SEARCH

SEARCH BY CITATION

Keywords:

  • angiogenesis;
  • chemokines;
  • FGF;
  • inflammation;
  • macrophages

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fibroblast growth factor-2 (FGF2) is a potent angiogenic growth factor. Here, gene expression profiling of FGF2-stimulated microvascular endothelial cells revealed, together with a prominent pro-angiogenic profile, a pro-inflammatory signature characterized by the up-regulation of pro-inflammatory cytokine/chemokines and their receptors, endothelial cell adhesion molecules and members of the eicosanoid pathway. Real-time quantitative PCR demonstrated early induction of most of the FGF2-induced, inflammation-related genes. Accordingly, chick embryo chorioallantoic membrane (CAM) and murine Matrigel plug angiogenesis assays demonstrated a significant monocyte/macrophage infiltrate in the areas of FGF2-driven neovascularization. Similar results were obtained when the conditioned medium (CM) of FGF2-stimulated endothelial cells was delivered onto the CAM, suggesting that FGF2-upregulated chemoattractants mediate the inflammatory response. Importantly, FGF2-triggered new blood vessel formation was significantly reduced in phosphatidylinositol 3-kinase-γ null mice exhibiting defective leucocyte migration or in clodronate liposome-treated, macrophage-depleted mice. Furthermore, the viral pan-chemokine antagonist M3 inhibited the angiogenic and inflammatory responses induced by the CM of FGF2-stimulated endothelial cells and impaired FGF2-driven neovascularization in the CAM assay. These findings point to inflammatory chemokines as early mediators of FGF2-driven angiogenesis and indicate a non-redundant role for inflammatory cells in the neovascularization process elicited by the growth factor.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Angiogenesis and inflammation are closely integrated processes in a number of physiological and pathological conditions, including wound healing, psoriasis, diabetic retinopathy, rheumatoid arthritis, arteriosclerosis and cancer [1, 2]. Inflammatory cells may produce angiogenic cytokines, growth factors and proteases that contribute to the formation of new vascular structures at the site of inflammation, tissue damage or tumour growth [3]. Conversely, microvascular endothelium activated by a number of cytokines and angiogenic growth factors can express pro-inflammatory molecules involved in leucocyte recruitment and activation [4, 5]. Strikingly, neovascularization and inflammation share a number of common signalling pathways and molecular mediators, the cyclooxygenase (Cox)/prostaglandin pathway representing a paradigm of this convergence [6]. Also, various chemokines may act both as leucocyte attractants and as angiogenic inducers by acting directly on endothelial cells [7]. Moreover, a number of pro-inflammatory cytokines [e.g. interleukin-1α (IL-1α), IL-1β, IL-6, tumour necrosis factor-α (TNFα), high mobility group box-1 (HMGB1) and osteopontin (Opn)] may induce blood vessel formation via direct engagement of target endothelial cells or indirectly by inducing leucocytes and/or endothelial cells to produce pro-angiogenic mediators [8–10]. Conversely, the angiogenic factors vascular endothelial growth factor (VEGF) and angiopoietin-1 (Ang-1) may elicit pro-inflammatory responses in endothelial cells by up-regulating the expression of cell adhesion molecules and inflammatory mediators [11, 12].

Fibroblast growth factor 2 (FGF2) is a pleiotropic heparin-binding factor that promotes growth and differentiation of a broad spectrum of cell types [13]. FGF2 triggers a complex ‘pro-angiogenic phenotype’ in endothelial cells that recapitulates the neovascularization process and exerts a potent angiogenic response in a variety of in vivo animal models [13]. The angiogenic activity of FGF2 is mediated by its interaction with high-affinity tyrosine kinase FGF receptors (FGFRs) and low-affinity heparan sulphate proteoglycans and integrin receptors, leading to the activation of multiple signal transduction pathways, including phospholipase C-γ, phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinases [13, 14].

Elevated levels of FGF2 have been implicated in the pathogenesis of several diseases characterized by a deregulated angiogenic/ inflammatory response, including cancer [13]. Inflammatory cells, including mononuclear phagocytes, T lymphocytes and mast cells, express FGF2. Moreover, FGF2 production and release from endothelial cells are triggered by inflammatory mediators (reviewed in [13]). Conversely, FGF2 may amplify the endothelial cell response to inflammatory stimuli [15] and up-regulates the expression of Opn[10], Ccl2 chemokine [16] and Cox-2[17] in endothelial cells. Taken together, these observations point to the existence of a tight cross-talk between inflammatory and angiogenic responses during FGF2-driven neovascularization.

Here, we report that FGF2 induces a pro-inflammatory signature in murine microvascular endothelial cells. Consistently, we provide in vivo evidence about the non-redundant role of chemokines and infiltrating monocytes/macrophages in FGF2-driven neovascularization.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Reagents and cells

Recombinant human FGF2 was purified as previously described [18]. Ketoprofen and hydrocortisone were purchased from Sigma-Aldrich (Saint Louis, MO, USA). Recombinant M3 protein was expressed in the baculovirus system and purified by affinity chromatography [19].

Murine lung microvascular endothelial cells (1G11 cells) [20] were obtained from A. Vecchi (Istituto Scientifico Humanitas, Rezzato, Milan, Italy) and cultured in Dulbecco modified Eagle medium (DMEM) containing 20% inactivated foetal bovine serum (FBS). Cells were usually starved for 24 hrs with DMEM containing 0.5% FBS before stimulation with FGF2. In all the assays, endotoxin content was lower than 0.06 EU/ml (6 pg/ml), as determined by the Limulus amebocyte lysate method (Cambrex BioSiences, Walkersville, MD, USA).

Affymetrix genechip analysis

Three independent 1G11 cell cultures were stimulated for 10 hrs with 30 ng/ml FGF2 in DMEM supplemented with 0.5% FBS. As a control reference, duplicate samples from non-treated cells were also analysed. RNA extraction, reverse transcription, cRNA preparation and GeneChip hybridization were performed according to the manufacturer's instructions (http://www.affymetrix.com/support/technical/manual/expression_manual.affx, Affymetrix, Santa Clara, CA, USA). Briefly, total RNA was extracted using Trizol (Invitrogen Life Technologies, Carlsbad, CA, USA) and phase lock gels (Eppendorf, Hamburg, Deutschland) and purified with Rneasy columns (Qiagen, Valencia, CA, USA). Ten micrograms of RNA were then used as a template for double-stranded cDNA synthesis primed using a T7-(dT)24 oligonucleotide. Double-stranded cDNA was then transcribed using T7 RNA polymerase to produce biotin-labelled cRNA. Resulting cRNA was fragmented and hybridized to Affymetrix GeneChip Murine Genome MOE430A oligonucleotide microarrays.

To define the transcriptional profile modulated by FGF2, raw expression measures at the probe level data were computed using robust multi-array average. Quantile normalization was performed across all microarrays to achieve the same distribution of signal intensities for each array [21]. Data analysis was then carried out using Genespring 7.3 software (Silicon Genetics, Redwood City, CA, USA). Initial data filtering of genes with a ‘present’ detection call in at least one chip, according to Affymetrix MAS5 algorithm, was applied. Differential expression was assessed by applying a twofold change cut-off and a Welch-modified two-sample t-test. A false discovery rate of 5% was used as a cut-off for statistical significance.

FGF2-regulated genes were annotated by employing the web-accessible software DAVID [22] (Database for Annotation, Visualization and Integrated Discovery; http://david.abcc.ncifcrf.gov/) and NetAffx Analysis Center (http://www.affymetrix.com/analysis/index.affx), which provides functional genomic annotations for gene ontology (GO), protein domain and biological pathways. Over-represented signatures, based on GO terms (cellular localization, molecular function and biological process) were identified using statistical Fisher's test (P < 0.05) and the whole MOE430A gene list as the reference list. The complete, minimum information about a microarray experiment (MIAME)-compliant dataset is available at the public repository ArrayExpress at the EBI (Hinxton, UK) (accession number E-MEXP-1467).

Real-time PCR analysis

Two-step quantitative RT-PCR (qRT-PCR) was employed to validate microarray expression data on a selected list of genes (Table 1). Random-primed RT was carried out with 50 ng of RNA and High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA). Reactions lacking enzyme were carried out in tandem for each RNA sample as negative controls. One-fiftieth of the final RT reaction was used as template in qRT-PCR reactions containing HPLC-purified oligonucleotide primers (Thermo Electron, Ulm, Germany) specific for selected genes (the list of oligonucleotide primer sequences utilized in the present work are shown in Table 1). Primers were designed with Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www_slow.cgi) using the following settings: 100–200 bp PCR products, 18–22 mer primers, 60°C melting temperatures. Gene names, accession numbers and forward and reverse primer sequences are listed in Table 1 with the only exception for the Cxcl1 gene that was analysed by using a Gene Expression Assay (Mm00433859_m1) from Applied Biosystems and the manufacturer's TaqMan® PreAmp Master Mix Kit Protocol. Each primer set produced a single product, as determined by melt-curve analysis. Real-time PCR was carried out on a iCycler Real-Time PCR Detection System (BioRad Richmond, CA, USA) using 25-μl reactions containing iQ SYBR Green Supermix, 150–300 nM forward and reverse primers and 5 μl of cDNA-diluted template. The PCR cycling profile was as follows: 3 min. at 95°C and 40 cycles for 15 sec. at 95°C, 60°C for 1 min. After PCR amplification, melting curve analysis was performed for each reaction.

