SEARCH

SEARCH BY CITATION

Introduction

  1. Top of page
  2. Introduction
  3. Telomeres and cell replication
  4. Oligonucleotides and skin photoprotection
  5. Oligonucleotides and cancer
  6. Recent work and final perspectives
  7. References

Eukaryotic cells have evolved an intricate system of responses to genotoxic stress ranging from transient cell cycle arrest, presumably to allow time for DNA repair, to cell death by apoptosis, to eliminate cells that have experienced such massive damage that repair is not possible. In addition, these DNA damage responses can also induce protective mechanisms that can ‘prime’ the cell to better tolerate future assaults. Most somatic cells also respond to advanced age and excessive proliferation by mechanisms similar to those induced by DNA damage, to either permanently remove the cell from the cell cycle (replicative senescence) or kill the cell by apoptosis. It is generally considered that these responses to proliferative ageing, largely controlled by telomeres, large tracts of repetitive DNA that cap chromosome ends (Fig. 1), protect the organism from uncontrolled cell proliferation (carcinogenesis). Unfortunately, while DNA damage responses can be used therapeutically to treat a variety of hyperproliferative disorders, ranging from psoriasis (phototherapy) to cancer (chemotherapy), actual DNA damage runs the risk of increasing mutations and eventually can increase the risk of cancer. Clearly, methods to enhance cellular protection against genotoxic stress and uncontrolled proliferation without concomitant DNA damage would be beneficial.

image

Figure 1.  Telomeres are located at the ends of chromosomes. Metaphase spreads of normal human fibroblast chromosomes were hybridized with a telomere-specific probe (red). The chromatin has been stained with DAPI (blue). Each metaphase chromosome contains two telomeres with the metaphase pairs containing four.

Download figure to PowerPoint

This article will focus on the use of small DNA oligonucleotides to induce protective and anitproliferative DNA damage responses in normal and transformed mammalian cells without actually damaging the cellular DNA and will emphasize effects in skin. Because these oligonucleotides do not cause DNA damage, we prefer to refer to these responses as ‘DNA damage-like’ responses. We will start with a review of telomere structure and function, the basic information that is necessary to understand the genesis of this work. We will then discuss the uses of these oligonucleotide-induced DNA damage-like responses in skin photoprotection and as an anti-cancer therapy. Finally, we will discuss recent findings about the mechanism of action of these oligonucleotides, the implications for normal telomere functions and areas for future studies.

Telomeres and cell replication

  1. Top of page
  2. Introduction
  3. Telomeres and cell replication
  4. Oligonucleotides and skin photoprotection
  5. Oligonucleotides and cancer
  6. Recent work and final perspectives
  7. References

Replication of normal mammalian cells is limited by a proliferative arrest called replicative senescence, suggested to be a fundamental defense against cancer (1). This state in fibroblasts is largely dependent on the p53 tumor suppressor pathway (2–6), and inactivation of this pathway can lead to escape from replicative senescence. Some evidence also suggests that the retinoblastoma protein tumor suppressor (pRb) pathway may present an additional barrier to proliferation in fibroblasts and both the p53 and pRb pathways appear to cause senescence in human epithelial cells (4,5).

Replicative senescence is controlled in large part by telomeres, tandem repeats of DNA that cap chromosome ends (7) (Fig. 1). In mammalian cells, this DNA sequence is TTAGGG (7). The 3′ end of each telomere is a single-strand G-rich overhang of TTAGGG repeats several hundred bases in length (8). Normally, telomere ends form a loop structure, with the 3′ single-strand overhang inserted into and base-paired within the DNA duplex and stabilized by association with telomere repeat binding factors (TRFs) (9). In the absence of a telomere maintenance system, telomeres shorten with each round of replication because of the inability to replicate the extreme 3′ ends of DNA and critical shortening of telomeres is associated with the onset of replicative senescence or cell death by apoptosis, depending on cell type (10,11). Although the mechanism by which telomere shortening triggers senescence or death is not clear, it is now thought that features other than simply telomere length are important (12). For example, experimental disruption of the telomere loop structure by expression of a dominant-negative TRF (TRF2DN) leads to overhang loss, chromosomal fusions and ultimately induction of DNA damage responses including senescence or apoptosis, mediated at least in part through the activation of the ATM kinase and p53 (13). Loss of TRF2 was shown to lead to the formation of DNA damage foci containing phosphorylated histone H2AX (γH2AX) and 53BP1 at the telomeres, possibly as a response to disrupted telomere structure (14).

