SEARCH

SEARCH BY CITATION

Keywords:

  • Streptococcus equi ssp. zooepidemicus;
  • porcine circovirus type 2;
  • bacterial vector

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information

Porcine circovirus type 2 (PCV2) infection and other concurrent factors is associated with post-weaning multisystemic wasting syndrome, which is becoming a major problem for the swine industry worldwide. Coinfection of Streptococcus equi ssp. zooepidemicus (SEZ) and PCV2 in swine has necessitated demand for a recombinant vaccine against these two pathogens. A recombinant SEZ-Cap strain expressing the major immunogenic capsid protein of PCV2 in place of the szp gene of acapsular SEZ C55138 ΔhasB was constructed. Fluorescence-activated cell sorting and immunofluorescence microscopy analyses indicated that the capsid protein is expressed on the surface of the recombinant strain. Experiments in mice demonstrated that strain SEZ-Cap was less virulent than the parental strain and that it induced significant anti-PCV2 antibodies when administered intraperitoneally, which is worthy of further investigation in swine.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information

Porcine circovirus type 2 (PCV2) is a small single-stranded nonenveloped DNA virus mainly responsible for post-weaning multisystemic wasting syndrome (PMWS), with considerable economic losses to the swine industry. PMWS is clinically characterized by wasting and growth retardation and is defined as a multifactorial disease, in which the final clinical outcome depends on other factors apart from the infection with PCV2 (Perez-Martin et al., 2010). Studies have revealed the variety of concurrent infection pathogens associated with PCV2-affected pig herds. Streptococcus equi ssp. zooepidemicus (SEZ) was one of such agents identified, and it caused septicemia, meningitis, endocarditis and arthritis in pigs (Hong-Jie et al., 2009). The common occurrence of PCV2 with SEZ in diseased pig samples (Metwally et al., 2010) prompted us to construct a recombinant vaccine strain against SEZ and PCV2 infection simultaneously.

PCV2 is hardy, persisting in the farm environment for long periods of time (Allan & Ellis, 2000). Therefore, the only effective method of controlling disease outbreaks is considered to be vaccination. Several prototypes of PCV2 vaccines have been described to date, most based on the expression of the PCV2 capsid protein (Cap), considered the only structural viral protein and the major immunogenic viral determinant (Nawagitgul et al., 2000; Cheung & Bolin, 2002). PCV2 vaccines under development include inactivated vaccine (Opriessnig et al., 2009), DNA vaccines (Kamstrup et al., 2004; An et al., 2008; Fan et al., 2008b), recombinant virus-vectored vaccines (Ju et al., 2005; Wang et al., 2007; Fan et al., 2008a) and bacterial-vectored vaccines (Wang et al., 2008). SEZ is a widespread pathogen associated with swine streptococcal diseases. The M-like protein (SzP) is a cell surface-anchored protein of SEZ that conveys phagocytosis resistance (Hong-Jie et al., 2009) and is an excellent vaccine target. Meehan et al. (1998) immunized mice with the recombinant SzP derived from SEZ strain W60, which protected them from intraperitoneal challenge with the homologous strain. An SzP-deletion SEZ strain was attenuated and was able to elicit good protective immunity against challenge with the wild-type strain (Hong-Jie et al., 2009). An acapsular attenuated vaccine strain C55138 ΔhasB was constructed in our laboratory and showed good protection efficiency against SEZ challenge (data not shown). It is thus hypothesized that incorporation of PCV2 capsid protein into SzP of SEZ strain C55138 ΔhasB (SEZ-Cap) could further attenuate the virulence of this stain and also elicit an immune response against PCV2 capsid protein at the same time. In this study, we used SEZ as a bacterial vector for expression of PCV2 capsid protein and verified this hypothesis.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information

Bacterial strains, plasmids, primers and PCV2-positive sera

SEZ strain C55138 (China Institute of Veterinary Drug Control, Beijing, China) was originally recovered from a diseased pig with septicemia in Sichuan, China. It was grown on tryptone soya broth (TSB) (Oxoid, Wesel, Germany) or tryptone soya agar (TSA) (Difco Laboratories, Detroit, MI) plus 5% newborn calf serum at 37 °C under aerobic conditions. The capsule-deficient mutant ΔhasB was constructed in our laboratory by disruption of the capsule synthesis hasB gene (data not shown). A thermosensitive broad-host-range vector pG+host5 (Appligene, Illkirch, France) was used to construct the SEZ-Cap recombinant strain (Biswas et al., 1993). The primers used in this study are detailed in Table 1. The corresponding position of the primers on the genome of SEZ is illustrated in Fig. 1a. When necessary, erythromycin was added to the culture media at the following concentrations: 150 μg mL−1 for Eschrichia coli and 5 μg mL−1 for SEZ.