Table 1.  Quantitative RT-PCR: oligonucleotide primer sequences
Gene RefSeq Forward Reverse Amplicon
ActbNM_007393 CGTAAAGACCTCTATGCCAACA CCACCGATCCACACAGAGA 161
Ccl2 NM_011333 CTTCTGGGCCTGCTGTTCA CCAGCCTACTCATTGGGATCA 127
Ccl7 NM_013654 CCTGGGAAGCTGTTATCTTCA TTGGCTCCTAGGTTGGTTTC 159
Cx3cl1 NM_009142 CATGTGCGACAAGATGACC CTTGGACCCATTTCTCCTTC 149
Cxcl16 NM_023158 CCATTCTTTATCAGGTTCCAGT CTCGTGTCCGAAGGTGTC 200
Egr1 NM_007913 CCTGACCACAGAGTCCTTTT ATAGGTGATGGGAGGCAAC 103
IL6 NM_031168 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA 141
Jam2 NM_023844 TGCTGGAGAGTATCGCTGT CTTCTTTATCCTGGCATCGT 157
Ptgs2 NM_011198 GGTGTGAACAATCAAACAAAATG TAACATGCTTGGGTCAGTCAAT 160
Vcam1 NM_011693 GAACTGATTATCCAAGTCTCTCCA CCATGTCTCCTGTCTTTGCTT 157

Each PCR reaction was performed in triplicate on one plate and fluorescence data were recorded using iCycler software (BioRad). Relative expression ratios were calculated by use of Pfaffl equation and Relative Expression Software Tool (http://www.gene-quantification.info). The mRNA expression levels of target genes were normalized to the levels of β-actin gene, which, according to microarray experiments, behaves as a housekeeping gene under the tested conditions.

Endothelial cell adhesion to FGF2-coated plastic dishes

Adhesion of 1G11 cells to FGF2-coated plastic dishes was performed as described [23] with minor modifications. Non-tissue polystyrene culture plastic 35-mm dishes were incubated with 100 mM NaHCO3, pH 9.6 (carbonate buffer) containing 5 μg/ml of FGF2. After 16 hrs of incubation at 4°C, the dishes were washed with cold carbonate buffer and DMEM containing 0.5% FBS. Then, serum-starved 1G11 cells were seeded at 100,000 cells/dish and incubated for 24 hrs in DMEM/0.5% FBS. Cells were dissociated in Trizol for RNA extraction followed by qRT-PCR. The conditioned medium (CM) from FGF2-stimulated cells was collected and stored at −20°C until use. For comparison, confluent cultures of 1G11 cells were treated for 24 hrs with 30 ng/ml of free human recombinant FGF2 whereas untreated cells seeded on tissue culture polystyrene plastic plates were used as negative controls.

Chemotaxis assay

Human monocytes were obtained from buffy coats of healthy blood donors by Ficoll (Lympholite-H, Cederlane Labs, Hornly, Canada) and Percoll (GE Healthcare, Little Chalfont, UK) gradients. Chemotaxis was assayed in 96 well-plates (Neuro Probe, Inc., Gaithersburg, MD, USA) containing a polycarbonate filter with 5-μm pores. Briefly, monocytes were resuspended in RPMI-1640 medium containing 1% serum, and then loaded onto inserts at 5 × 103 cells/50 μl for each well. Thirty microlitres of RPMI-1640 medium containing the chemoattractants at the indicated concentrations were placed in the bottom compartment. After 1.5 hrs of incubation at 37°C with 5% CO2, non-migrating cells were scraped from the upper surface of the filter. Migrating cells on the lower surface were fixed with methanol, stained with Diff-Quik (Baxter Healthcare, Miami, FL, USA) and their number was determined by counting five microscopic fields per well at ×250 magnification. For inhibitory assays, cells and media were pre-incubated for 30 min. with the indicated concentrations of the pan-chemokine inhibitor M3 before loading onto Transwell inserts (Sigma-Aldrich). Each sample was tested in triplicate.

Matrigel plug angiogenesis assay

Liquid Matrigel (10 mg/ml; 0.5 ml/mouse) was mixed at 4°C with FGF2 (1.0 μg/ml) and injected subcutaneously into the flank of 6-week-old C57BL/6 mice (Charles River, Calco, Italy). Matrigel with PBS alone was used as negative control. Alternatively, 5-week-old 129sv WT and 129sv PI3Kγ−/− mice [24] were used. On day 7 after implantation, mice were killed and plugs were removed, embedded in Tissue Tec OCT (Sigma-Aldrich), snap-frozen in liquid nitrogen-cooled isopentane and stored at −80°C.

Macrophage depletion

Six-week-old C57BL/6 mice were injected intraperitoneally with clodronate liposomes (Clodro-lip) or PBS liposomes (PBS-lip) every 4 days (initial dose 1.5 mg/20 g mouse, then every fourth day 0.8 mg/20 g mouse) for 4 weeks as described [25]. During the fourth week of treatment, mice were used for the FGF2-Matrigel assay as described above and killed by cervical dislocation 3 days after the last clodronate liposome injection.

Immunofluorescence analysis

Eight micrometres frozen sections of Matrigel plugs were fixed in ice-cold acetone. After blocking with 10% goat serum in Tris-buffered saline, sections were stained with rat IgG2b monoclonal antibodies raised against mouse CD45, mouse F4/80 or mouse CD11b (all at 1/100 dilution, Serotec, Martinsried/Planegg, Germany), followed by incubation with FITC-conjugated goat anti-rat IgG antibody (1/100 dilution, Santa Cruz, Biotechnology, Santa Cruz, CA, USA). Alternatively, to evaluate microvessel density, sections were incubated with rat IgG2a antimouse CD31 monoclonal antibody followed by incubation with biotinylated mouse anti-rat IgG1/2a antibody (both at 1/100 dilution, BD Pharmingen, San Diego, CA, USA) and Texas red avidin (1/800 dilution, Vector Laboratories, Inc., Burlingame, CA, USA). Nuclei were counterstained by 4′,6-diamidino-2-phenylindole (Sigma-Aldrich). For imaging analysis, CD31 immunostaining was performed on F4/80-pre-stained sections. Images were acquired using an epifluorescence microscope (Zeiss, Inc., Jena, Germany) equipped with an Olympus N547 digital camera (Olympus, Hamburg, Germany) at ×200 magnification.

Imaging and statistical analysis

Experimental groups included at least five mice. The Matrigel regions containing the most intense CD31+ areas of neovascularization (‘hotspots’) were chosen for quantification. Five hotspots per Matrigel section and two sections per Matrigel plug were analysed. The ImagePro Plus analysis system was used to measure CD31+ and F4/80+ areas in each hotspot. Statistical analysis was performed with two-tailed Student's t-test. Differences were considered statistically significant at P < 0.05.

Chicken embryo chorioallantoic membrane (CAM) assay

Alginate beads (5 μl) containing the sample under test were placed on top of the CAM of fertilized White Leghorn chicken eggs at day 11 of incubation [26]. After 72 hrs, blood microvessels entering the implants within the focal plane of the CAM were counted in ovo at ×5 magnification using a STEMI SR stereomicroscope equipped with an objective f equal to 100 mm with adapter ring 475070 (Zeiss). Then, the CAMs were cut, fixed with 4% paraformaldehyde and stained May Grünwald-Giemsa to visualize the inflammatory infiltrate. The experiments were repeated at least twice with 7–10 eggs per group.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Transcriptional profiling of FGF2-stimulated murine microvascular endothelial cells reveals a pro-inflammatory signature

To assess the effect of FGF2 on the transcriptional profile of microvascular endothelium, confluent monolayers of mouse lung capillary endothelial 1G11 cells were stimulated for 10 hrs with 30 ng/ml FGF2 in low-serum culture medium. The transcriptional profile was then determined by microarray analysis using Affymetrix MOE4303A genechips (consisting of 22,690 probe sets, corresponding to approximately 15,000 genes) and compared to that of unstimulated cells.

FGF2 treatment exerts a significant impact on the microvascular endothelial cell transcriptome. Indeed, 239 FGF2-modulated genes were identified by combining twofold change filtering with statistical significance analysis. Among these genes, 146 transcripts were up-regulated following FGF2 stimulation whereas 93 genes were down-regulated. Most of the FGF2-modulated transcripts correspond to annotated genes whereas 14 genes were unidentified or hypothetical (a comprehensive list of all the differentially expressed genes is provided in Table 2).

Table 2.  FGF2-regulated genes in microvascular 1G11 endothelial cells
FGF2-upregulated genes (fold change > 2; P < 0.05)
Fold change Gene symbol Gene name Unigene ID Affymetrix ID
  1. The fold change, the official gene symbol and name, the Unigene cluster and the Affymetrix probe set ID number are shown. Note that various genes are interrogated by more than one probe set in the Affymetrix MOE430A genechip.

