SEARCH

SEARCH BY CITATION

Keywords:

  • plant pathogen;
  • polymorphic markers;
  • genetic diversity

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fusarium oxysporum is a ubiquitous species complex of soil-borne plant pathogens comprising of many different formae speciales, each characterized by a high degree of host specificity. In the present investigation, we surveyed microsatellites in the available express sequence tags and transcript sequences of three formae speciales of F. oxysporum viz. melonis (Fom), cucumerium (Foc), and lycopersici (Fol). The relative abundance and density of microsatellites were higher in Fom when compared with Foc and Fol. Thirty microsatellite primers were designed, ten from each forma specialis, for genetic characterization of F. oxysporum isolates belonging to five formae speciales. Of the 30 primers, only 14 showed amplification. A total of 28 alleles were amplified by 14 primers with an average of two alleles per marker. Eight markers showed 100% polymorphism. The markers were found to be more polymorphic (47%) in Fol as compared to Fom and Foc; however, polymorphic information content was the maximum (0.899) in FocSSR-3. Nine polymorphic markers obtained in this study clearly demonstrate the utility of newly developed markers in establishing genetic relationships among different isolates of F. oxysporum.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fusarium oxysporum is an economically important soil-borne pathogen with worldwide distribution (Santos et al., 2002). The fungus causes vascular wilt in about 80 botanical species by invading epidermal tissues of the root, extends to the vascular bundles, produces mycelia and/or spores in the vessels, and ultimately results in death of the plants (Namiki et al., 1994). Individual pathogenic strain within the species has a limited host range, and strains with similar or identical host range are assigned to intraspecific groups, called forma specialis (Namiki et al., 1994).

To understand the evolutionary history and genomic constituents of the formae speciales within F. oxysporum requires knowledge of the phylogenetic relationships among isolates (Appel & Gordon, 1996). Over the past several years, genetic diversity in F. oxysporum has been examined using various genetic markers, such as isozyme profiles (Bosland & Williams, 1987), restriction fragment length polymorphisms (RFLP) in mitochondria and nuclear DNA (Jacobson & Gordon, 1990) and inter-simple sequence repeat (ISSR), (Baysal et al., 2009). Phylogenetic analyses based on DNA sequences of housekeeping genes such as the mitochondrial small subunit (mtSSU), ribosomal RNA gene, rDNA intergenic spacer (IGS) region, and translation elongation factor (TEF)-1α gene were extensively studied for genetic and evolutionary relationships within and among the formae speciales of F. oxysporum (O'Donnell et al., 1998; Lievens et al., 2009).

Microsatellites or simple sequence repeats (SSRs) are composed of tandemly repeated 1–6 bp long units (Tautz, 1989). Microsatellites markers are having a reputation of highly polymorphic, locus specific, easily transferable, and cost-effective molecular markers distributed throughout the genome (Powell et al., 1996). Together, these characteristics make microsatellite loci, one of the best markers for genetic mapping and diversity studies. These markers have been widely used for investigating genetic diversity among cultivars and genetic resources, for developing genetic maps suitable for quantitative trait locus (QTL) detection studies and marker-assisted selection programs, whereas use of these markers to study diversity and polymorphism in fungi is limited. Genetic diversity could reveal the adaptive potential of pathogenic populations, and sometimes, SSR patterns could reflect the variability up to formae speciales, which make possible to increase the resolution of existing markers to discriminate individual strain or formae speciales. The transcripts and express sequence tags (EST) of F. oxysporum are available in different databases, but any formal analysis of microsatellites within these sequences is yet to be reported.

The aims of this study were (1) to access microsatellite variability in available EST and transcripts of three formae speciales of F. oxysporum and (2) to develop EST-based microsatellite markers for genetic characterization of Fusarium isolates. To accomplish this, an in silico approach has been used to assess the frequency and distribution of SSRs in EST and transcript sequences within three formae speciales, and primers were designed and validated for polymorphism.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Source of EST and annotated transcript sequences

The available ESTs of Fom and Foc were downloaded from National Center for Biotechnology Information (www.ncbi.nlm.nih.gov), whereas annotated transcript sequences of Fol were downloaded from ‘Fusarium Comparative Sequencing Project’ (www.broadinstitute.org). The identification of microsatellites was carried out using online software WebSat (Martins et al., 2009). All SSRs were analyzed for their frequency of occurrence, density, and relative abundance.