Localized telomeric DNA damage responses may function other than to signal senescence or apoptosis in response to critical telomere shortening or irreparable change of telomere structure. Recently, Verdun et al. (15,16) detected the recruitment of DNA damage response proteins to ‘unprotected’ telomeres during the late S and G2 phases of the cell cycle in normal human fibroblasts and found that inhibition of this process lead to persistent exposure of telomere ends as DNA breaks. The authors conclude that recruitment of these DNA damage response proteins to the telomeres restores proper telomere structure and function after DNA replication.

Therefore, telomeres have the ability to induce a variety of DNA damage responses which undoubtedly serve a variety of functions. The work described below demonstrates the induction of these responses and therefore a way to manipulate cell and tissue physiology without actually disrupting the endogenous telomeres or incurring real damage to the DNA, by use of small G-rich DNA oligonuleotides homologous to the telomere sequence.

Oligonucleotides and skin photoprotection

  1. Top of page
  2. Introduction
  3. Telomeres and cell replication
  4. Oligonucleotides and skin photoprotection
  5. Oligonucleotides and cancer
  6. Recent work and final perspectives
  7. References

Human skin is protected from UV-induced damage by the pigment melanin. Synthesis of melanin in skin occurs de-novo in melanocytes by the action of the enzymes tyrosinase and the tyrosinase-related proteins-1 and 2 (TRP-1 and TRP-2) (17). The activity of these enzymes in melanocytes is in direct proportion with the level of melanin produced (18,19). The process of melanin synthesis is also affected by a variety of stimuli including ultraviolet radiation (UVR) and paracrine effects from factors such as MSH, ACTH and ET-1 from adjacent cells (20). UV-induced melanogenesis (tanning) is perhaps the most clinically important and well-known mode of enhancement of melanogenesis in human skin. Evidence suggests that DNA damage from UVR is a stimulus for pigmentation and the enhancement of melanogenesis by DNA damaging chemicals such as MMS and 4NQO (21), and the similarity of UVR action spectrum for tanning and for the formation of UVR-induced DNA photoproducts (22,23) support this hypothesis. Also, increased tanning of cells in vitro after exposure to UVR by increasing the repair of UVR-induced thymine dimers strongly suggests that DNA damage and/or its repair stimulates melanogenesis (24). Furthermore, the DNA damage-responsive transcription factor p53 regulates the expression of tyrosinase mRNA and pigmentation (25–28), as will be discussed later. In order to study the role of DNA damage on melanogenesis, we originally focused on thymidine dinucleotides, pTT, the precursor of the most prominent UVR-induced photoproduct, thymine dimers (29), to study whether this DNA alone would induce pigmentation. Treatment of melanogenic cells and intact guinea-pig skin with pTT, but not the homologous sequence pAA, produced a striking increase in melanin, clinically and histologically similar to that seen after UV irradiation (30). It was later demonstrated that this pTT-induced tan was highly photoprotective (31). The effect of pTT on melanogenesis was also confirmed by Pedeux et al. (32). The photoprotective qualities of pTT treatment are not limited to melanogenesis; further work demonstrated that pTT increased the level of DNA repair activity (33,34) and DNA repair proteins (35), and enhanced survival of cells in culture after UV irradiation (33). Most, if not all, of these protective responses were accomplished through induction of p53 (33–35). Furthermore, three different model systems demonstrated that pretreatment with pTT before UV irradiation reduced subsequent mutation frequency, in agreement with the demonstrated enhanced DNA repair (36–38). These studies were expanded to an ex vivo model (39) where pTT was shown to increase pigmentation, inhibit cell proliferation and speed the removal of UVR-induced cyclobutane pyrimidine dimers in human skin.

Although most of the early work described here focused on the use of the small dinucleotide pTT, it soon became evident that other, but not all, oligonucleotides could elicit similar DNA damage-like responses. Particularly, a 9-base oligonucleotide with the sequence GAGTATGAG was found to be more effective in stimulating pigmentation than pTT (40). One common feature of the melanogenic oligonucleotides compared with the inactive controls is their ability to induce the p53 transcription factor (33,34,39,40), a major effector of DNA damage responses in mammalian cells. In fact, it was subsequently shown that p53 regulates tyrosinase gene expression (25–28), likely accounting, at least in part, for the effect of these oligonucleotides on pigmentation. P53 also plays an important role in the inducible (by oligonucleotides or various forms of DNA damage) DNA repair capacity inherent in many mammalian cells (33,41).