21.5Mmp13Matrix metallopeptidase 13Mm.50221417256_at
18.5Ptgs2Prostaglandin-endoperoxide synthase 2Mm.2925471417262_at
14.3   1417263_at
16.4Sprr1aSmall proline-rich protein 1AMm.3311911449133_at
13.4Prl2c2Prolactin family 2, subfamily c, member 2Mm.887961427760_s_at
11.1Spp1Secreted phosphoprotein 1Mm.2884741449254_at
8.4HbegfHeparin-binding EGF-like growth factorMm.2896811418350_at
7.1   1418349_at
8.1EregEpiregulinMm.47911419431_at
7.8SgkSerum/glucocorticoid regulated kinaseMm.284051416041_at
7.7Hmga2High mobility group AT-hook 2Mm.1571901450780_s_at
7.3   1422851_at
5.8   1450781_at
7.0Prkg2Protein kinase, cGMP-dependent, type IIMm.2630021435162_at
6.01600029D21RikRIKEN cDNA 1600029D21 geneMm.299591423933_a_at
6.0Cd44CD44 antigenMm.4236211452483_a_at
4.9   1423760_at
6.0Errfi1ERBB receptor feedback inhibitor 1Mm.3188411416129_at
2.6   1419816_s_at
5.71810011O10RikRIKEN cDNA 1810011O10 geneMm.257751451415_at
5.6Serpinb2Serine (or cysteine) peptidase inhibitor, clade B, member 2Mm.2718701419082_at
5.5Egr2Early growth response 2Mm.2904211427683_a_at
4.9   1427682_at
5.0IvlInvolucrinMm.2073651422222_at
4.9Tnfrsf23Tumour necrosis factor receptor superfamily, member 23Mm.2907801422101_at
4.8Ptger4Prostaglandin E receptor 4 (subtype EP4)Mm.185091424208_at
4.1   1421073_a_at
4.2Fosl1Fos-like antigen 1Mm.62151417487_at
3.2   1417488_at
4.2Tnfrsf22Tumour necrosis factor receptor superfamily, member 22Mm.2613841422039_at
3.1   1422038_a_at
2.1   1426095_a_at
4.1MgpMatrix Gla proteinMm.2430851448416_at
4.0Edg1Endothelial differentiation sphingolipid G-protein-coupled receptor 1Mm.9821423571_at
3.8Hmga1High mobility group AT-hook 1Mm.44381416184_s_at
3.8Il6Interleukin 6Mm.10191450297_at
3.8Arhgap6Rho GTPase activating protein 6Mm.4418101451867_×_at
2.7   1456333_a_at
2.6   1417704_a_at
3.6Ier2Immediate early response 2Mm.3991416442_at
3.6MetrnlMeteorin, glial cell differentiation regulator-likeMm.1535661424356_a_at
3.5Egr1Early growth response 1Mm.1819591417065_at
3.5Ccl2Chemokine (C-C motif) ligand 2Mm.2903201420380_at
3.5Gfpt2Glutamine fructose-6-phosphate transaminase 2Mm.244021418753_at
3.4Ccrn4lCCR4 carbon catabolite repression 4-like (S. Cerevisiae)Mm.865411425837_a_at
3.4PvrPoliovirus receptorMm.2275061450295_s_at
3.3   1423905_at
2.8   1423903_at
2.7   1451160_s_at
3.3MycMyelocytomatosis oncogeneMm.24441424942_a_at
3.2A030007L17RikRIKEN cDNA A030007L17 geneMm.2947081435695_a_at
3.2PlaurPlasminogen activator, urokinase receptorMm.13591452521_a_at
3.2Dusp6Dual specificity phosphatase 6Mm.17911415834_at
3.2Hk2Hexokinase 2Mm.2558481422612_at
3.2Slc2a1Solute carrier family 2 (facilitated glucose transporter), member 1Mm.210021426599_a_at
3.1   1426600_at
2.8   1434773_a_at
3.1Ccl7Chemokine (C-C motif) ligand 7Mm.3415741421228_at
3.1Serpine1Serine (or cysteine) peptidase inhibitor, clade E, member 1Mm.2504221419149_at
3.1Gch1GTP cyclohydrolase 1Mm.106511420499_at
3.1   1429692_s_at
3.1Vcam1Vascular cell adhesion molecule 1Mm.766491451314_a_at
2.6   1415989_at
3.1MmdMonocyte to macrophage differentiation associatedMm.2775181423489_at
2.6   1423488_ats
3.1PdgfbPlatelet-derived growth factor, B polypeptideMm.1440891450414_at
2.1   1450413_at
3.0Slc4a7Solute carrier family 4, sodium bicarbonate cotransporter, member 7Mm.2588931438673_at
3.0Slit2Slit homolog 2 (Drosophila)Mm.2897391424659_at
2.9JunbJun-B oncogeneMm.11671415899_at
2.9Nr4a1Nuclear receptor subfamily 4, group A, member 1Mm.1191416505_at
2.9Ell2Elongation factor RNA polymerase II 2Mm.212881450744_at
2.9Tnfrsf12aTumour necrosis factor receptor superfamily, member 12aMm.285181418571_at
2.9   1418572_×_at
2.9Rgs2Regulator of G-protein signalling 2Mm.282621419248_at
2.6   1419247_at
2.9Ankrd1Ankyrin repeat domain 1 (cardiac muscle)Mm.102791420991_at
2.3   1420992_at
2.9Sox9SRY-box containing gene 9Mm.2864071424950_at
2.1   1451538_at
2.8F3Coagulation factor IIIMm.2731881417408_at
2.8Grem1Gremlin 1Mm.4584921425357_a_at
2.8Ifrd1Interferon-related developmental regulator 1Mm.1681416067_at
2.7Antxr2Anthrax toxin receptor 2Mm.248421426708_at
2.7AregAmphiregulinMm.80391421134_at
2.7Nmt2N-myristoyltransferase 2Mm.650211423581_at
2.7Runx1Runt-related transcription factor 1Mm.40811422864_at
2.4   1422865_at
2.7Thbs1Thrombospondin 1Mm.41591450377_at
2.3   1460302_at
2.7Lrig1Leucine-rich repeats and immunoglobulin-like domains 1Mm.2452101449893_a_at
2.3   1434210_s_at
2.6Car8Carbonic anhydrase 8Mm.1193201427482_a_at
2.6Clcf1cardiotrophin-like cytokine factor 1Mm.3479191437270_a_at
2.6Tnnt2Troponin T2, cardiacMm.2474701418726_a_at
2.4   1424967_×_at
2.6Steap1Six transmembrane epithelial antigen of the prostate 1Mm.854291424938_at
2.3   1451532_s_at
2.5Map3k6Mitogen-activated protein kinase kinase kinase 6Mm.366401449901_a_at
2.5Fxyd5FXYD domain-containing ion transport regulator 5Mm.18701418296_at
2.5Timp1Tissue inhibitor of metalloproteinase 1Mm.82451460227_at
2.5Baiap2l1BAI1-associated protein 2-like 1Mm.188141424951_at
2.5Adam19A disintegrin and metallopeptidase domain 19 (meltrin βMm.899401418403_at
2.4   1418402_at
2.51200016E24RikRIKEN cDNA 1200016E24 geneMm.3329311435138_s_at
2.3   1453237_s_at
2.5Ero1lERO1-like (S. cerevisiae)Mm.3871081419030_at
2.1   1419029_at
2.2   1449324_at
2.4TecCytoplasmic tyrosine kinase, Dscr28C related (Drosophila)Mm.3195811460204_at
2.4RhojRAS homolog gene family, member JMm.274671418892_at
2.4Lyve1Lymphatic vessel endothelial hyaluronan receptor 1Mm.3960781429379_at
2.4Slc20a2Solute carrier family 20, member 2Mm.3239011434235_at
2.4Slc25a37Solute carrier family 25, member 37Mm.2936351417750_a_at
2.4Wisp1WNT1 inducible signalling pathway protein 1Mm.102221448594_at
2.3   1448593_at
2.4CpCeruloplasminMm.137871455393_at
2.1   1417495_×_at
2.1   1417496_at
2.0   1448734_at
2.4TesTestis-derived transcriptMm.4365481460378_a_at
2.1   1424246_a_at
2.3CalcrlCalcitonin receptor likeMm.754671425814_a_at
2.3Dfna5hDeafness, autosomal dominant 5 homolog (human)Mm.2483611421534_at
2.3Serpina3nSerine (or cysteine) peptidase inhibitor, clade A, member 3NMm.226501419100_at
2.3Tnfaip8Tumour necrosis factor, ·-induced protein 8Mm.277401416950_at
2.3Fgf2Fibroblast growth factor 2Mm.4579751449826_a_at
2.3LifLeukaemia inhibitory factorMm.49641421207_at
2.3Plk2Polo-like kinase 2 (Drosophila)Mm.3801427005_at
2.3PtpreProtein tyrosine phosphatase, receptor type, EMm.9451418540_a_at
2.3Il1rapInterleukin 1 receptor accessory proteinMm.2534241421844_at
2.3CtgfConnective tissue growth factorMm.3930581416953_at
2.3Phlda1Pleckstrin homology-like domain, family A, member 1Mm.31171418835_at
2.3OafOAF homolog (Drosophila)Mm.2464791424086_at
2.3Jam2Junction adhesion molecule 2Mm.417581419288_at
2.3   1431416_a_at
2.1   1449408_at
2.3Slc12a2Solute carrier family 12, member 2Mm.3999971417622_at
2.2   1417623_at
2.3Hsd17b7Hydroxysteroid (17-β) dehydrogenase 7Mm.128821417871_at
2.2   1448865_at
2.3Tnfaip2Tumour necrosis factor, α-induced protein 2Mm.2553321438855_×_at
2.1   1416273_at
2.2PorP450 (cytochrome) oxidoreductaseMm.38631416933_at
2.2Nfil3Nuclear factor, interleukin 3, regulatedMm.1366041418932_at
2.2Tgfb1Transforming growth factor, β1Mm.2483801420653_at
2.2Trib2Tribbles homolog 2 (Drosophila)Mm.2666791426641_at
2.2Fli1Friend leukaemia integration 1Mm.2589081433512_at
2.2Etv4Ets variant gene 4 (E1A enhancer binding protein, E1AF)Mm.50251423232_at
2.2Btg1B-cell translocation gene 1, anti-proliferativeMm.2721831426083_a_at
2.2TgfaTransforming growth factor αMm.1372221421943_at
2.2Rai14Retinoic acid induced 14Mm.2123951417401_at
2.2OsmrOncostatin M receptorMm.107601418674_at
2.1   1418675_at
2.2Rasa1RAS p21 protein activator 1Mm.2596531426477_at
2.0   1426476_at
2.2Gprc5bG protein-coupled receptor, family C, group 5, member BMm.1034391451411_at
2.0   1424613_at
2.1Hmgcr3-hydroxy-3-methylglutaryl-Coenzyme A reductaseMm.3166521427229_at
2.1Grwd1Glutamate-rich WD repeat containing 1Mm.2748471455841_s_at
2.1Lrrc8cLeucine-rich repeat containing 8 family, member CMm.3198471423614_at
2.1Chst11Carbohydrate sulfotransferase 11Mm.3607471450509_at
2.1FosFBJ osteosarcoma oncogeneMm.2465131423100_at
2.1Tnfsf9Tumour necrosis factor (ligand) superfamily, member 9Mm.411711422924_at
2.1Run×2Runt-related transcription factor 2Mm.3910131424704_at