Thirty SSR primers representing 10 from each forma specialis were randomly selected for PCR amplification to study their utility in revealing polymorphism. Primers complementary to the flanking regions of selected microsatellites were designed using the program primer 3 online software (frodo.wi.mit.edu/).

Fungal isolates

A total of 24 different F. oxysporum isolates, which include six of F. oxysporum f. sp. melonis (Fom), six of F. oxysporum f. sp. cucmerium (Foc), six of F. oxysporum f. sp. lycopersici (Fol), three of F. oxysporum f. sp. cubense (Fou), and three of F. oxysporum f. sp. ciceri (Foi), were obtained from National Agriculturally Important Microbial Culture Collection (NAIMCC), National Bureau of Agriculturally Important Microorganisms (NBAIM), Mau Nath Bhanjan, Uttar Pradesh, India, representing different agroclimatic zones of India.

DNA isolation and SSR amplification

Total genomic DNA was extracted from 24 isolates of F. oxysporum using CTAB method (Abdelnoor et al., 1995). The PCR was performed in 10.0-μL reaction volume containing 1× PCR buffer (10 mM Tris–HCl pH 9.0, 1.5 μM MgCl2, 50 mM KCl, 0.01% gelatin), 0.4 mM each of dNTP (Bangalore Genei), 0.2 U of Taq DNA polymerase (Bangalore Genei), 10 pM each of forward and reverse primers, and 10 ng of genomic DNA was used as template in PCR tubes. PCR program was as initial denaturation at 95 °C for 3 min, subsequently, five touch-down PCR cycles comprising of 94 °C for 20 s, 60/55 °C (depending on the marker as given in Table 3) for 20 s, and 72 °C for 30 s were performed. These cycles were followed by 40 cycles of denaturation at 94 °C for 20 s with constant annealing temperature of 56/51 °C (depending on marker) for 20 s, and extension at 72 °C for 20 s, and a final extension at 72 °C for 20 min.

All PCR amplicons were resolved by electrophoresis on 3% agarose gel to identify the informative SSR loci across all the isolates. GeneRuler 100-bp DNA ladder (MBI Fermentas) was used to estimate the allele size.

Statistical analysis

The amplification data generated by SSR markers were analyzed using SIMQUAL route to generate Jaccard's similarity coefficient (Jaccard, 1908) using ntsys-pc, software version 2.1 (Rohlf, 1998). These similarity coefficients were used to construct a dendrogram depicting genetic relationships among the isolates by employing the Unweighted Paired Group Method of Arithmetic Averages (UPGMA) algorithm and SAHN clustering. The robustness of the dendrogram was evaluated with a bootstrap analysis performed on the binary dataset using winboot software (version. 2.0).

Evaluation of polymorphism

The allelic diversity or polymorphism information content (PIC) was measured as described by Botstein et al. (1980). PIC is defined as the probability that two randomly chosen copies of gene will be different alleles within a population. The PIC value was calculated with the formula as follows:

  • display math

where Pij represents the frequency of the jth pattern for marker i, and summation extends over n patterns.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The frequency of repeat motifs in the consensus EST sequences and annotated transcripts was assessed, and both perfect and compound SSRs were selected with a minimum acceptable length of 12 bp for di, tri, and tetra-nucleotide motifs (Garnica et al., 2006). Only SSRs with a minimum of three repeats were included in the analyses of penta- and hexa-nucleotide repeats. Maximum number of SSR (1679) was identified in Fol followed by Foc (313) and Fom (204). The higher number of SSRs in Fol was expected because the total size covered by transcripts sequences of Fol (21.7 Mb) was much higher than that of ESTs of Fom (1.3 Mb) and Foc (2.4 Mb). To compare the SSR count between all three formae speciales, the complete length of each set of sequences was analyzed, and thus, total relative abundance and total relative density were calculated and depicted in Table 1. It was found that relative abundance of SSRs in Fom (157) was higher than Foc (130) and Fol (77). Similarly, the relative density of SSR was also higher in Fom (2117) in comparison with Foc (1680) and Fol (1071) (Table 1; Fig. 1a and b).

image

Figure 1. Graphical representation of relative density (a) and relative abundance (b) of different SSR type found in ESTs and transcripts of Fusarium oxysporum.