Oligonucleotides and cancer

  1. Top of page
  2. Introduction
  3. Telomeres and cell replication
  4. Oligonucleotides and skin photoprotection
  5. Oligonucleotides and cancer
  6. Recent work and final perspectives
  7. References

Given the sequence similarity between the active oligonucleotides (particularly GAGTATGAG) and the telomere repeat sequence (TTAGGG) and the fact that telomere loop disruption exposes the TTAGGG telomere overhang and induces p53 (13), we postulated that these telomere overhang-homologous oligos may be presented to the cell as exposed telomeric DNA and trigger responses normally associated with telomere damage and/or disruption. In order to test this hypothesis, we generated oligonucleotides 100% homologous to the telomere TTAGGG sequence (GTTAGGGTTAG), and as controls used oligonucleotides complementary to this sequence (CTAACCCTAAC) or unrelated to this sequence (GATCGATCGAT) and tested the ability of these oligonucleotides to induce apoptosis in human lymphocytic (Jurkat) cells and a human melanoma cell line. The telomere overhang-homologous oligonucleotide, but not the controls, induced apoptosis in these cells (42). In general, we now refer to any telomere sequence-related oligonucleotide that induces these DNA damage-like responses as a ‘T-oligo’. Subsequently, the telomere overhang oligonucleotide was shown to induce an accumulation of cells in the S-phase of the cell cycle, similar to pTT (32,42,43), dependent on the p95/Nbs1 protein (43). Also, accumulation and activation (phosphorylation on serine 15) of p53 was demonstrated in several cell types, although neither the cell cycle arrest nor apoptosis was dependent on p53 status, at least in the cell types studied (43). Not all transformed cell types undergo apoptosis after treatment with T-oligo, however. Human fibrosarcoma cells become senescent, as demonstrated by their large, flattened morphology, expression of senescence-associated β-galactosidase activity and inability to phosphorylate pRb and resume DNA synthesis after serum stimulation (44).

Also, the activities of T-oligos on cell growth and apoptosis appear to be independent of the expression of telomerase in that both telomerase-negative U2OS cells, maintaining telomeres by the ALT mechanism (45), and normal human fibroblasts and telomerase positive MM-AN cells (46) are affected. Furthermore, although telomerase inhibition is an attractive and promising cancer therapy [reviewed in Ref. (47)] the responses to T-oligo treatment are quite rapid, appearing within hours, compared to the period of several weeks before the effects of telomere erosion after telomerase inhibition are noticed (48).

Although the majority of the work with T-oligos described here focuses on the use of the 100% telomere homolog GTTAGGGTTAG oligonucleotide, we have extensively studied the effects of other sequences as well (Table 1) (49). Although a thorough discussion of the features that affect the activities of these oligos is beyond the scope of this review, these aspects are discussed in detail elsewhere (49). Briefly, the activity of these oligos in inducing DNA damage-like responses is positively influenced by % G content and size and negatively affected by the presence of C residues (Table 1). Although the requirement for a high G content suggests that formation of G-quadruplex structures, non-Watson-Crick structures stabilized by interacting guanine residues (50), favours these activities, why C residues decrease the activities is unclear. Also unclear is why the dinucleotide pTT, with no G residues, would also stimulate these responses. All of these aspects of T-oligos are discussed elsewhere (49).

Table 1.   Oligonucleotides with variable length and telomere homology affect MM-AN melanoma cells. MM-AN cells, as a representative cell line, were provided the indicated dose of T-oligos (10, 20 or 40 μM) once and cell yield, percent apoptosis (sub G0/G1 cells) as well as γH2AX phosphorylation were determined after the indicated number of days. Induction of γH2AX above diluent control was assessed on a +/++++ scale with + indicating little induction and ++++ very robust induction
  Oligonucleotide (5′–3′)Number of bases% Telomere homology% G content% C contentTested dose (μM)γH2AX1% Apoptosis (day 4)
  1. N/A = not assessed. Source: Modified from Ohashi et al. (49).

  2. 1Induction above diluent control, as assessed by Western blot at 48 h. Not assessed for the 10 μm dose.

  3. 2Percent apoptosis comparable to diluent control.