image

Figure 1. Illustration of szp-cap recombinant gene organization in the SEZ C55138 genome and confirmation analysis of the recombinant mutant strain SEZ-Cap. (a) Genomic organization of the szp-cap recombinant gene and its flanking genes in the SEZ C55138 genome. Arrows represent the length and direction of transcription of the genes. (b) Strategy for construction of SEZ-Cap mutant strain. (c) Identification of the SEZ-Cap recombinant strain by PCR and RT-PCR, using primer pairs M1/M2 and PCV-S-1/PCV-S-2, respectively.

Download figure to PowerPoint

Table 1. Primers used in this study
PrimerSequencePurposeAmplification length (bp)
szp-1AATCGTCGACGAAAAGCT (SalI)Recombinant vector construction504
szp-2CGGCCTCGGATCCTAAACTA (BamHI)
szp-3TCTTAGGATCCATTGCTAA (BamHI)493
szp-4TGATAGAATTCGTTAGACA (EcoRI)
s-PCV-1GCGCGGATCCTTCAAC (BamHI)559
s-PCV-2CATGGATCCACGGATATTGT (BamHI)
M-1TGTAGCACTCATAGGTCCATRecombinant strain identification2160/2265
M-2CTAAAGCTCCTTCGGTCT
PCV-S-1CAAGCGAACCACAGTCAA276
PCV-S-2GTATGGCGGGAGGAGTAG
PCV-1CCATAACCCAGCCCTTCTReal-time PCR124
PCV-2GCAGTTTGTAGTCTCAGCCAC
szp-5CGGTGGTCGTAATGGAGA260
szp-6TGTATGCTGCGAATGCTG
16SrRNA-1ATCCGAACTGAGATTGGC100
16SrRNA-2CCCTTATGACCTGGGCTA

Five 4- to 6-week-old BALB/c mice were immunized twice at 2-week intervals by intraperitoneal injection with commercially available PCV2-inactive vaccine (Nannong Hi-tech Co. Ltd, Nanjing, China). Serum samples were tested using a commercial PCV2 ELISA IgG kit (Ingezim Circovirus IgG, Ingenasa, Madrid, Spain). When the serum sample with a sample/positive (S/P) ratio reached 1.0, the mice were sacrificed and sera were pooled as PCV2-positive serum.

Construction of the recombinant SEZ harboring the cap gene

DNA fragments were amplified using the genomic DNA of SEZ strain C55138 as template by PCR with primer pairs szp-1 and szp-2, and szp-3 and szp-4 (Fig. 1a). The cap gene was amplified with s-PCV-1 and s-PCV-2 from PCV2 antigen-positive samples (lymph nodes of infected pigs with typical clinical signs of PMWS) kept in our laboratory. All PCR amplicons were digested with the appropriate restriction enzymes and sequentially ligated into the pG+host5, giving rise to the recombinant vector pG∆szp (Fig. 1b).

The isogenic recombinant strain SEZ-Cap was obtained according to Biswas et al. (1993). Competent cells of strain C55138 ΔhasB were subjected to electrotransformation with pG∆szp and the cells were grown at 28 °C in the presence of erythromycin. Bacteria at the midlogarithmic growth phase were diluted with TSB containing erythromycin and cultured at 28 °C to early logarithmic phase. The culture was then shifted to 37 °C and incubated for 4 h. Subsequently, the cells were spread on TSA and incubated at 28 °C. Temperature-resistant colonies were screened at 37 °C for the loss of vector-mediated erythromycin resistance and to detect putative double cross-over homologous recombinant mutants with PCR using primers M1 and M2 and RT-PCR using primers PCV-S-1 and PCV-S-2 (Fig. 1a).

Determination of the growth curve and virulence of the mutant strain

To analyze the growth properties of the strains, cultures of recombinant strain SEZ-Cap and the parental strain SEZ ΔhasB were grown overnight in TSB supplemented with 5% newborn calf serum. The cultures were subinoculated into fresh supplemented TSB at a dilution of 1 : 1000. The bacteria of each culture were enumerated using serial dilution plating at intervals of 1 h to obtain the growth curves.