Download figure to PowerPoint

Table 1. Number and distribution of SSRs in consensus ESTs and transcript sequences of different formae speciales of Fusarium oxysporum
 Fusarium oxysporum (59.9 Mb)
Melonis (ESTs)Cucumerium (ESTs)Lycopersici (Transcripts)
Number of sequence examined2641644817708
Total size covered by examined sequences (Mb)1.3 (2.1%)2.4 (4.0%)21.7 (36.2%)
Number of SSR identified2043131758
Perfect SSRs192 (95.1%)295 (94.2%)1679 (95.5%)
Compound SSRs12 (4.9%)18 (5.8%)79 (4.5%)
Total length of SSRs (bp)2752403323239
Relative density (bp per Mb)211716801071
Relative abundance (SSR per Mb)15713077

The maximum frequency of SSRs among all three sequence sets was of trinucleotide repeats (62.7%), while the dinucleotide repeats represented < 3% (Table 2). Tetranucleotide repeats constituted the second most frequent motif (16.7%) followed by hexanucleotide (13.11%) and pentanucleotide (4.91) repeat motifs in sequences of all three formae speciales. However, the percentage of di and pentanucleotide repeat was higher in Fom. This agrees with the results from other eukaryotes, where trinucleotide repeats are overrepresented in coding region (Garnica et al., 2006).

Table 2. Percentage, relative abundance, and relative density of SSRs in sequence sets of different formae speciales of Fusarium oxysporum
 Motif lengthCountPercentageRelative abundanceRelative density
Fomdi2612.720.0472.3
tri8642.166.066.2
tetra3617.627.027.7
penta4120.031.5373.1
hexa157.411.011.5
Focdi0144.55.893.3
tri11938.049.6550.0
tetra12138.650.4645.0
penta3410.814.2202.1
hexa257.910.4190.0
Foldi171.00.89.4
tri117269.854.0705.1
tetra20912.49.3116.9
penta332.01.523.27
hexa24814.811.4216.2

DNA polymorphism

Out of 30, a total of 14 SSR markers (six from Fom, three from Foc, and five from Fol) amplified easily scorable bands ranged from 70 to 400 bp in all the isolates. Of the 14 markers, three amplified dinucleotide repeats, ten amplified trinucleotide repeats, and only one marker were able to amplify tetranucleotide repeat. We used three indexes (percentage of polymorphic SSRs, number of alleles per locus and PIC value) to indicate SSR polymorphism level. Among all the markers, nine markers (64.3%) were polymorphic, whereas rest five markers (35.7%) were monomorphic. A total of 28 alleles were amplified by 14 markers. We detected 1–4 alleles per microsatellite locus with an average of two alleles per marker. FomSSR primers amplified 10 alleles with 1.8 allele per locus, whereas FocSSR primers detected 4.0 alleles with 1.3 alleles per locus and FolSSR primers detected 14 alleles with 2.8 alleles per locus. Maximum numbers of alleles (4) were amplified by FolSSR-7, while minimum one allele was amplified with five markers viz. FomSSR-3, FomSSR-5, FomSSR-9, FocSSR-5, and FocSSR-6. Three markers namely FomSSR-8, FolSSR-3, and FolSSR-6 amplified three alleles, while five markers namely FomSSR-2, FomSSR-6, FocSSR-3, FolSSR-2, and FolSSR-10 amplified two alleles (Table 3). Of nine polymorphic markers, eight showed 100% polymorphism and one showed 66% (FolSSR-6). On comparison of polymorphism potential of markers derived from each forma specialis, of six SSR markers from Fom and three SSR markers from Foc, only three (50%) and one (65%) markers were found polymorphic, respectively (Table 4). FolSSR markers exhibited highest percentage of polymorphism (100%), all the five markers were found polymorphic. Among the polymorphic markers, the maximum PIC value was obtained with FocSSR-5 (0.899) and minimum with FolSSR-6 (0.023), the average being 0.517.