2.1Cyb561Cytochrome b-561Mm.1494031417507_at
2.1Mpp6Membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)Mm.412881449348_at
2.1B4galt6UDP-Gal: βGlcNAc β 1,4-galactosyltransferase, polypeptide 6Mm.3981811460329_at
2.1Spred1Sprouty protein with EVH-1 domain 1, related sequenceMm.3927261423161_s_at
2.1Efnb2Ephrin B2Mm.2098131449548_at
2.1   1419639_at
2.0   1419638_at
2.1Enc1Ectodermal-neural cortex 1Mm.2410731450061_at
2.1   1420965_a_at
2.0Snai1Snail homolog 1 (Drosophila)Mm.20931448742_at
2.0Maffv-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian)Mm.866461418936_at
2.0Rab20RAB20, member RAS oncogene familyMm.3900141438097_at
2.0ChkaCholine kinase αMm.2255051450264_a_at
2.0Mthfd2Methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolaseMm.4431419254_at
2.0Slc20a1Solute carrier family 20, member 1Mm.4579951448568_a_at
2.02010002N04RikRIKEN cDNA 2010002N04 geneMm.2731971423306_at
2.0Slco3a1Solute carrier organic anion transporter family, member 3a1Mm.4254671418030_at
2.0C×3cl1Chemokine (C-X3-C motif) ligand 1Mm.1037111415803_at
2.0Flnbfilamin, βMm.280951426750_at
2.01810054D07RikRIKEN cDNA 1810054D07 geneMm.55401440192_at
2.0Ifi204Interferon activated gene 204Mm.4425611419603_at
2.0Itga5Integrin α 5 (fibronectin receptor α)Mm.162341423267_s_at
2.0Klf10Kruppel-like factor 10Mm.42921416029_at
2.0Ier3Immediate early response 3Mm.256131419647_a_at
2.0Spred2Sprouty-related, EVH1 domain containing 2Mm.2666271434403_at
2.0Cyp51Cytochrome P450, family 51Mm.1401581422533_at
2.0Ier5Immediate early response 5Mm.122461417612_at
2.0Eea1Early endosome antigen 1Mm.2100351438045_at
2.0Cdca7Cell division cycle associated 7Mm.2706761428069_at
2.0Stc2Stanniocalcin 2Mm.325061449484_at
2.0Acsl4Acyl-CoA synthetase long-chain family member 4Mm.3913371433531_at
2.0Cxcl16Chemokine (C-X-C motif) ligand 16Mm.4414111418718_at
2.0   1449195_s_at
−5.7Mettl7aMethyltransferase like 7AMm.2209751434150_a_at
−5.0   1434151_at
−4.9   1454858_×_at
−4.2   1421184_a_at
−5.1Akr1c14Aldo-keto reductase family 1, member C14Mm.268381418979_at
−4.4DbpD site albumin promoter binding proteinMm.3782351438211_s_at
−2.7   1418174_at
−3.8SordSorbitol dehydrogenaseMm.3715801426584_a_at
−2.5   1438183_×_at
−3.5Sesn1Sestrin 1Mm.1394181454699_at
−3.3   1438931_s_at
−3.0   1433711_s_at
−3.3SncaipSynuclein, α interacting protein (synphilin)Mm.2921681423499_at
−3.1Transcribed locusMm.3917361455582_at
−3.1Rab40bRab40b, member RAS oncogene familyMm.2816391436566_at
−3.1Angptl7Angiopoietin-like 7Mm.3889291451478_at
−3.3Tgm2Transglutaminase 2, C polypeptideMm.3307311455900_×_at
−3.1   1417500_a_at
−3.1   1433428_×_at
−3.1   1437277_×_at
−2.7   1426004_a_at
−3.0Ptplad2Protein tyrosine phosphatase-like A domain containing 2Mm.3867881450967_at
−3.0Mapre2Microtubule-associated protein, RP/EB family, member 2Mm.1322371451989_a_at
−3.0Unc119Unc-119 homolog (C. elegans)Mm.2848111418123_at
−3.0AW548124Expressed sequence AW548124Mm.3119741454838_s_at
−2.4   1460411_s_at
−2.9Rasl11bRAS-like, family 11, member BMm.2933161423854_a_at
−2.9D0H4S114DNA segment, human D4S114Mm.4074151436736_×_at
−2.8   1450839_at
−2.8Bnc1Basonuclin 1Mm.2438021424890_at
−2.8Sfrp2Secreted frizzled-related protein 2Mm.191551448201_at
−2.8OgnOsteoglycinMm.42581419663_at
−2.5   1419662_at
−2.7Antxr1Anthrax toxin receptor 1Mm.2325251451446_at
−2.7Trp53inp1Transformation-related protein 53 inducible nuclear protein 1Mm.3930181416926_at
−2.3   1416927_at
−2.6Slc1a6Solute carrier family 1 (high-affinity aspartate/glutamate transporter), member 6Mm.62571418933_at
−2.6Fhl1Four and a half LIM domains 1Mm.31261417872_at
−2.6PkiaProtein kinase inhibitor, αMm.31931420858_at
−2.6   1420859_at
−2.6Ddit4lDNA-damage-inducible transcript 4-likeMm.2508411451751_at
−2.4   1439332_at
−2.6VldlrVery low density lipoprotein receptorMm.41411417900_a_at
−2.3   1434465_×_at
−2.6Fzd2Frizzled homolog 2 (Drosophila)Mm.364161418534_at
−2.1   1418532_at
−2.1   1418533_s_at
−2.5Pdlim3PDZ and LIM domain 3Mm.2829001449178_at
−2.5Dhrs3Dehydrogenase/reductase (SDR family) member 3Mm.140631448390_a_at
−2.5Ephx2Epoxide hydrolase 2, cytoplasmicMm.152951448499_a_at
−2.5Gab1Growth factor receptor bound protein 2-associated protein 1Mm.2774091417694_at
−2.3   1417693_a_at
−2.4Zfp521Zinc finger protein 521Mm.403251451332_at
−2.4SspnSarcospanMm.496891417644_at
−2.4Oplah5-oxoprolinase (ATP-hydrolysing)Mm.3227381424359_at
−2.4McamMelanoma cell adhesion moleculeMm.2750031416357_a_at
−2.4FigfC-Fos induced growth factorMm.2979781438954_×_at
2.3   1438953_at
−2.3Npr3Natriuretic peptide receptor 3Mm.252591435184_at
−2.3Mmp11Matrix metallopeptidase 11Mm.45611417234_at
−2.3TekEndothelial-specific receptor tyrosine kinaseMm.143131418788_at
−2.3Wdr6WD repeat domain 6Mm.3354541415770_at
−2.3   1455940_×_at
−2.2Adamts5A disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)Mm.1129331422561_at
−2.2PdgfraPlatelet-derived growth factor receptor, α polypeptideMm.2214031421917_at
−2.2Appl2Adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2Mm.2829851426743_at
−2.2Stard10START domain containing 10Mm.288961448956_at
−2.2Fgf18Fibroblast growth factor 18Mm.3398121449545_at
−2.2Apbb1Amyloid, (A4) precursor protein-binding, family B, member 1Mm.384691423893_×_at
−2.2PalmParalemminMm.346501423967_at
−2.2Slc25a23Solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23Mm.237201419045_at
−2.2Igf1Insulin-like growth factor 1Mm.2685211437401_at
−2.2Serpinb9Serine (or cysteine) peptidase inhibitor, clade B, member 9Mm.2725691422601_at
−2.2GamtGuanidinoacetate methyltransferaseMm.73291422558_at
−2.2Klhl13Kelch-like 13 (Drosophila)Mm.2243061448269_a_at
−2.0   1416242_at
−2.2Acaa2Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)Mm.2457241455061_a_at
−2.0   1428146_s_at
−2.1Slc39a8Solute carrier family 39 (metal ion transporter), member 8Mm.302391416832_at
−2.1Dzip1DAZ interacting protein 1Mm.874561452792_at
−2.1Aldh1a7Aldehyde dehydrogenase family 1, subfamily A7Mm.146091418601_at
−2.12310002J21RikRIKEN cDNA 2310002J21 geneMm.3750911456393_at
−2.1Pmp22Peripheral myelin proteinMm.12371417133_at
−2.1Ifit3Interferon-induced protein with tetratricopeptide repeats 3Mm.4260791449025_at
−2.1Tsc22d3TSC22 domain family 3Mm.222161425281_a_at
−2.16720475J19RikRIKEN cDNA 6720475J19 geneMm.2735361423072_at
−2.1Rtn1Reticulon 1Mm.2212751429761_at
−2.1Pdcd4Programmed cell death 4Mm.16051418840_at
−2.1Cables1Cdk5 and Abl enzyme substrate 1Mm.407171422477_at
−2.1ReckReversion-inducing cysteine-rich protein with kazal motifsMm.3315731450784_at
−2.1Gsta3Glutathione S-transferase, α3Mm.3945931423436_at
−2.1Myl7Myosin, light polypeptide 7, regulatoryMm.465141449071_at
−2.1Cd200Cd200 antigenMm.2458511448788_at
−2.11200015N20RikRIKEN cDNA 1200015N20 geneMm.198251448557_at
−2.1PtprdProtein tyrosine phosphatase, receptor type, DMm.1840211429052_at
−2.1DcxrDicarbonyl L-xylulose reductaseMm.2310911419456_at
−2.1Gadd45bGrowth arrest and DNA-damage-inducible 45 βMm.13601450971_at
−2.1   1449773_s_at
−2.0Atp6v0e2ATPase, H+ transporting, lysosomal V0 subunit E2Mm.4580981448211_at
−2.04930570C03RikRIKEN cDNA 4930570C03 geneMm.289551450410_a_at
−2.0Sorbs1Sorbin and SH3 domain containing 1Mm.2108151436737_a_at
−2.0Add3Adducin 3 (γ)Mm.4260801423298_at
−2.0HadhHydroxyacyl-Coenzyme A dehydrogenaseMm.2601641460184_at
−2.0Oprl1Opioid receptor-like 1Mm.2850751450486_a_at
−2.0Armcx3Armadillo repeat containing, X-linked 3Mm.679491460359_at
−2.0Klhl24Kelch-like 24 (Drosophila)Mm.3929141451793_at
−2.0Transcribed locusMm.2754141454967_at
−2.0Zfp810Zinc finger protein 810Mm.3060381451566_at
−2.0Pdk2Pyruvate dehydrogenase kinase, isoenzyme 2Mm.297681448825_at
−2.0Abhd14bAbhydrolase domain containing 14bMm.3354271451326_at
−2.0Mxd4Max dimerization protein 4Mm.3917771434378_a_at
−2.0Marcksl1MARCKS-like 1Mm.4249741437226_x_at
−2.0BckdhaBranched chain ketoacid dehydrogenase E1, α polypeptideMm.258481416647_at
−2.0Stk17bSerine/threonine kinase 17b (apoptosis-inducing)Mm.255591450997_at
−2.0Spag5Sperm associated antigen 5Mm.242501433893_s_at
−2.0AldocAldolase 3, C isoformMm.77291451461_a_at
−2.0Tuft1Tuftelin 1Mm.102141416689_at
−2.0Tmem9Transmembrane protein 9Mm.417731419557_a_at
−2.0Calml4Calmodulin-like 4Mm.4405761424713_at

