion with NcoI.

Transformation of A. niger

Transformation of A. niger by constructs (Pcat300/xylanase/pAN56-1, Pcat924/xylanase/pAN56-1) was carried out by electroporation as described by Sanchez & Aguirre (1996). Transformed spores were spread on minimal medium agar plates containing 175 μg mL−1 hygromycin (Biogene; Imperial Biomedics) as the selective agent, and incubated at 37 °C (Tilburn et al., 1983; Malardier et al., 1989). Transformants were observed after 36–48 h at 37 °C. Individual clones were transferred to fresh Sabouraud's/hygromycin plates. Genomic DNA of putative transformants was extracted and amplified by the E. coli ori primers (Varadarajalu & Punekar, 2005) to confirm that each construct had been integrated into the genome of A. niger.

Screening of transformants for alkaline xylanase activity

The transformants were further evaluated quantitatively for xylanase production by growing in seed medium under shaking conditions (200 rpm) for 48 h at 28 °C (inoculum size was 2 × 106 spores per flask) and then 10% inoculum was transferred in wet wheat bran (production medium pH 6.0) under static conditions for 96 h. The AlX enzyme from production medium was extracted by shaking at 30 °C for 2 h using 0.05 M phosphate buffer (pH 8.0) and filtered through a wet muslin cloth by squeezing. The extract was centrifuged at 6000 g for 5 min. Clear supernatant sample from each transformant was taken and used for the enzyme assay. Xylanase activity was estimated by quantifying the release of reducing sugar and expressed in terms of IU mL−1 (Gupta et al., 2000). One international unit of enzyme activity was defined as the amount of enzyme required to release 1 μmol reducing sugar mL−1 min−1 under the assay conditions. Released reducing sugar was determined using known amounts of xylose as a standard. All of the experiments were performed in triplicate. Specific AlX activity was expressed as U mg−1 protein. Protein was determined by the Bradford assay (Bradford, 1976) using bovine serum albumin as a standard (Bio-Rad Laboratories, Hercules, CA).

Effect of different seed media on AlX activity

The effect of different seed media on AlX production was investigated by growing 10 representative transformants (A1–A10 containing Pcat300/xylanase/pAN56-1; K1–K10 containing Pcat924/xylanase/pAN56-1) of both the constructs in Sabouraud's (glucose 40 g L−1, peptone 10 g L−1; pH 6.0)/wheat flour medium (Maida 55.2 g L−1, Soya Peptone 4.08 g L−1, Mono ammonium phosphate 0.2 g L−1, copper sulphate 0.08 g L−1; pH 6.0). After 48 h, inoculums were transferred in production medium as described above.

Effect of different inducers on reporter gene (AlX) activity

One selected transformant (K6) harboring Pcat924/xylanase/pAN56-1 was subjected to various inducing conditions and the expression pattern of AlX was analysed. H2O2, CaCO3 and a combination of both were used as inducers in the study. The inducers were added to the seed media in which K6 was grown. Different concentrations of the inducers were used to determine the optimum concentration required for the maximum reporter gene activity.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References

Construction of Pcat300/xylanase/pAN56-1 and Pcat924/xylanase/pAN56-1

The promoter-less xylanase/pAN56-1 vector was constructed using EVPAN7-1 and pAN56-1 alk-xylanase (truncated) (Fig. 1). Pcat300 and Pcat924 were amplified by using specific primers, cloned and sequenced (Fig. 2). Pcat300 and Pcat924 were cloned in promoter-less xylanase/pAN-56-1 to check the functional activity of Pcat300 and Pcat924 (Fig. 3a). Constructs (Pcat300/xylanase/pAN56-1 and Pcat924/xylanase/pAN56-1) were transformed in A. niger. Genomes of putative transformants were initially screened for the presence of introduced construct using the E. coli ori primers, which amplified a 400-bp fragment from all the transformants, confirming that the construct was integrated successfully in the genome of the host, whereas from the host there was no amplification (data not shown; Fig. 3b).

image

Figure 2. Sequence of the catR promoter of the Aspergillus niger highlighting the TATA-, CAAT- motifs in gray, heat shock transcription factor motifs in bold and italics, and cre motifs in bold, highlighted and underlined with double line. Nucleotides are numbered from the putative translation initiation codon (ATG) indicated as −1 above.