Table 3. Details of locus, primer sequence, Tm, Motif, no. of alleles, alleles size, percentage polymorphism, and PIC value of different primers used to evaluate genetic diversity within Fusarium oxysporum isolates
Primer Name/locusForward primerReverse primerTm (°C)MotifNo. of allelesAllele size% PolymorphismPIC
FomSSR-2TCATTCTCCATGTCCTCATCACTCGTTCCGATAGTAATTCGTCA55.5(AC)1521791000.493
FomSSR-3ATGCGAAAGAAGGTCTGGATTAGAGAAGCCATTATCAACAACGC54.5(TC)61393
FomSSR-5CGTATCACAGCTACAGCCACTCATCTCAGTCACCCACTCAACCT59.2(ACA)41223
FomSSR-6ACACTCCAAGAACTCAGCATCAGACAAAACTCGCTATTCGTTCC56.4(AC)622141000.493
FomSSR-8CAACACACGTCACAATTCTTCCCTTTGGCGACGACCTCCT56.2(TCG)433771000.231
FomSSR-9GCACACAATTCTATCCTCCTCCCTGAAAGTGCTGTTGATACGCT57.4(CCT)41251
FocSSR-3CGAAACAATGCGTACATCCATAAGACTCCATACTCCCGAAACA55.2(CATT)422161000.899
FocSSR-5CCCAAAGCAACTACAACGCTATATCCAAGGAAGTGCAAATGG54.9(CAG)41308
FocSSR-6CTGTTTTCTCAAAGACCATGTCCTACACCGATCTCATCAACAAGC56.7(CGT)41360
FolSSR-2GGAGGCCGAGGTAATGGATACCTGAGACTGAATGGCAGTAGGG60.0(CGG)723841000.554
FolSSR-3CTCGCATACTACTACCGCACAGGCAGATAAGGGAGATGCAAAAC58.3(CAG)1033121000.712
FolSSR-6ACCTAACTCTTGGGAGGACGATCTGCATAGCCTTGGTTGTTGTA57.4(CAG)73308660.023
FolSSR-7ATACCAGTCAAAGCCAAAGGAATCTTCGGGTAGTGGTGTATGTG56.4(CCA)642641000.641
FolSSR-10AACAACAGCAACAGCAACAGATCTTCCAGTAGTGCCAGTGTGA56.2(CAG)921801000.609
Table 4. A comparison between Fom,Foc, and Fol markers to estimate the level of polymorphism revealed by them
 Fom markersFoc markersFol markersTotal markers
Markers used10101030
Marker amplified6 (60%)3 (30%)5 (50%)14 (47%)
No. of monomorphic markers3 (50%)2 (66.7%)0 (0%)5 (35.7%)
No. of polymorphic markers3 (50%)1 (33.3%)5 (100%)9 (64.3%)
Average PIC value0.4390.750.510.531
No. of alleles amplified1041428
Similarity coefficient value (Avg.)0.660.660.570.63

Diversity and cluster analysis

The similarity coefficient values between isolates ranged from 0.14 to 0.96 with a mean of 0.61 for all 276 isolate combinations used in the present study. For microsatellite markers derived from Fom, the similarity coefficient values between isolates ranged from 0.22 to 1.00 with average genetic diversity of 33.1%. Similarly, with Foc-derived SSR markers, the similarity coefficients between isolates ranged from 0.4 to 1.00 with 34.5% genetic diversity. For Fol markers, similarity coefficient value ranged from 0.2 to 1.0 with an average diversity being 42.7% (Table 4).