To compare the virulence of the above two strains, 50 BALB/c mice (five mice in each group) were injected intraperitoneally with 0.5 mL of either SEZ ΔhasB or SEZ-Cap with 10-fold dilutions ranging from 106 to 1010 CFU according to Hong-Jie et al. (2009). All experimental protocols were approved by the Laboratory Animal Monitoring Committee of Guangdong Province and were performed accordingly. The 50% lethal dose (LD50) of the two strains was calculated according to Karber's method (Li et al., 2008).

Real-time PCR analysis of cap gene transcription

Total RNA from in vitro and in vivo harvested bacteria were prepared according to Ogunniyi et al. (2002). cDNAs were synthesized using a reverse transcription system (Promega, Madison, WI) according to the manufacturer's instructions. Each cDNA sample was used as a template for a real-time PCR, and the amplification mixture contained SYBR Green (TaKaRa, Dalian, China). All reactions were performed in triplicate, and a LightCycler 480 (Roche) was used for amplification and detection. For each run, to normalize the amount of sample cDNA added to each reaction, the Ct value of the endogenous control 16S rRNA gene was subtracted from the Ct value of each gene. Fold changes were calculated using the formula of the 2−∆Ct method.

Immunofluorescence microscopy analysis

Immunofluorescence microscopy analysis of capsid protein expression was performed according to Tunney et al. (1999). SEZ-Cap and SEZ ΔhasB strains were applied in duplicate to multiwell slides. The slides were air dried and then fixed in 100% methanol for 10 min at −20 °C. The slides were incubated with the mouse sera against the PCV2 (1 : 20), and preimmune mice serum was used as negative control. After washing, the slides were incubated with fluorescence isothiocyanate (FITC)-labeled affinity-purified antibody to mouse IgG (H + L) (Santa Cruz, CA). After a final wash, the slides were examined with a fluorescence microscope (Zeiss, Germany).

Fluorescence-activated cell sorting (FACS) assay

Surface expression of the capsid protein by SEZ was determined as previously described (Rubinsztein-Dunlop et al., 2005), with some modifications. About 5 × 106 bacteria were incubated with PCV2-positive serum or normal mice serum, which was diluted 10-fold in phosphate-buffered saline/bovine serum albumin (PBS-BSA) and incubated at room temperature with bacteria in a total volume of 500 μL for 45 min. The bacteria were harvested by centrifugation at 6000 g for 5 min and washed with PBS-BSA. Goat antimouse IgG-FITC (10 μg) (Santa Cruz) was added, and the bacteria were incubated for 45 min at room temperature, washed and analyzed with a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA). Forward and side scatter were used to exclude debris and aggregates, and 10 000 gated events were recorded. The mean fluorescence intensity and percentage of fluorescent bacteria (brighter than 10 fluorescence intensity units on the FL1 axis) were calculated for each sample.

Determination of antibody response against capsid protein

To evaluate the efficacy of recombinant live vaccine against PCV2, 6-week-old female BALB/c mice were randomly divided into three groups (10 mice per group). The mice in group 1 were immunized twice at 2-week intervals by intraperitoneal injection with 1 × 106 CFU SEZ-Cap (0.5 mL). Group 2, serving as a positive control, were vaccinated with commercially available PCV2-inactive vaccine (Nannong Hi-tech Co. Ltd, Nanjing, China) and group 3, serving as a negative control, were vaccinated with SEZ ΔhasB strain at an equal dose and using the same protocol. Fourteen days after the second vaccination, sera were obtained from each group by tail vein bleeding and the antibodies were measured using the commercial PCV2 ELISA IgG kit (Ingezim Circovirus IgG, Ingenasa).