1GTTAGGGTT910044040++++64 ± 5
2TTAGGGTTA910033040++58 ± 0.5
3GTTAGGTTTAAGGTT158733040+++66
4GGTAGGTGTAGGGTG157360010/40++++61 ± 3/96 ± 0.5
5GGTCGGTGTCGGGTG1560601340+16 ± 22
6GGCAGGCGCAGGGCG1553602740+11 ± 0.52
7GTTAGGGTTAGGGTT1510047010/40++++52 ± 7/92 ± 1
8GATAAGGGATTGGGAT164444040+++66 ± 6
9GAGTATGAG94444040+++70
10GGGTTAGGG910067040++++69 ± 10
11GTTAGGGTTAG1110045010/40++++44 ± 2/86 ± 3
12GGTAGGTGTAGGATT157347040+++NA
13GGTAGGTGTAGGATTT166944040NANA
14GGTTAGGTGTAGGTTT168144020/40++/++++69/77
15GGTTAGGTGGAGGTTT167550040++++NA
16GGTTAGGTTTAGGTTT168838020/40+++/++++54/70
17GGTTAGGTTAAGGTTA168838040NANA
18GGTAGGTGTAGGGTG157560020/40++/++++68/79
19GTTAGGGTTAGGGTTA1610044020NA45 ± 2
20GGTTGGTTGGTTGGTT165650010/20NA44 ± 11/74 ± 3
21CCTTGGTTGGTTGGTTGGTT2040401020NA18 ± 0.4
22GGTTGGTTGGTTGGTTGGTT205050010NA63

It should be noted here that other groups have also reported antiproliferative effects of certain DNA oligonucleotides. For example, Xu et al. (51) and Bates et al. (52) found that some but not all G-rich oligonucleotides induced an S-phase arrest and in some cases apoptosis in transformed cells, while normal fibroblasts were largely unaffected. Further, they found that the most inhibitory of these oligonucleotides bound a specific protein in in vitro assays and it was predicted that this protein is nucleolin (52). Interestingly, these inhibitory oligonucleotides were found to form G-quadruplex secondary structures in vitro (52). Qi et al. recently also reported the induction of apoptosis in cancer cells by G-quadruplex-forming DNAs (53). Also, Saretzki et al. (54) detected growth inhibition by small G-rich oligonucleotides and attributed this inhibition to p53 activation. Whether their dependence on p53 differs from our results because of different cell types studied or because of other experimental conditions remains to be seen.

Because of the strong antiproliferative effects on transformed cells, inducing both apoptosis (Jurkat and melanoma cells) and senescence (fibrosarcoma cells), of the T-oligos, we have explored the use of these molecules as an anti-cancer therapy. Our initial efforts focused on melanoma because it is the most lethal form of skin cancer and new methods of treatment for this malignancy are greatly needed. Treatment with the 11-base T-oligo induced apoptosis in the MM-AN melanoma cell line within 4 days but only a transient cell cycle arrest in normal melanocytes (46). The apoptosis was preceded by a decrease in the anti-apoptotic protein Livin and an increase in differentiation-associated proteins gp100, tyrosinase, TRP-1 and MART-1 (46). Brief pretreatment of MM-AN cells with T-oligos reduced their ability to form subcutaneous tumors or to form metastases when injected into the tail vein of SCID mice (46). Furthermore, intralesional injection of T-oliogs into pre-established tumors prevented their growth and increased expression of the differentiation markers gp100 and TRP-1 (46). T-oligos were also found to be effective when administered intraperitoneally (46).

More recently, T-oligos have been shown to induce apoptosis and senescence in the MCF-7 human breast cancer cell line and greatly increased the survival of SCID mice following i.v. injection of MCF-7 cells (55). Similar to normal melanocytes, the oligos did not induce apoptosis in normal human mammary epithelial cells (55). Analysis of normal tissues from both the melanoma and breast cancer mouse models showed no apparent effect from T-oligo treatment (46,55).

Together, these data suggest that T-oligos show great potential in the treatment of malignancy. However, much work remains to determine the most effective T-oligo and the best method for administration as well as to perform more extensive toxicology analyses on normal tissue from treated mice. But to date, these oligos appear to present a novel and exciting new tool in treating human malignancy.