The highest similarity coefficient (0.96) was observed between Fom isolate Fom-1 and Fom-2, which was closely followed by Foc isolate Foc-1 and Foc-3 (0.92). The similarity was expected because both isolates belong to same forma specialis and geographical region. The most diverse (similarity coefficient value 0.12) isolates were Fol-6 and Foi-2. The dendrogram constructed based on similarity index resulted in two major clusters (Fig. 2). High bootstrap values were recorded with internodes, which indicate the robustness of the clustering. The first major cluster has been exclusively composed of Fom isolates, which is further divided into two subclusters having three Fom isolates each. The second cluster having different subclusters comprises a mix of all the formae speciales taken into this study except Fom.

image

Figure 2. Dendrogram showing genetic relationship among the Fusarium oxysporum isolated based on 14 microsatellites markers. Scale indicates Jaccard's coefficient of similarity.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The knowledge of abundance and distribution of genetic variability within and among formae speciales of F. oxysporum is a prerequisite to study their genetic relationships (Bruns et al., 1991). In the present study, the relative density and relative abundance of SSRs in Fom was higher. So far, we do not have any strongly supported explanation for this. However, this discrepancy may be occurred because of transfer of lineage-specific (LS) genomic regions in F. oxysporum that include four entire chromosomes and account for a quarter of the genome (Ma et al., 2010). It has been observed from genome-wide study that the distribution of microsatellites in the genome is not random. Coding regions are mostly dominated by tri and hexa-nucleotide repeats, whereas di, tetra, and penta nucleotide repeats are often found in abundance in noncoding region (Kim et al., 2008; Levdansky et al., 2008). Differential distribution in terms of abundance of SSRs has been reported in between intronic and intergenic regions, 5′ and 3′ UTRs, and in different chromosomes and lastly, different species have different frequencies of SSR types and repeat units (Li et al., 2004; Garnica et al., 2006; Lawson & Zhang, 2006). In our study, we observed similar pattern of distribution of SSR in the coding region where tri and hexanucleotide SSRs were predominant. These tri and hexanucleotide SSRs in the coding region are translated into amino-acid repeats, which possibly contribute to the biological function of the protein (Kim et al., 2008). Dinucleotide SSRs are often found in the exonic region of F. oxysporum; however, (GT)n and (AC)n repeats were common in all the three formae speciales. Stallings et al. (1991) reported that (GT)n repeat is able to enhance the gene activity from a distance independent of its orientation. However, more effective transcription enhancement resulted from the GT repeat being closer to promoter region. Similarly, (CA)n repeat can act as a bridge to bring the promoter into close proximity with a putative repressor protein bound downstream of the (CA)n SSR (Young et al., 2000).

The maximum length of dinucleotide repeats was observed in Fom where TC is repeated 34 times, followed by tri nucleotide repeats in Fol where GGA is repeated 15 times. We found that the overall number of repeat motifs are generally low in the transcripts and cDNA sequences, which is in agreement with the earlier findings of Lim et al. (2004). They observed that shorter numbers of repeats (5–7 U) were predominated with around 90% of all motifs. The expansion of microsatellite repeats in the transcribe region of the genome has been limited because of strong evolutionary and functional constrains (Metzgar et al., 2000). It has been reported that longer repeats have high mutation rates and could, therefore, be less stable. Random mutation followed by DNA polymerase slippages is mainly responsible for short microsatellite repeats (Kruglyak et al., 2000).

High numbers of perfect repeats in long microsatellites are more likely to be polymorphic as compared to shorter one because of higher rate of DNA replication slippage. Several studies in other organisms have shown that the number of repeats is a good indicator of the level of variability (Vigouroux et al., 2002). We investigated whether the polymorphism of SSRs could be affected by any of the factors including different repeat units, SSR types, repeat numbers, and total SSR lengths. The results showed that there were no significant differences in PIC scores among these criteria. Locus FocSSR-3 with four repeats and locus FolSSR-3 with 10 repeats showed PIC value of 0.899 and 0.712, respectively, whereas locus FomSSR-2 with 15 repeats exhibited a PIC value of 0.493.