Statistical analysis

Data are presented as mean ± SD and were analyzed using a t-test. Values of < 0.05 were considered significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information

Characterization of the SEZ-Cap recombinant strain

To gain the recombinant strain expressing the capsid protein of PCV2, a fragment of the ORF2 gene lacking the nuclear localization signal sequence which possesses rare codons encoding arginine and proline and suppressing high-level expression (Liu et al., 2001) was cloned. The truncated cap gene was incorporated into the szp gene of SEZ strain ΔhasB designated as SEZ-Cap through homologous replacement. To confirm the recombinant strain harboring the fusion gene, PCR analysis with primers M1 and M2 was carried out. When the genomic DNA of SEZ strain ΔhasB was used as template, a 2265-bp band encompassed the length of its homologous arms and the deleted region of the szp gene. However, when the genomic DNA of SEZ-Cap was used as template, a 2160-bp fragment could be amplified, indicating that the length of the partial szp gene was subtracted and the cap gene was incorporated (Fig. 1c). The PCR products were further cloned and sequenced. The result showed that part of the szp gene had been successfully replaced by the recombinant szp-cap gene, coding for the fusion protein with partial Cap protein sequence (see Supporting Information, Data S1). In addition, using RT-PCR with primers located in the cap gene frame of the szp-cap gene also confirmed a 276-bp fragment yield from the SEZ-Cap strain but no transcription from the parental SEZ ΔhasB strain (Fig. 1c).

The mutant strain showed equal growth rate and reduced virulence

The nearly identical growth curves of SEZ-Cap and SEZ ΔhasB indicated that incorporation of cap into the szp gene did not have a significant influence on the growth of SEZ strain ΔhasB. A 276-bp PCR fragment was consistently amplified using primers PCV-S-1 and PCV-S-2 from SEZ-Cap from each of 25 serial passages, implying that the cap gene was stably inserted into the genome (data not shown).

To study attenuation of the SEZ-Cap strain, virulence of the two strains was assessed in BALB/c mice. Results showed that SEZ-Cap was nearly fourfold less virulent than the parental strain (Table 2).

Table 2. Determination of LD50 in BALB/c mice challenged with the SEZ-Cap and SEZ ΔhasB strain
Dose of challenge (CFU/0.5 mL)Number of deaths/totalSurvival rate (%)
SEZ ΔhasBSEZ-CapSEZ ΔhasBSEZ-Cap
1 × 10105/55/500
1 × 1095/54/5020
1 × 1083/52/54060
1 × 1071/50/580100
1 × 1060/50/5100100
LD505.01 × 1072.0 × 108  

Transcription level of cap was comparable that of szp

To test whether the transcription level of cap was reduced when incorporated into the szp gene, we compared that of the recombinant szp-cap gene in the SEZ-Cap strain and the original szp gene in the parental SEZ ΔhasB strain by quantitative RT-PCR. The comparison was carried out using the strains either cultured in TSB broth (in vitro) or recovered from infected mice (in vivo). Analysis of the dissociation curves from infected samples and bacteria cultured in vitro revealed a single melting peak, and no specific fluorescence signal was detected from negative control samples. The result showed that transcription levels of cap in the recombinant strain were not statistically different from that of szp in the parental strain both in vitro and in vivo.

In vitro analyses of capsid protein expression by FACS and immunofluorescence microscopy analysis

Immunofluorescence labeling of the cells was performed using mouse anti-PCV2 antibody as the primary antibody and FITC-conjugated goat anti-mouse IgG as the secondary antibody. The green fluorescence of the immunostained capsid fusion protein was observed on SEZ-Cap cells, whereas control cells of SEZ strain ΔhasB were not immunostained (Fig. 2). Flow cytometry was used to quantitatively analyze the cell-surface display of the cap-anchor. As shown in Fig. 3, the recombinant strain showed significantly more intense fluorescence signals than the parental strain SEZ ΔhasB.

image

Figure 2. Immunofluorescence labeling of SEZ-Cap cells (a,b) and SEZ ΔhasB cells (c,d).

Download figure to PowerPoint

image

Figure 3. Flow cytometric analysis of strains SEZ ΔhasB (a) and SEZ-Cap (b). The mean fluorescence intensity (MFI) of unlabeled bacteria (shaded) and bacteria incubated with primary and secondary antibodies (open).

Download figure to PowerPoint

In vivo characterization of capsid protein expression in mice

To analyze expression of the capsid protein in vivo and determine whether the SEZ-Cap strain could evoke an antibody response against capsid protein (the structural protein of PCV2), the antibody response was measured (Fig. 4). When the mice were immunized with SEZ ΔhasB, there was an absence of antibody elicited against capsid protein (0.135 ± 0.007) but a high-level antibody response with the inactive PCV2 vaccine (1.204 ± 0.157). A significant level of antibody (0.629 ± 0.116) could be induced by the recombinant strain compared with the negative control, indicating that the cap gene was expressed during the course of immunization.