To gather biological information about the FGF2-regulated transcriptional profile, we performed data mining on the web-based database DAVID [22] that provides functional genomic annotations according to GO.

The most over-represented GO terms, based on their statistical significance, were ‘extracellular space’ (cellular component), ‘receptor binding/growth factor activity’ (molecular function) and ‘blood vessel morphogenesis/angiogenesis’ (biological process) (Table 3). Accordingly, data mining on published research literature revealed a clear trend towards the process of new blood vessel formation (Table 4). Indeed, several FGF2-upregulated genes encode for angiogenesis-promoting extracellular factors and cytokines, including Fgf2 itself, heparin-binding EGF-like growth factor (Hb-egf), prolactin family 2, subfamily c, member 2/Proliferin (Prl2c2/Plf), slit homolog-2 (Slit2), transforming growth factor-b1 (Tgfb1) and Tgfa, ephrin-B2 (EfnB2), Drm/gremlin-1, Ccl2, C×3cl1, C×cl16, platelet-derived growth factor-b (Pdgf-b), IL-6 and connective tissue growth factor (Ctgf). Angiogenesis-related genes were also found in the categories of membrane receptors [anthrax toxin receptor-2 (Antxr2), calcitonin receptor-like receptor (Calcrl), integrinα5 (Itg5), endothelial differentiation sphingolipid G-protein-coupled receptor-1 (Edg1), lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1), prostaglandin E receptor 4 (Ptger4), urokinase-type plasminogen activator receptor (Plaur), coagulation factor III (F3)], transcriptional regulators [(early growth response 1 (Egr1), runt-related transcription factor (Runx) 1 and 2, ankyrin repeat domain 1 (Ankrd1)], cell adhesion molecules [CD44 antigen], proteases and their inhibitors [matrix metallopeptidase 13 (Mmp13), serpine1, serpinb2, tissue inhibitor of metalloproteinase 1 (Timp1)] (Table 4).

Table 3.  Over-represented GO terms for FGF2-upregulated genes in murine microvascular 1G11 cells
GO term Number of genes % Statistical significance
  1. FGF2-upregulated genes (see Table 2 for the detailed list of these genes) were classified in terms of their associated GO molecular functions, cellular components and biological processes. The most over-represented GO terms, the number and percentage of genes belonging to each category, and the statistical significance are shown.

Molecular function
Receptor binding 3412.11.0E-07
Growth factor activity 186.41.1E-07
Cytokine activity 196.82.5E-06
Cellular component
Extracellular space 6924.62.5E-04
Extracellular region 7125.45.8E-04
Basolateral plasma membrane 62.16.0E-03
Extracellular matrix 103.65.2E-02
Biological process
Blood vessel morphogenesis 196.82.2E-09
Angiogenesis 165.74.5E-08
Ossification 134.62.0E-07
Bone mineralization 82.93.8E-05
Regulation of bone remodelling 72.52.7E-05
Inflammatory response 124.34.4E-04
Table 4.  FGF2-upregulated genes in murine microvascular 1G11 endothelial cells related to angiogenesis, bone formation, and inflammation
Growth factors, cytokines and chemokines Symbol Biological Process Fold change
Chemokine (C-C motif) ligand 7 Ccl7I3.1
Chemokine (C-X3-C motif) ligand 1 Cx3cl1A/I2.0
Chemokine (C-X-C motif) ligand 1 Cxcl1A/I2.0
Chemokine (C-X-C motif) ligand 16 Cxcl16A/I2.0
Connective tissue growth factor CtgfA/B2.3
Ephrin B2 Efnb2A/B2.1
Fibroblast growth factor 2 Fgf2A/B/I2.3
Gremlin 1 Grem1A3.1
Heparin-binding EGF-like growth factor HbegfA8.4
Interleukin 6 Il6A/B/I3.8
Leukemia inhibitory factor LifB/I2.3
Platelet-derived growth factor, B polypeptide PdgfbA3.2
Prolactin family 2, subfamily c, member 2/Proliferin Prl2c2/PflA13.5
Secreted phosphoprotein 1/osteopontin Spp1/OpnA/B/I12.2
Slit homolog 2 (Drosophila) Slit2A/I3.0
Thrombospondin 1 Thbs1A/B/I2.7
Transforming growth factorαTgfaA2.2
Transforming growth factor, β1 Tgfb1A/B/I2.2
Tumor necrosis factor, α-induced protein 2 Tnfaip2A2.3
Membrane receptors and adhesion molecules Symbol Biological Process Fold change
Anthrax toxin receptor 2 Antxr2A2.7
Calcitonin receptor-like CalcrlA/B2.3
CD44 antigen Cd44A/I6.1
Coagulation factor III F3/TfA/I2.9
Endothelial differentiation sphingolipid G-protein-coupled receptor 1 Edg1A4.1
Integrin α5 (fibronectin receptor α) Itga5A2.0
Interleukin 1 receptor accessory protein Il1rapI2.3
Junction adhesion molecule 2 Jam2I2.3
Lymphatic vessel endothelial hyaluronan receptor 1 Lyve1A2.4
Oncostatin M receptor OsmrA/B/I2.2
Plasminogen activator, urokinase receptor PlaurA/B/I3.2
Prostaglandin E receptor 4 (subtype EP4) Ptger4A/B/I4.9
Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12aA/B/I2.9
Vascular cell adhesion molecule 1 Vcam1I3.1
Transcriptional regulators Symbol Biological Process Fold change
Early growth response 1 Egr1A3.4
Early growth response 2 Egr2B5.6
Runt-related transcription factor 1 Runx1A/B2.8
Runt-related transcription factor 2 Runx2A/B2.1
Ankyrin repeat domain 1 (cardiac muscle) Ankrd1A3.6
Others Symbol Biological Process Fold change
  1. Selected FGF2-upregulated genes (fold change > 2, P < 0.05, see Table 2) were classified in terms of their association with angiogenesis (A), bone formation (B) and inflammation (I) processes, according to the GO database and bibliographic searching.

Matrix Gla protein MgpB4.1
Matrix metallopeptidase 13 Mmp13A/B22.1
Prostaglandin-endoperoxide synthase 2 Ptgs2/Cox-2A/B/I18.5
Serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1A/I3.0
Serine (or cysteine) peptidase inhibitor, clade B, member 2 Serpinb2A5.6
Tissue inhibitor of metalloproteinase 1 Timp1A/I2.5

A second enriched biological category within the FGF2-modulated gene list was related to the bone formation process (GO terms ‘ossification’, ‘bone mineralization’, ‘regulation of bone remodelling’) (Table 3), a process in which FGF2 has been shown to play a relevant role [27, 28]. Genes of this functional cluster include master regulators of osteoblast development and function as Tgfb1 and the transcriptional factor Runx2. Other genes related to bone remodelling were the prostaglandin receptor Ptger4, the transcriptional factor Egr2, the protease Mmp13 and downstream TGFb1/Run×2 target genes like the bone matrix components Opn and Mgp (Table 4).

Interestingly, a third prominent group of FGF2-induced genes was related to the inflammatory response (Table 3). As shown in Table 4, FGF2 up-regulates the expression of a number of chemokines involved in the recruitment of different inflammatory cells such as monocytes/macrophages (Ccl2, Ccl7, C×3cl1, Opn), neutrophils (C×cl1), NK cells (C×3cl1) and T lymphocytes (C×cl16, C×3cl1). Also, FGF2-induced genes include inflammatory cytokines [IL-6, leukaemia inhibitory factor (Lif), Opn] and cytokine receptors [oncostatin M receptor (Osmr), tumour necrosis factor receptor superfamily member 12a (Tnfrsf12a)/Tweak-receptor, interleukin 1 receptor accessory protein (IL1rap)], cell adhesion molecules related to leucocyte recruitment and transendothelial migration [vascular cell adhesion molecule 1 (Vcam1), junctional adhesion molecule 2 (JAM2)], as well as key inflammatory mediators like the cyclooxygenase Ptgs2/Co×-2 and the prostaglandin E2 receptor Ptger4.

It must be pointed out that, given the tight interplay among angiogenesis, bone formation and inflammation, the role exerted by various genes mentioned above (e.g. Opn) is not limited to a single biological process (Table 4).

Real-time PCR analysis of FGF2 up-regulated genes

The qRT-PCR was used to confirm the up-regulation of a number of selected inflammation-related genes (IL-6, Ccl2, Ccl7, C×3cl1, C×cl1, C×cl16, Egr1, Jam2, Ptgs2/ Co×-2, Vcam1) in FGF2-treated endothelial 1G11 cells. Time-course analysis demonstrated the up-regulation of all the genes examined (Fig. 1), showing an early up-regulation for most of them (1 hr after treatment), thus indicating that the induction of a pro-inflammatory signature represents an early event in FGF2-driven endothelial cell activation. Also, dose–response experiments showed that the selected genes Ccl2, Ccl7 and Ptgs2/Co×-2 were all significantly up-regulated in 1G11 cells when tested at FGF2 concentrations ranging from 1.0 to 30 ng/ml. Moreover, qRT-PCR analysis confirmed the up-regulation of the inflammation-related genes Ccl2, Ccl7, C×3cl1 and Ptgs2/Co×-2 in FGF2-stimulated murine brain microvascular endothelial 10027 cells [29], supporting the notion that the induction of a pro-inflammatory signature represents a general feature of the FGF2-mediated response in endothelium.

image

Figure 1. qRT-PCR time course analysis of selected inflammation-related genes in FGF2-stimulated endothelial cells. Serum starved 1G11 endothelial cells were stimulated with 30 ng/ml of FGF2 for 0, 1, 2, 4, 8, 12 and 24 hrs. Total RNA from each time-point was reverse transcribed to cDNA and analysed by qRT-PCR. Data (mean values ± SD, n= 3) represent the expression ratio of each target gene relative to the untreated control. Expression levels were normalized to β-actin gene.