Download figure to PowerPoint

image

Figure 3. (a) Restriction digestion of promoter-less xylanase/pAN56-1 vector. (b) Integration of construct in Aspergillus niger genome and Scheme to confirm the integration of construct in A. niger genome by using the Escherichia coli ori primers.

Download figure to PowerPoint

Screening of transformants for alkaline xylanase activity

Effect of seed media on the AlX expression

To study the regulation of catR promoter, the transformants were grown in two different seed media (Sabouraud's and wheat flour media) to check the effect of seed media composition on the expression of AlX. In Sabouraud's media, the AlX-specific activity profile of the transformants carrying Pcat(300) xylanase/pAN56-1, and Pcat924bp xylanase/pAN56-1 constructs are shown in Table 1. The activity was in the range of 41.91–91.4 U mg−1. Among the transformants carrying Pcat(300) xylanase/pAN56-1, A8 showed maximum 3.21-fold increase in specific activity compared to transformant containing promoter-less xylanase/pAN-56-1, whereas A5 showed the minimum change, with a 1.86-fold increase in specific activity. Transformant K5 containing Pcat924/xylanase/pAN56-1 construct showed the highest specific activity, with a 3.64-fold increase compared to transformant containing the promoter-less xylanase/pAN-56-1.

Table 1. AlX activity of transformants in Sabouraud's medium followed by wheat bran. Bold values depicts the highest fold increase in xylanase activity
TransformantsSpecific activity (IU mg−1)Fold increase with respect to P0xylanase/pAN56-1
Pcat300xylanase/pAN56-1#A154.28 ± 0.252.16
Pcat300xylanase/pAN56-1#A251.83 ± 0.352.06
Pcat300xylanase/pAN56-1#A367.85 ± 0.382.70
Pcat300xylanase/pAN56-1#A449.03 ± 0.181.95
Pcat300xylanase/pAN56-1#A546.66 ± 0.161.86
Pcat300xylanase/pAN56-1#A664.61 ± 0.252.57
Pcat300xylanase/pAN56-1#A754.31 ± 0.272.16
Pcat300xylanase/pAN56-1#A880.74 ± 0.363.21
Pcat300xylanase/pAN56-1#A974.05 ± 0.382.95
Pcat300xylanase/pAN56-1#A1075.86 ± 0.233.02
Pcat924xylanase/pAN56-1#K154.21 ± 0.452.16
Pcat924xylanase/pAN56-1#K241.91 ± 0.551.67
Pcat924xylanase/pAN56-1#K346 ± 0.521.83
Pcat924xylanase/pAN56-1#K452.25 ± 0.382.08
Pcat924xylanase/pAN56-1#K591.4 ± 0.483.64
Pcat924xylanase/pAN56-1#K648.33 ± 0.281.92
Pcat924xylanase/pAN56-1#K751.84 ± 0.372.06
Pcat924xylanase/pAN56-1#K845.53 ± 0.541.81
Pcat924xylanase/pAN56-1#K962.59 ± 0.462.49
Pcat924xylanase/pAN56-1#K1053.2 ± 0.502.12
P0xylanase/pAN56-125.08 ± 0.22 

There was a significant change in the activity profile when wheat flour medium was used (Table 2). A8 showed the maximum change, with a 3.95-fold increase in the specific activity, whereas A5 showed the minimum change, with a 2.78-fold increase in the specific activity compared to the transformant harboring promoter-less xylanase/pAN-56-1. The activity of the transformant K5 carrying the Pcat924/xylanase/pAN56-1 showed the maximum change, with a 10.3-fold increase in the specific activity compared to the transformant harboring the promoter-less xylanase/pAN-56-1, whereas transformant K2 showed the least, with a 2.91-fold increase in specific activity. The results clearly depicted that AlX was expressed 6.35-fold more under the Pcat924 promoter in comparison with Pcat300.