To analyze the overall pattern of polymorphism of the SSRs in the three formae speciales, we strived to select SSRs randomly from these formae speciales. The average PIC value was comparable and found relatively low for SSR markers compared with previous reports in Fusarium. Bogale et al. (2005) have developed nine SSR markers from F. oxysporum having average PIC value of 0.594. These SSR markers were evaluated on 64 isolates belonging to 21 formae speciales. Similarly, Gauthier et al. (2007) observed average PIC value of 0.756 with 15 makers developed from Fusarium graminearum. The low value of PIC in our study may be contributed to the fact that SSRs represent the coding region of genome which is generally conserved. The number of alleles per locus varied according to the origin of the marker. Markers with PIC values of > 0.50, such as FocSSR-3 (0.899), FolSSR-2 (0.554), FolSSR-3 (0.712), FolSSR-7 (0.641), and FolSSR-10 (0.609), will be highly informative for genetic studies and are extremely useful in distinguishing the polymorphism rate of the marker at specific locus. High levels of polymorphism associated with microsatellites are expected because of the unique mechanism responsible for generating microsatellite allelic diversity by replication slippage rather than by simple mutations or insertions/deletions (Tautz, 1989).

To our knowledge, this is the first attempt to extensively develop SSR markers from the coding regions of F. oxysporum. This study clearly demonstrates the utility of newly developed EST–SSR markers in establishing genetic relationships among different isolates of F. oxysporum. Although the number of useful markers was low, all the isolates could be differentiated from each other. These marker can be further utilized for addressing genetic relatedness in other species of Fusarium because EST-derived SSR markers have a reputation of being highly transferable (Datta et al., 2010).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The authors gratefully acknowledge the financial assistance under project ‘Application of Microorganisms in Agriculture and Allied Sectors’ (AMAAS) and ‘Outreach project on Phytophthora, Fusarium and Ralstonia disease in horticulture and field crops’ from Indian Council of Agricultural Research (ICAR), India.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Abdelnoor RV, Barros EG & Moreira MA (1995) Determination of genetic diversity within Brazilian soybean germplasm using random amplified DNA amplification techniques and comparative analysis with pedigree data. Braz J Genet 18: 265273.
  • Appel DJ & Gordon TR (1996) Relationships among pathogenic and nonpathogenic isolates of Fusarium oxysporum based on the partial sequence of the intergenic spacer region of the ribosomal DNA. Mol Plant Microbe Interact 9: 125138.
  • Baysal O, Siragusa M, Ikten H, PolatI , Kcu EG, Yigit F, Carimi F & da Silva JAT (2009) Fusarium oxysporum f. sp. lycopersici races and their genetic discrimination by molecular markers in West Mediterranean region of Turkey. Physiol Mol Plant Pathol 74: 6875.
  • Bogale M, Wingfield BD, Wingfield MJ & Steenkamp ET (2005) Simple sequence repeat markers for species in the Fusarium oxysporum complex. Mol Ecol Notes 5: 622624.
  • Bosland PW & Williams PH (1987) An evaluation of Fusarium oxysporum from crucifers based on pathogenicity, isozyme polymorphism, vegetative compatibility, and geographic origin. Can J Bot 65: 20672073.
  • Botstein D, White KL, Skolnick M & Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32: 314331.
  • Bruns TD, White TJ & Taylor JW (1991) Fungal molecular systematic. Annu Rev Ecol Syst 22: 525564.
  • Datta S, Mahfooz S, Singh P, Choudhary AK, Singh F & Kumar S (2010) Cross-genera amplification of informative microsatellite markers from common bean and lentil for the assessment of genetic diversity in pigeonpea. Physiol Mol Biol Plants 16: 123134.