image

Figure 4. Comparison of specific antibody levels after immunization with SEZ-Cap, PCV2-inactive vaccine (positive control) and SEZ ΔhasB (negative control).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information

Diseases associated with PCV2 infections are becoming a major problem for the swine industry worldwide. Commercially available and currently developed vaccines focus on the Cap protein, and these include DNA vaccines (Kamstrup et al., 2004; An et al., 2008) and virus-vectored vaccines (Ju et al., 2005; Wang et al., 2007; Fan et al., 2008a). However, producing a sufficient amount of DNA/viral for vaccine development is relatively expensive. To overcome this problem, heterologously expressing Cap protein through attenuated swine pathogenic bacteria is an attractive route: it is cost effective compared with DNA/viral vector-based vaccines, and the swine bacterial vector benefits the recombinant strain against other bacterial infection simultaneously compared with yeast (Bucarey et al., 2009) and Lactococcus lactis (Wang et al., 2008) vectors. Kim et al. (2009) used an aroA mutant of Bordetella bronchiseptica, which efficiently colonized ciliated respiratory mucosa of pigs, as a live vaccine vehicle for Cap protein expression. Results in mice and pigs showed that this bacterial vehicle could elicit an immune response against Cap protein and was effective in preventing PCV2 multiplication in pigs. Unfortunately, the kanamycin-resistant gene used for mutant selection was still present in the B. bronchiseptica genome, limiting its spread in the field.

The SEZ-Cap recombinant stain was a more promising vaccine candidate. Therefore, SEZ rather than B. bronchiseptica coincident with PCV2 plays an important role in respiratory infection development in the swine industry (Metwally et al., 2010), and the recombinant strain was constructed without any resistant marker. In addition, the Cap protein was stably expressed on SEZ at transcriptional and translational level both in vitro and in vivo. Real-time PCR showed that the cap gene could transcript at the same level as the substitutive szp gene, either in TSB culture or during the course of infection in mice. FACS and immunofluorescence microscopy analysis demonstrated that Cap protein could be displayed on the surface of SEZ. Almost all SEZ-Cap immune sera showed a higher S/P value than negative sera assessed by enzyme-linked immunosorbent assay, which indicated that the Cap protein was expressed in vivo and most individuals were able to mount an immune response against this protein. The two conditions above were indispensable to a successful vaccine.

In conclusion, we constructed a mutant SEZ-Cap strain expressing the major immunogenic Cap protein of PCV2 in place of the szp gene of SEZ C55138 ΔhasB. Experiments in mice demonstrated that the mutant strain was less virulent than the parental strain and that it induced a significant immune response in a mouse model when administered intraperitoneally. This may pave the way for developing a live attenuated SEZ-Cap vaccine that induces protective immunity against both SEZ and PCV2. Further research in pigs is required to confirm protective levels and safety of this vaccine.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information