Table 2. AlX activity of transformants in wheat flour medium followed by wheat bran. Bold values depicts the highest fold increase in xylanase activity
TransformantsSpecific activity (IU mg−1)Fold increase with respect to P0xylanase/pAN56-1
Pcat300xylanase/pAN56-1#A15.75 ± 0.152.85
Pcat300xylanase/pAN56-1#A27.32 ± 0.043.63
Pcat300xylanase/pAN56-1#A36.92 ± 0.283.43
Pcat300xylanase/pAN56-1#A47.17 ± 0.063.56
Pcat300xylanase/pAN56-1#A55.61 ± 0.102.78
Pcat300xylanase/pAN56-1#A67.34 ± 0.053.64
Pcat300xylanase/pAN56-1#A76.81 ± 0.093.38
Pcat300xylanase/pAN56-1#A87.94 ± 0.343.95
Pcat300xylanase/pAN56-1#A96.22 ± 0.153.09
Pcat300xylanase/pAN56-1#A107.67 ± 0.0353.80
Pcat924xylanase/pAN56-1#K16.4 ± 0.343.18
Pcat924xylanase/pAN56-1#K25.85 ± 0.202.91
Pcat924xylanase/pAN56-1#K38.89 ± 0.254.42
Pcat924xylanase/pAN56-1#K46.18 ± 0.353.07
Pcat924xylanase/pAN56-1#K520.72 ± 0.4010.3
Pcat924xylanase/pAN56-1#K68.57 ± 0.354.26
Pcat924xylanase/pAN56-1#K711.06 ± 0.255.5
Pcat924xylanase/pAN56-1#K810.7 ± 0.235.32
Pcat924xylanase/pAN56-1#K99.83 ± 0.344.89
Pcat924xylanase/pAN56-1#K1013.04 ± 0.366.48
P0xylanase/pAN56-12.01 ± 0.120 
Effect of inducers on AlX activity

The effect of inducers on AlX activity in K6 was examined. The inducers used in this study were H2O2, CaCO3 and a combination of both. The inducers were added to the seed media. Optimal concentration of the inducer was determined for the maximum activity of the reporter gene. 0.1, 0.15, 0.20 and 0.25% (v/v) of H2O2 were used to examine the enzyme production. The maximum increase of 9.62-fold in specific activity was observed at 0.20% (v/v) H2O2 (Fig. 4), when compared to control 2 (transformant harboring promoter-less xylanase/pAN56-1) and a 2.61-fold increase in specific activity was observed when compared to control 1 (K6 transformant harboring Pcat(924) xylanase/pAN56-1 but grown without inducer).

image

Figure 4. Effect of different inducers and their concentrations on AlX activity of transformant K6. The AlX activity of the K6 transformant grown with inducers was compared with K6 transformant grown under non-induction conditions (control 1) and transformant harboring promoter-less construct (control 2).

Download figure to PowerPoint

Induction of the promoter by CaCO3 was also studied using various concentrations (1.5%, 2.5%, 3.5% and 4.5%) of CaCO3. There was an appreciable decrease in AlX activity when the concentration of CaCO3 was increased from 1.5% to 4.5% (Fig. 4). The maximum increase in specific activity of 8.11-fold compared to control 2 and 2.20-fold compared to control 1, was seen with 1.5% CaCO3.

Combinations of H2O2 and CaCO3 (0.1% H2O2 + 1.5% CaCO3, 0.15% H2O2 + 2.5% CaCO3, 0.20% H2O2 + 3.5% CaCO3, 0.25% H2O2 + 4.5% CaCO3) were investigated. The maximum increase of 7.59-fold in specific activity compared to control 2 and 2.06-fold compared to the control 1 was observed at 0.20% H2O2 + 3.5% CaCO3 (Fig. 4). Therefore, it appears that each of the two inducers is involved in co-operative regulation of catR promoter.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References

In this study, we sought to exploit catR promoter to produce recombinant protein. For this purpose, two promoters of different lengths. Pcat300 and Pcat924, were amplified and cloned in promoter-less xylanase/pAN56-1 vector. The ability drive the expression of alx gene was evaluated for both transformants harboring Pcat(300) xylanase/pAN56-1 and Pcat924bp xylanase/pAN56-1. Expression of AlX in all transformants suggested that Pcat(300) contained the sequences required to initiate the start of transcription. Different AlX activity was found in different transformants (A1–A10 and K1–K10) which might be attributed to varying copy number or varying position in the genome of the host at which integration took place, as also reported by Verdoes et al. (1993).