Download figure to PowerPoint

FGF2 induces inflammatory cell recruitment in the areas of neovascularization

The above results led us to investigate the presence of FGF2-triggered inflammatory cues in two different in vivo models of angiogenesis, the chick embryo CAM assay and the murine Matrigel plug assay.

As shown in Fig. 2, an alginate pellet containing FGF2 triggered a potent angiogenic response when applied on the top of the chick embryo CAM. May Grünwald-Giemsa staining of the FGF2-treated CAMs revealed the presence of an inflammatory cell infiltrate in the stroma among the newly formed blood vessels (Fig. 2). However, the lack of specific antibodies and the early stage of development of the chick embryos did not allow a characterization of the inflammatory cells infiltrating the CAM. Next, the anti-inflammatory drugs hydrocortisone and ketoprofen were used to assess the overall impact of the inflammatory response on FGF2-induced angiogenesis in the CAM assay. As shown in Fig. 2, both drugs were able to inhibit the angiogenic response triggered by FGF2, thus implicating inflammatory cells/mediators in FGF2-dependent neovascularization.

image

Figure 2. FGF2 induces angiogenic and inflammatory responses in the chick embryo CAM assay. (A) Alginate beads containing vehicle (PBS) or 150 ng of FGF2 (FGF2) were implanted on top of chick embryo CAMs at day 11 of development. After 3 days, CAMs were assessed for new vessel formation (upper panels) using a stereomicroscope (original magnification, ×5) and for inflammatory cell infiltration (lower panels) by May Grünwald-Giemsa staining of paraffin-embedded sections (original magnification, ×40). Note the strong presence of inflammatory cells (arrowheads) in the areas of FGF2-induced neovascularization, as shown in the enlarged lower right panel. Alginate implant (AI, dotted line), vessels (v). (B) Alginate implants containing vehicle or 150 ng of FGF2 were assessed for their angiogenic capacity in the absence or presence of 50 μg of hydrocortisone or 50 μg of ketoprofen. Data (7–10 eggs per group) represent the number of vessels converging towards the alginate implant and are expressed as mean ± SD. *, statistically different from the ‘FGF2 plus vehicle’ group, P < 0.05.

Download figure to PowerPoint

In a second set of experiments, FGF2-embedded Matrigel plugs were implanted subcutaneously in mice and examined hystologically at day 7 after implantation (Fig. 3). Haematoxylin/eosin staining revealed the presence of numerous blood vessels and of an abundant cellular infiltrate in FGF2-embedded pellets when compared to PBS-embedded control implants. Immunofluorescence analysis confirmed the presence of a potent neovascular response in FGF2-embedded plugs, as shown by the presence of numerous CD31+ endothelial cells, which was accompanied by a consistent CD45+ leucocyte infiltrate. The characterization of the leucocyte subsets revealed that the inflammatory cell infiltrate consists mainly of CD11b+ monocytes and F4/80+ macrophages. Only rare Gr-1+ neutrophils and CD8+ or CD4+ T-lymphocytes and no CD19+ B-lymphocytes, NK1.1+ natural killer or CD11c+ dendritic cells were instead detectable (Fig. 3 and Table 5). A time-course analysis of the cellular populations infiltrating the FGF2-embedded Matrigel plugs revealed that monocytes/macrophages are already detectable within the plug at day 2 after implantation whereas a significant CD31+ neovascular response becomes evident on day 4 (data not shown). Thus, macrophage recruitment precedes neovascularization in FGF2-driven angiogenesis.

image

Figure 3. Inflammatory cells infiltrate the areas of FGF2-induced neovascularization in Matrigel plugs. Matrigel pellets containing PBS or 150 ng of FGF2 were implanted subcutaneously in mice and examined at day 7 by haematoxylin and eosin staining and immunofluorescence analysis with antibodies specific to the indicated antigens. Note the presence in the implanted FGF2-Matrigel plugs of numerous CD31+ endothelial cells and of CD45+ infiltrating leucocytes, mainly consisting of CD11b+ monocytes and F4/80+ macrophages. Only scarce Gr-1+ neutrophils, CD8+ and CD4+ T-lymphocytes and no CD19+ B-lymphocytes, NK1.1+ natural killer or CD11c+ dendritic cells are instead detectable. Nuclei are shown by DAPI counterstaining. Original magnification: a–j, ×200; k–o, ×100.

Download figure to PowerPoint

Table 5.  Immunoistochemical characterization of the inflammatory infiltrate in FGF2-Matrigel plugs
Treatment CD31+ CD45+ CD11b+ F4/80+ GR-1+ CD4+ CD8+
  1. Eight μm frozen sections of Matrigel plugs containing PBS or FGF2 (five plugs per group) were immunostained for the indicated antigens. Then, the corresponding immunoreactive areas were analysed in five microscopic fields per Matrigel section (two sections per Matrigel plug) using the ImagePro Plus software. Analysis was performed on plugs on day 7 after implantation. Data (mean ± SD) are expressed as μm2 of immunoreactive area per microscopic field (0.38 mm2).

PBS 1074 ± 7487682 ± 32207002 ± 6012316 ± 18661 ± 6300
FGF2 12,228 ± 202437,467 ± 590013,469 ± 237217,401 ± 718782 ± 115154 ± 169654 ± 834

Impairment of macrophage recruitment reduces FGF2-induced angiogenesis

The above observations support the notion that inflammatory cells are relevant to FGF2-dependent neovascularization. To further investigate this hypothesis, we evaluated the capacity of FGF2 to trigger an angiogenic response in the Matrigel plug assay under conditions that impair the recruitment of inflammatory cells.

Proper migration of leucocytes to chemotactic agonists in inflammatory sites is dependent on PI3Kγ activity [24]. To investigate the potential role of infiltrating inflammatory cells in the modulation of FGF2-dependent angiogenesis, FGF2-embedded Matrigel plugs were implanted subcutaneously in PI3Kγ−/− mice and examined by immunostaining at day 7 after implantation. Computerized image analysis of the immunofluorescence signals demonstrated a significant reduction of the F4/80+ cell infiltrate (–60%) and, importantly, of CD31+ neovessels (–40%) in PI3Kγ−/− mice when compared to wild-type control animals (Fig. 4).

image

Figure 4. Defective macrophage recruitment impairs FGF2-induced angiogenesis. (A) Immunohistochemical analysis of FGF2-Matrigel pellets from wild-type (wt) or PI3Kγ−/− SV129 mice and from C57Bl/6 mice that underwent PBS-lips or Clodro-lips pre-treatment. Matrigel sections were double-stained with anti-CD31 (red) and anti-F4/80 (green) monoclonal antibodies. Original magnification, ×200. (B) Quantitative analysis of infiltrating CD31+ endothelial cells and F4/80+ macrophages in FGF2-Matrigel plugs on day 7 after implantation. Data (mean ± SD) represent the percentage of CD31+ (red bars) or F4/80+ (green bars) immunopositive areas of Matrigel sections from PI3Kγ−/− or Clodro-lip-treated mice relative to their respective wt and PBS-lip-treated controls. *, P < 0.05.

Download figure to PowerPoint

In a second set of experiments, FGF2-induced angiogenesis was evaluated after macrophage depletion following intraperitoneal pre-treatment with clodronate liposomes (Clodro-lip) [30]. Again, immunofluorescence analysis demonstrated a 72% reduction of the F4/80+ macrophage infiltrate and a 40% decrease of the CD31+ areas of neovascularization in FGF2-embedded Matrigel plugs implanted in Clodro-lip-treated animals when compared to control animals injected with PBS-containing liposomes (PBS-lip) (Fig. 4). Taken together, these results point to a role for pro-inflammatory macrophages in FGF2-induced angiogenesis in vivo.

The conditioned medium from FGF2-stimulated microvascular cells is chemotactic for monocytes and promotes chemokine-dependent angiogenesis in vivo

Gene expression data indicate that FGF2 up-regulates the production of various chemokines that may serve to recruit monocytes in the neovascularized areas. To test this hypothesis, we evaluated the ability of the CM from FGF2-stimulated microvascular 1G11 cells to induce monocyte chemotaxis in vitro. To avoid the possibility that exogenously added FGF2 may interfere with the biological activity of the CM from FGF2-treated cells, 1G11 cells were seeded on FGF2 immobilized to plastic dishes where it retains a full biological activity [31]. Following a 24-hr stimulation, cells extracts and CM were analysed for gene expression and monocyte chemotactic activity, respectively. The concentration of human FGF2 in the CM was typically lower than 1.0 ng/ml, as assessed by ELISA. As controls, 1G11 cells cultured for 24 hrs on non-coated dishes or stimulated with soluble FGF2 (30 ng/ml) were analysed in parallel. As shown in Fig. 5, both immobilized and free FGF2 induced the up-regulation of selected chemotactic factors, thus confirming the ability of substratum-bound FGF2 to activate endothelial cells.

image

Figure 5. qRT-PCR analysis of selected chemokines in endothelial cells stimulated by immobilized or soluble FGF2. Microvascular 1G11 cells were incubated for 24 hrs on FGF2-coated dishes (immobilized FGF2) or stimulated for 24 hrs with 30 ng/ml of FGF2 (soluble FGF2) onto non-coated dishes. Total RNA was reverse transcribed to cDNA and analysed by real-time PCR. Data are presented as the expression ratio of each target gene relative to an untreated control. Expression levels were normalized to β-actin gene. The bars show mean values ± SD (n= 3).