This study was supported by the National Swine Industry Technology System Foundation (CARS-36), China Postdoctoral Science Foundation (Grant No. 20110490971) and National Natural Science Foundation of China (Grant No. 30871772).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information
  • Allan GM & Ellis JA (2000) Porcine circoviruses: a review. J Vet Diagn Invest 12: 314.
  • An DJ , Song DS & Park BK (2008) Systemic cytokine profiles of mice vaccinated with naked DNAs encoding six open reading frame antigens of porcine circovirus type 2 (PCV2). Res Vet Sci 85: 503509.
  • Biswas I , Gruss A , Ehrlich SD & Maguin E (1993) High-efficiency gene inactivation and replacement system for gram-positive bacteria. J Bacteriol 175: 36283635.
  • Bucarey SA , Noriega J , Reyes P , Tapia C , Saenz L , Zuniga A & Tobar JA (2009) The optimized capsid gene of porcine circovirus type 2 expressed in yeast forms virus-like particles and elicits antibody responses in mice fed with recombinant yeast extracts. Vaccine 27: 57815790.
  • Cheung AK & Bolin SR (2002) Kinetics of porcine circovirus type 2 replication. Arch Virol 147: 4358.
  • Fan H , Pan Y , Fang L , Wang D , Wang S , Jiang Y , Chen H & Xiao S (2008a) Construction and immunogenicity of recombinant pseudotype baculovirus expressing the capsid protein of porcine circovirus type 2 in mice. J Virol Methods 150: 2126.
  • Fan H , Xiao S , Tong T , Wang S , Xie L , Jiang Y , Chen H & Fang L (2008b) Immunogenicity of porcine circovirus type 2 capsid protein targeting to different subcellular compartments. Mol Immunol 45: 653660.
  • Hong-Jie F , Fu-yu T , Ying M & Cheng-ping L (2009) Virulence and antigenicity of the szp-gene deleted Streptococcus equi ssp. zooepidemicus mutant in mice. Vaccine 27: 5661.
  • Ju C , Fan H , Tan Y , Liu Z , Xi X , Cao S , Wu B & Chen H (2005) Immunogenicity of a recombinant pseudorabies virus expressing ORF1-ORF2 fusion protein of porcine circovirus type 2. Vet Microbiol 109: 179190.
  • Kamstrup S , Barfoed AM , Frimann TH , Ladekjaer-Mikkelsen AS & Botner A (2004) Immunisation against PCV2 structural protein by DNA vaccination of mice. Vaccine 22: 13581361.
  • Kim T , Toan NT , Seo J , Jung B , Lee J & Lee B (2009) Bordetella bronchiseptica aroA mutant as a live vaccine vehicle for heterologous porcine circovirus type 2 major capsid protein expression. Vet Microbiol 138: 318324.
  • Li L , Zhou R , Li T , Kang M , Wan Y , Xu Z & Chen H (2008) Enhanced biofilm formation and reduced virulence of Actinobacillus pleuropneumoniae luxS mutant. Microb Pathog 45: 192200.
  • Liu Q , Tikoo SK & Babiuk LA (2001) Nuclear localization of the ORF2 protein encoded by porcine circovirus type 2. Virology 285: 9199.
  • Meehan M , Nowlan P & Owen P (1998) Affinity purification and characterization of a fibrinogen-binding protein complex which protects mice against lethal challenge with Streptococcus equi subsp. equi. Microbiology 144: 9931003.
  • Metwally S , Mohamed F , Faaberg K et al. (2010) Pathogenicity and molecular characterization of emerging porcine reproductive and respiratory syndrome virus in Vietnam in 2007. Transbound Emerg Dis 57: 315329.
  • Nawagitgul P , Morozov I , Bolin SR , Harms PA , Sorden SD & Paul PS (2000) Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. J Gen Virol 81: 22812287.
  • Ogunniyi AD , Giammarinaro P & Paton JC (2002) The genes encoding virulence-associated proteins and the capsule of Streptococcus pneumoniae are upregulated and differentially expressed in vivo. Microbiology 148: 20452053.
  • Opriessnig T , Patterson AR , Madson DM , Pal N & Halbur PG (2009) Comparison of efficacy of commercial one dose and two dose PCV2 vaccines using a mixed PRRSV-PCV2-SIV clinical infection model 2-3-months post vaccination. Vaccine 27: 10021007.
  • Perez-Martin E , Gomez-Sebastian S , Argilaguet JM , Sibila M , Fort M , Nofrarias M , Kurtz S , Escribano JM , Segales J & Rodriguez F (2010) Immunity conferred by an experimental vaccine based on the recombinant PCV2 Cap protein expressed in Trichoplusia ni-larvae. Vaccine 28: 23402349.
  • Rubinsztein-Dunlop S , Guy B , Lissolo L & Fischer H (2005) Identification of two new Helicobacter pylori surface proteins involved in attachment to epithelial cell lines. J Med Microbiol 54: 427434.
  • Tunney MM , Patrick S , Curran MD , Ramage G , Hanna D , Nixon JR , Gorman SP , Davis RI & Anderson N (1999) Detection of prosthetic hip infection at revision arthroplasty by immunofluorescence microscopy and PCR amplification of the bacterial 16S rRNA gene. J Clin Microbiol 37: 32813290.
  • Wang X , Jiang P , Li Y , Jiang W & Dong X (2007) Protection of pigs against post-weaning multisystemic wasting syndrome by a recombinant adenovirus expressing the capsid protein of porcine circovirus type 2. Vet Microbiol 121: 215224.
  • Wang K , Huang L , Kong J & Zhang X (2008) Expression of the capsid protein of porcine circovirus type 2 in Lactococcus lactis for oral vaccination. J Virol Methods 150: 16.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authors' contribution
  9. References
  10. Supporting Information
FilenameFormatSizeDescription
fml2569-sup-0001-DataS1.docWord document32KData S1. The sequence of PCR product and the deduced sequence of SZP-Cap fusion protein.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.