To evaluate the effect of seed media on the AlX expression of transformants, two seed media (Sabouraud's and wheat flour media) were tried. AlX expression was found to be highest in transformants grown in Sabouraud's media (41.91–91.4 U mg−1) in comparison with wheat flour media (5.61–20.72 U mg−1). This may be because of better growth of transformants in Sabouraud's media than in wheat flour media. Wheat bran is considered as one of the most popular components of complex media for xylanase production (Deschamps & Huet, 1985; Hoq et al., 1994; Sa-Pereira et al., 2002). Many authors reported the advantages of using wheat bran as a substrate for xylanase production, and therefore for functional characterization; wet wheat bran was used as production medium.

In Sabouraud's media, transformants A1–A10 showed AlX activity in the range of 46.66–80.74 U mg−1, which showed a 3.21-fold increase in AlX activity. This might be attributed to TATA box present at −59 position in Pcat300. The TATA box was the first core promoter element identified in eukaryotic protein-coding genes (Breathnach & Chambon, 1981). In Sabouraud's media, transformants K1–K10 showed AlX activity in the range of 41.91–91.4 U mg−1, which showed a 3.64-fold increase in AlX activity that might be attributed to two TATAA boxes at position −59 and −359 and two CCAAT motifs lying at positions −355 and −590. As reported by Bucher (1990), in filamentous fungi and higher eukaryotes, the CCAAT motif is an essential and functional element for high-level expression of a large number of genes. The region from −59 to −590 contains the two TATAA and two CCAAT boxes and thus was involved in strong expression. As also suggested by Liu et al. (2003), multiple copies of CCAAT motifs improved the heterologous protein production in A. niger. Results discussed here indicated that there was no significant increase in specific activity in K transformants despite two CCAAT and two TATAA boxes, perhaps because of three cre1-binding sites (5′-SYGGRG-3′) present at −98, −613 and −900, which are responsible for repression by glucose.

In wheat flour media, transformants A1–A10 showed AlX activity in the range of 5.75–7.67 U mg−1, which showed a 3.95-fold increase in AlX activity. In contrast, transformants K1–K10 showed AlX activity in the range of 5.85–20.72 U mg−1, showing a 10.3-fold increase in AlX activity. This increase might be attributed to two TATAA boxes, two CCAAT motifs and absence of repression created by binding of glucose with three cre1-binding sites (5′-SYGGRG-3′) because of absence of glucose in wheat flour medium. Similarly, Roth et al. (2007), using the Psuc1 promoter, observed a sevenfold increased GFP fluorescence in recombinant A. niger strain.

High expression levels and induction of the A. niger cat encoding gene, catR, by CaCO3 and H2O2 have been reported by Liu et al. (1998, 1999). The induction of cat synthesis by CaCO3 was thought to be due either to the high calcium ion concentration of an insoluble salt, which acts as a solid support for mycelial growth, or to resistance to pH change caused by CaCO3. It is also well known that heat shock and hydrogen peroxide induce catalase gene expression in Aspergilli (Abrashev et al., 2005; Hisada et al., 2005) and that each catalase gene promoter has a regulatory element for stress response. The AGAAN motifs are consensus DNA-binding sites of the heat shock transcription factor (HSF) of A. oryzae as reported, by Ishida et al. (2004). The HSF positively regulates the stress response and catR is involved in the defense against oxidative stress in submerged culture. It is therefore anticipated that the AGAAN motifs are involved in the positive regulation of catR promoter. The Pcat924 contained nine AGAAN sequences, consisting of four AGAAN at −701, −692, −555, −498 bp in the sense strand and five AGAAN (reverse compliment; NTTCT) at −616, −579, −522, −298 and −122 bp in the antisense strand.

With the frequently used PglaA of A. niger, glucoamylase expression was reported to be 7.5-fold, using glucose as inducer vs. xylose (Ganzlin & Rinas, 2008). The catR promoter also showed a 6.66-fold increase in AlX activity while growing in medium containing maida vs. glucose, suggesting that the catR promoter is as efficient as PglaA of A. niger.

The results demonstrated that Pcat924 showed better efficiency under the given growth conditions. This is the first report describing the identification of the regulatory element of catR gene in A. niger. Clarifying the specific induction or repression of the catR promoter provides the possibility for utilization of this promoter in heterologous protein production industry.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References

R.S. gratefully acknowledges the Council of Scientific and Industrial Research (CSIR), Government of India, for awarding Senior Research Fellowship and the authors would like to thank the New Millennium Indian Technology Leadership Initiative (NMITLI) for financial support. This is Institutes Publication No. IIIMJ/1465/2011.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors’ contributions
  9. References