  • Garnica DP, Pinzón AM, Ocampo LMQ, Bernal AJ, Barreto E, Grünwald NJ & Restrepo S (2006) Survey and analysis of microsatellites from transcript sequences in Phytophthora species: frequency, distribution, and potential as markers for the genus. BMC Genomics 7: 245.
  • Gauthier N, Clouet CD, Fargues J & Bon MC (2007) Microsatellite variability in the entomopathogenic fungus Paecilomyces fumosoroseus: genetic diversity and population structure. Mycologia 99: 693704.
  • Jaccard P (1908) Nouvelle recherches sur La distribution florale. Bull Soc Vaud Sci Nat 44: 223270.
  • Jacobson DJ & Gordon TR (1990) Variability of mitochondrial DNA as an indicator of relationships between population of Fusarium oxysporum f. sp. melonis. Mycol Res 94: 734744.
  • Kim TS, Booth JG, Gauch HG Jr, Sun Q, Park J, Lee YH & Lee K (2008) Simple sequence repeats in Neurospora crassa: distribution, polymorphism and evolutionary inference. BMC Genomics 9: 31.
  • Kruglyak S, Durrett RT, Schug MD & Aquadro CF (2000) Distribution and abundance of microsatellites in the yeast genome can be explained by a balance between slippage events and point mutations. Mol Biol Evol 17: 12101219.
  • Lawson MJ & Zhang L (2006) Distinct patterns of SSR distribution in the Arabidopsis thaliana and rice genomes. Genome Biol 7: R14.
  • Levdansky E, Sharon H & Osherov N (2008) Coding fungal tandem repeats as generators of fungal diversity. Fungal Biol Rev 22: 8596.
  • Li YC, Korol AB, Fahima T & Nevo E (2004) Microsatellites within genes: structure, function, and evolution. Mol Biol Evol 21: 9911007.
  • Lievens B, Houterman PM & Rep M (2009) Effector gene screening allows unambiguous identification of Fusarium oxysporum f. sp. lycopersici races and discrimination from other formae speciales. FEMS Microbiol Lett 300: 201215.
  • Lim S, McRobb LN, Lim M & Carter DA (2004) A comparison of the nature and abundance of microsatellites in 14 fungal genomes. Fungal Genet Biol 41: 10251036.
  • Ma LJ, Van der Does HC, Borkovich KA et al. (2010) Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464: 367373.
  • Martins WS, Lucas DCS, Neves KFS & Bertioli DJ (2009) WebSat – a Web Software for microsatellite marker development. Bioinformation 3: 282283.
  • Metzgar D, Bytof J & Wills C (2000) Selection against frameshift mutations limits microsatellite expansion in coding DNA. Genome Res 10: 7280.
  • Namiki F, Shiomi T, Kayamura T & Tsuge T (1994) Characterization of the formae speciales of Fusarium oxysporum causing wilts of cucurbits by DNA fingerprinting with Nuclear Repetitive DNA Sequences. Appl Environ Microbiol 60: 26842691.
  • O'Donnell K, Kistler HC, Cigelnik E & Ploetz R (1998) Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondria gene genealogies. P Natl Acad Sci USA 95: 20442049.
  • Powell W, Morgante M, Andre C, Hanafey V, Vogel T, Tingey S & Rafalski JA (1996) The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol Breed 3: 225238.
  • Rohlf FJ (1998) NTSYS-PC Numerical taxonomy and Multivariate analysis system Version 2.1., Exeter Software. Applied Biostatistics, New York.
  • Santos FMA, Ramos B, Sanchez MAG, Eslava AP & Minguez JMD (2002) A DNA based procedure for in planta detection of Fusarium oxysporum f. sp. phaseoli. Phytopathology 92: 237244.
  • Stallings RL, Ford AF, Nelson D, Torney DC, Hildebrand CE & Moyzis RK (1991) Evolution and distribution of (GT)n repetitive sequences in mammalian genomes. Genomics 10: 807815.
  • Tautz D (1989) Hyper variability of simple sequences as a general source of polymorphism DNA markers. Nucleic Acids Res 17: 64636471.
  • Vigouroux Y, Jaqueth JS, Matsuoka Y, Smith OS, Beavis WD, Smith JSC & Doebley J (2002) Rate and pattern of mutation at microsatellite loci in maize. Mol Biol Evol 19: 12511260.
  • Young ET, Sloan JS & van Riper K (2000) Trinucleotide repeats are clustered in regulatory genes in Saccharomyces cerevisiae. Genetics 154: 10531068.