Download figure to PowerPoint

On this basis, the CM from control and FGF2-stimulated 1G11 cells were tested in a Boyden chamber assay for the capacity to induce a chemotactic response in freshly isolated human monocytes (Fig. 6A). The CM from FGF2-stimulated 1G11 cells exerted a dose-dependent chemotactic response whereas the CM from control cells was ineffective. Importantly, the chemotactic response was inhibited in a dose-dependent manner when the CM from FGF2-stimulated 1G11 cells was pre-incubated with the pan-chemokine inhibitor M3 (Fig. 6B), a murine gammaherpesvirus 68 protein antagonist for human and mouse CC, CXC and CX3C chemokines [19]. At variance, M3 did not affect the capacity of FGF2 to trigger in vitro endothelial cell proliferation and sprouting (data not shown). Taken together, these observations indicate that FGF2-activated endothelium expresses and secretes biologically active chemokine(s) that represent a chemotactic stimulus for human monocytes.

image

Figure 6. The conditioned medium (CM) from FGF2-stimulated microvascular endothelial cells is chemotactic to monocytes. (A) The migration of human monocytes towards different dilutions of the CM from non-stimulated (Control_CM) and FGF2-stimulated (FGF2_CM) 1G11 endothelial cells was quantified as described in ‘Materials and methods’. Data are expressed as the mean number of migrated cells per field. (B) Inhibition of the chemotactic response of 1G11 endothelial cells towards FGF2-CM by different concentrations of the pan-chemokine inhibitor M3. Chemotaxis was tested at the dose of FGF2_CM that induced the maximal chemotactic responses (1/300 dilution) and compared to the equivalent dilution of Control_CM. Data are expressed as the number of migrated cells per field.

Download figure to PowerPoint

Next, the CM from FGF2-stimulated microvascular 1G11 cells was investigated for the capacity to induce neovascularization in vivo in the chick embryo CAM assay. As shown in Fig. 7A, the CM from FGF2-stimulated endothelial cells exerted a potent angiogenic response that was significantly reduced in the presence of the pan-chemokine inhibitor M3. Accordingly, the intense cellular infiltrate observed in the areas of neovascularization induced by the CM from FGF2-stimulated cells was almost abolished in the presence of M3 (Fig. 7B). In keeping with these observations, the pan-chemokine inhibitor M3 induced a significant inhibitory effect on neovascularization induced by recombinant FGF2, without affecting the basal levels of vascularization of the CAM (Fig. 8). Taken together, these findings demonstrate a relevant role for pro-inflammatory chemokines in FGF2-driven angiogenesis.

image

Figure 7. The conditioned medium (CM) from FGF2-stimulated microvascular endothelial cells promotes chemokine-dependent angiogenesis in vivo. (A) Chick embryo CAM assay was performed with the CM from non-stimulated (Control_CM) and FGF2-stimulated (FGF2_CM) 1G11 endothelial cells in the absence or presence of 75 ng of the pan-chemokine inhibitor M3. Data are expressed as the mean ± SD of the number of vessels invading the alginate area (*, statistically different from the ‘FGF2_CM’ group, P < 0.05). (B) Representative histological sections of CAMs from the different experimental groups (May Grünwald-Giemsa staining). Note that FGF2_CM induces neovascularization and a strong inflammatory cell infiltrate within the alginate implant (AI, dotted line), both greatly reduced in the presence of M3.

Download figure to PowerPoint

image

Figure 8. Pan-chemokine inhibitor M3 impairs FGF2-induced angiogenesis. CAMs were implanted at day 11 of development with alginate beads containing vehicle (PBS), 150 ng of FGF2, 75 ng of M3 or 150 ng of FGF2 added with 75 ng of M3. After 3 days, CAMs were photographed (A, original magnification ×5) and angiogenesis was quantified by counting the number of microvessels (mean ± SD) invading the alginate area (B). Note the significant reduction (*, P < 0.05) in the number of newly-formed microvessels converging towards the FGF2 implant in the presence of the M3 inhibitor.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Scattered experimental evidence pointed to a role for inflammatory mediators and leucocytes in mediating the neovascularization process triggered by the angiogenic growth factor FGF2 [10, 13, 15–17, 32]. In the present study, transcriptome analysis demonstrates that FGF2 activates a complex pro-inflammatory signature in murine microvascular endothelial cells. Accordingly, we provide evidence that FGF2-induced chemokines and infiltrating monocytes/macrophages are non-redundant mediators of the neovascularization process elicited by the growth factor. Indeed, FGF2-triggered angiogenesis is significantly reduced in the CAM assay by mechanistically distinct steroidal (hydrocortisone) and non-steroidal (ketoprofen) anti-inflammatory drugs and by the pan-chemokine inhibitor M3. Also, FGF2 elicits a decreased angiogenic response in PI3Kγ−/− mice exhibiting defective leucocyte migration and in clodronate-pre-treated, macrophage-depleted animals.

Monocytes/macrophages are active players in pathological angiogenesis [33–35]. They often precede, temporally and spatially, new vessel formation by altering the microenvironment, thus promoting vascular sprouting [36] and the recruitment of endothelial cell precursors [32]. Accordingly, we have observed that the early recruitment of mononuclear phagocytes (within 2–3 days after implantation) precedes blood vessel formation in FGF2-driven angiogenesis in the Matrigel plug assay. The depletion of monocytes/macrophages reduces also neovascularization driven by VEGF [37], placental growth factor (PIGF) [38] and IL-1β[39]. Thus, mononuclear phagocytes play a pivotal role in the angiogenesis process driven by various angiogenic growth factors, including FGF2.

Our observations indicate that FGF2-driven angiogenesis is, at least in part, chemokine-dependent. Chemotactic factors produced by FGF2-stimulated endothelium may recruit mononuclear phagocytes that, in turn, will amplify the angiogenic response by releasing monocyte-derived pro-angiogenic cytokines. Also, FGF2-induced chemoattractants may play a direct role in neovascularization by interacting with specific chemokine receptors expressed on endothelial cells [7]. Among them, the FGF2-induced chemokines Ccl2, C×cl1, C×cl16 and C×c3l1 could act as enhancers of the neovascularization process elicited by the growth factor.

The capacity of the pan-chemokine inhibitor M3 [19] to inhibit angiogenesis triggered by FGF2 or by the CM from FGF2-stimulated endothelial cells is of interest. This gammaherpesvirus 68-derived protein prevents chemokine-mediated signal transduction and leucocyte recruitment induced by a number of chemokines and may have therapeutic potential in inflammatory conditions [40]. Our findings suggest that M3 protein may represent the basis for the design of novel angiogenesis inhibitors with therapeutic implications in angiogenesis-dependent pathological conditions, including tumour growth and metastasis.

Taken together, our findings support the notion that monocytes/macrophages and inflammation-related gene products actively participate in the angiogenic process elicited by FGF2 as part of a complex cascade of cellular and molecular events triggered by the growth factor on microvascular endothelium. Indeed, FGF2 up-regulates also the expression of a variety of angiogenic growth factors in endothelial cells, including FGF2 itself (Table 4). This suggests that FGF2 is able to activate an autocrine loop of amplification of the angiogenic response that, together with the paracrine activity exerted by endothelium-derived cytokines/chemokines on inflammatory cells, will contribute to the modulation of the neovascularization process triggered by the growth factor.

Like FGF2, also VEGF is known to up-regulate the expression of pro-inflammatory mediators in endothelial cells [41–43]. In our experiments, the induction of inflammation-related genes by FGF2 represents an early event, most of these genes being up-regulated 1 hr after treatment (see Fig. 1). This precedes the limited increase of VEGF expression induced by FGF2 in 1G11 cells that reaches a maximal twofold up-regulation at 24 hrs after stimulation (data not shown). This observation appears to rule out the possibility that the pro-inflammatory signature triggered by FGF2 in endothelial cells may represent an indirect, VEGF-mediated effect. On the other hand, in parallel with a significant monocyte/macrophage infiltrate, we have observed a sixfold increase of VEGF mRNA levels in FGF2-Matrigel plugs when compared to control implants (data not shown). Further experiments are required to fully dissect the complex cross-talk between FGF2 and VEGF during angiogenesis (reviewed in [13]).

FGF2 expression is augmented at sites of chronic inflammation, tissue injury and in human cancer [13]. Our observations suggest that FGF2 released after tissue damage may contribute to the host defence responses by activating pro-angiogenic and pro-inflammatory signatures in endothelium that, by acting in concert, will lead to neovessel formation and monocyte/macrophage engagement. Accordingly, Fgf2-null mice exhibit delayed wound repair [44] and neutralizing anti-FGF2 antibodies inhibit angiogenesis and formation of granulation tissue in a rat model of wound healing [45]. Conversely, local application of FGF2 effectively improves wound repair [46], the healing process being accompanied by mononuclear cell infiltrate recruitment [47]. On the other hand, long-term stimulation by FGF2 inhibits monocyte/macrophages adhesion to endothelium and the chemotactic response to various chemokines [48], suggesting that the pro- or anti-inflammatory activity of FGF2 may be contextual (discussed in [13]).

In conclusion, our findings point to inflammatory chemokines as important early mediators of FGF2-driven angiogenesis and indicate a relevant role for inflammatory cells in the neovascularization process elicited by the growth factor. Conversely, FGF2 may exert important functions at sites of inflammation and/or tissue injury not only by inducing neovascularization but also by contributing to the activation of innate immune responses.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported by grants from Istituto Superiore di Sanità (Oncotechnological Program), Ministero dell’Istruzione, Università e Ricerca (Centro di Eccellenza per l’Innovazione Diagnostica e Terapeutica, Cofin projects), Associazione Italiana Ricerca sul Cancro, Fondazione Berlucchi, NOBEL Project Cariplo, and Integrated European Commission Project STROMA to M.P. G.A. was supported by a Marie Curie Fellowship from the European Community Quality of Life Programme. A.A. was funded by the Wellcome Trust.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • 1
    Jackson JR, Seed MP, Kircher CH, et al. The codependence of angiogenesis and chronic inflammation. FASEB J. 1997; 11: 45765.
  • 2
    Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature. 2000; 407: 24957.
  • 3
    Zijlstra A, Seandel M, Kupriyanova TA, et al. Proangiogenic role of neutrophil-like inflammatory heterophils during neovascularization induced by growth factors and human tumor cells. Blood. 2006; 107: 31727.
  • 4
    Pober JS, Sessa WC. Evolving functions of endothelial cells in inflammation. Nat Rev Immunol. 2007; 7: 80315.
  • 5
    Danese S, Dejana E, Fiocchi C. Immune regulation by microvascular endothelial cells: directing innate and adaptive immunity, coagulation, and inflammation. J Immunol. 2007; 178: 601722.
  • 6
    Williams CS, Mann M, DuBois RN. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene. 1999; 18: 790816.
  • 7
    Romagnani P, Lasagni L, Annunziato F, et al. CXC chemokines: the regulatory link between inflammation and angiogenesis. Trends Immunol. 2004; 25: 2019.
  • 8
    Voronov E, Shouval DS, Krelin Y, et al. IL-1 is required for tumor invasiveness and angiogenesis. Proc Natl Acad Sci USA. 2003; 100: 264550.
  • 9
    Naldini A, Leali D, Pucci A, et al. Cutting edge: IL-1beta mediates the proangiogenic activity of osteopontin-activated human monocytes. J Immunol. 2006; 177: 426770.
  • 10
    Leali D, Dell’Era P, Stabile H, et al. Osteopontin (Eta-1) and fibroblast growth factor-2 cross-talk in angiogenesis. J Immunol. 2003; 171: 108593.
  • 11
    Aplin AC, Gelati M, Fogel E, et al. Angiopoietin-1 and vascular endothelial growth factor induce expression of inflammatory cytokines before angiogenesis. Physiol Genomics. 2006; 27: 208.
  • 12
    Angelo LS, Kurzrock R. Vascular endothelial growth factor and its relationship to inflammatory mediators. Clin Cancer Res. 2007; 13: 282530.
  • 13
    Presta M, Dell’Era P, Mitola S, et al. Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis. Cytokine Growth Factor Rev. 2005; 16: 15978.
  • 14
    Cross MJ, Claesson-Welsh L. FGF and VEGF function in angiogenesis: signalling pathways, biological responses and therapeutic inhibition. Trends Pharmacol Sci. 2001; 22: 2017.
  • 15
    Zittermann SI, Issekutz AC. Basic fibroblast growth factor (bFGF, FGF-2) potentiates leukocyte recruitment to inflammation by enhancing endothelial adhesion molecule expression. Am J Pathol. 2006; 168: 83546.
  • 16
    Wempe F, Lindner V, Augustin HG. Basic fibroblast growth factor (bFGF) regulates the expression of the CC chemokine monocyte chemoattractant protein-1 (MCP-1) in autocrine-activated endothelial cells. Arterioscler Thromb Vasc Biol. 1997; 17: 24718.
  • 17
    Kage K, Fujita N, Oh-hara T, et al. Basic fibroblast growth factor induces cyclooxygenase-2 expression in endothelial cells derived from bone. Biochem Biophys Res Commun. 1999; 254: 25963.
  • 18
    Gualandris A, Urbinati C, Rusnati M, et al. Interaction of high-molecular-weight basic fibroblast growth factor with endothelium: biological activity and intracellular fate of human recombinant M(r) 24,000 bFGF. J Cell Physiol. 1994; 161: 14959.
  • 19
    Parry CM, Simas JP, Smith VP, et al. A broad spectrum secreted chemokine binding protein encoded by a herpesvirus. J Exp Med. 2000; 191: 5738.
  • 20
    Dong QG, Bernasconi S, Lostaglio S, et al. A general strategy for isolation of endothelial cells from murine tissues. Characterization of two endothelial cell lines from the murine lung and subcutaneous sponge implants. Arterioscler Thromb Vasc Biol. 1997; 17: 1599604.
  • 21
    Irizarry RA, Bolstad BM, Collin F, et al. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 2003; 31: e15.
  • 22
    Dennis G Jr, Sherman BT, Hosack DA, et al. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 2003; 4: P3.
  • 23
    Rusnati M, Tanghetti E, Dell’Era P, et al. alphavbeta3 integrin mediates the cell-adhesive capacity and biological activity of basic fibroblast growth factor (FGF-2) in cultured endothelial cells. Mol Biol Cell. 1997; 8: 244961.
  • 24
    Hirsch E, Katanaev VL, Garlanda C, et al. Central role for G protein-coupled phosphoinositide 3-kinase gamma in inflammation. Science. 2000; 287: 104953.
  • 25
    Zeisberger SM, Odermatt B, Marty C, et al. Clodronate-liposome-mediated depletion of tumour-associated macrophages: a new and highly effective antiangiogenic therapy approach. Br J Cancer. 2006; 95: 27281.
  • 26
    Knoll A, Schmidt S, Chapman M, et al. A comparison of two controlled-release delivery systems for the delivery of amiloride to control angiogenesis. Microvasc Res. 1999; 58: 19.
  • 27
    Montero A, Okada Y, Tomita M, et al. Disruption of the fibroblast growth factor-2 gene results in decreased bone mass and bone formation. J Clin Invest. 2000; 105: 108593.
  • 28
    Naganawa T, Xiao L, Abogunde E, et al. In vivo and in vitro comparison of the effects of FGF-2 null and haplo-insufficiency on bone formation in mice. Biochem Biophys Res Commun. 2006; 339: 4908.
  • 29
    Bastaki M, Nelli EE, Dell’Era P, et al. Basic fibroblast growth factor-induced angiogenic phenotype in mouse endothelium. A study of aortic and microvascular endothelial cell lines. Arterioscler Thromb Vasc Biol. 1997; 17: 45464.
  • 30
    Van Rooijen N, Sanders A. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Methods. 1994; 174: 8393.
  • 31
    Tanghetti E, Ria R, Dell’Era P, et al. Biological activity of substrate-bound basic fibroblast growth factor (FGF2):s recruitment of FGF receptor-1 in endothelial cell adhesion contacts. Oncogene. 2002; 21: 388997.
  • 32
    Anghelina M, Krishnan P, Moldovan L, et al. Monocytes/macrophages cooperate with progenitor cells during neovascularization and tissue repair: conversion of cell columns into fibrovascular bundles. Am J Pathol. 2006; 168: 52941.
  • 33
    Dirkx AE, Oude Egbrink MG, Wagstaff J, et al. Monocyte/macrophage infiltration in tumors: modulators of angiogenesis. J Leukoc Biol. 2006; 80: 118396.
  • 34
    Sunderkotter C, Steinbrink K, Goebeler M, et al. Macrophages and angiogenesis. J Leukoc Biol. 1994; 55: 41022.
  • 35
    Rehman J, Li J, Orschell CM, et al. Peripheral blood “endothelial progenitor cells” are derived from monocyte/ macrophages and secrete angiogenic growth factors. Circulation. 2003; 107: 11649.
  • 36
    Moldovan NI, Goldschmidt-Clermont PJ, Parker-Thornburg J, et al. Contribution of monocytes/macrophages to compensatory neovascularization: the drilling of metalloelastase-positive tunnels in ischemic myocardium. Circ Res. 2000; 87: 37884.
  • 37
    Cursiefen C, Chen L, Borges LP, et al. VEGF-A stimulates lymphangiogenesis and hemangiogenesis in inflammatory neovascularization via macrophage recruitment. J Clin Invest. 2004; 113: 104050.
  • 38
    Pipp F, Heil M, Issbrucker K, et al. VEGFR-1-selective VEGF homologue PlGF is arteriogenic: evidence for a monocyte-mediated mechanism. Circ Res. 2003; 92: 37885.
  • 39
    Nakao S, Kuwano T, Tsutsumi-Miyahara C, et al. Infiltration of COX-2-expressing macrophages is a prerequisite for IL-1 beta-induced neovascularization and tumor growth. J Clin Invest. 2005; 115: 297991.
  • 40
    Fallon PG, Alcami A. Pathogen-derived immunomodulatory molecules: future immunotherapeutics Trends Immunol. 2006; 27: 4706.
  • 41
    Reinders ME, Sho M, Izawa A, et al. Proinflammatory functions of vascular endothelial growth factor in alloimmunity. J Clin Invest. 2003; 112: 165565.
  • 42
    Kim I, Moon SO, Kim SH, et al. Vascular endothelial growth factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E-selectin through nuclear factor-kappa B activation in endothelial cells. J Biol Chem. 2001; 276: 761420.
  • 43
    Abe M, Sato Y. cDNA microarray analysis of the gene expression profile of VEGF-activated human umbilical vein endothelial cells. Angiogenesis. 2001; 4: 28998.
  • 44
    Ortega S, Ittmann M, Tsang SH, et al. Neuronal defects and delayed wound healing in mice lacking fibroblast growth factor 2. Proc Natl Acad Sci USA. 1998; 95: 56727.
  • 45
    Broadley KN, Aquino AM, Woodward SC, et al. Monospecific antibodies implicate basic fibroblast growth factor in normal wound repair. Lab Invest. 1989; 61: 5715.
  • 46
    Tsuboi R, Rifkin DB. Recombinant basic fibroblast growth factor stimulates wound healing in healing-impaired db/db mice. J Exp Med. 1990; 172: 24551.
  • 47
    Ribatti D, Nico B, Vacca A, et al. Endogenous and exogenous fibroblast growth factor-2 modulate wound healing in the chick embryo chorioallantoic membrane. Angiogenesis. 1999; 3: 8995.
  • 48
    Zhang H, Issekutz AC. Down-modulation of monocyte transendothelial migration and endothelial adhesion molecule expression by fibroblast growth factor: reversal by the anti-angiogenic agent SU6668. Am J Pathol. 2002; 160: 221930.