Recent work and final perspectives

  1. Top of page
  2. Introduction
  3. Telomeres and cell replication
  4. Oligonucleotides and skin photoprotection
  5. Oligonucleotides and cancer
  6. Recent work and final perspectives
  7. References

In summary, we have shown that treatment of both normal and transformed cells with single-stranded DNA oligonucleotides homologous to the G-rich telomere overhang (called T-oligos), but not oligonucleotides unrelated or complementary to the overhang, induces DNA damage-like responses (40,43–46,55,56). T-oligos rapidly accumulate in the cell nucleus (43,57) and induce and/or activate ATM, p53, p95/Nbs1, p16, pRb and other DNA repair and cell cycle regulatory proteins (40,43,44,46,56,57). Recently, we also reported that T-oligos induce the phosphorylation of histone H2AX (γH2AX) (45), a well-known marker of sites of DNA damage (58,59) and known to occur at critically short telomeres (60). However, T-oligos induce these responses without telomere shortening or disrupting the telomere structure and leave the endogenous telomere overhang intact (43,45,56), unlike experimental telomere disruption (61). Together, these data suggest that the telomeric single-stranded G-rich DNA plays a role not only in telomere structure, but also in telomere function. We propose that T-oligos within the nucleus are recognized at the telomere by proteins whose normal role is to monitor and regulate telomere structure and function. In support of this hypothesis, we recently reported that T-oligo-induced γH2AX foci co-localize with telomeres in normal newborn dermal fibroblasts (45) (Fig. 2) demonstrating a telomere site of action of these oligos. Furthermore, phosphorylation of H2AX and p53 was severely diminished in the absence of the WRN helicase/exonuclease (45), the protein mutated in the progeroid Werner syndrome (WS) (62,63). Cells from WS patients senesce early in culture (64) and also show accelerated telomere loss (65), suggesting an important role for WRN in telomere maintenance. Furthermore, WRN is known to localize to telomeres at times of DNA replication, can associate with the telomere-binding proteins TRF1 and TRF2 and can resolve telomere loop structures in vitro (66,67). We speculate that WRN-mediated resolution of the telomere loop structure or other aberrant DNA structures at times of telomere replication induces localized DNA damage-like responses that mark the telomere and recruit proteins that facilitate replication and restore proper telomere structure and end-capping function after replication. In support of this hypothesis, Verdun and Karlseder recently reported the recruitment of homologous repair proteins to telomeres at the time of telomere replication (15,16). We propose that T-oligos present within the nucleus at the time of telomere resolution and replication may serve as additional substrate for WRN and produce the exaggerated and prolonged DNA damage-like responses we have documented (Fig. 3). Exactly how WRN may induce these responses and whether the WRN helicase, exonuclease or both activities are required is now under investigation. In any case, the situation may be analogous to the activation of the ATM kinase by the Mre11/hRad50/Nbs1 complex in the presence of specific DNA substrates (68), raising the possibility that other proteins or protein complexes may substitute for WRN in this aspect of telomere maintenance in other cell types and/or in the absence of WRN. In any case, identification of these T-oligo-interacting proteins could lead to the identification of small-molecule agonists perhaps with better efficacy, half-life and bioavailability. Regardless, T-oligos are an exciting new tool to study the mechanisms of telomere maintenance and functions that control cell proliferation, as well as a means to induce protective and antiproliferative responses in cells and tissue.

image

Figure 2.  T-oligo-induced γH2AX foci form at telomeres. Normal human newborn fibroblasts were treated for 2 days with T-oligo (GTTAGGGTTAG, 40 μm) or diluent (water) alone and then fixed and then processed for double immunofluorescence using an anti-γH2AX antibody (green) and an antibody against the telomere-specific protein TRF1 (red). Colocalization is seen in the merged images as a yellow colour. Nuclei are shown by DAPI staining (blue) in the merged images. For details, see Eller et al. (45).

Download figure to PowerPoint

image

Figure 3.  Schematic of hypothetical mechanism of T-oligo action at telomeres (18). Verdun and Karlseder have proposed that localized DNA damage responses at telomeres at the time of telomere replication facilitate eventual restoration of the proper telomere structure and function (15,16). We propose that WRN is involved in processing of the 3′ overhang and/or other G-rich structures at the telomere, opening of the telomere loop and subsequent induction of localized DNA damage-like responses, modifying the telomere chromatin (shown as darker DNA) (39). We further propose that T-oligos, present at this time and in the vicinity of the telomere, provide extra substrate for WRN which produces more extensive DNA damage-like responses including greater histone H2AX phosphorylation. Whether the telomere loop is opened in the presence of T-oligos and whether the loop is eventually restored are now under investigation.

Download figure to PowerPoint

References

  1. Top of page
  2. Introduction
  3. Telomeres and cell replication
  4. Oligonucleotides and skin photoprotection
  5. Oligonucleotides and cancer
  6. Recent work and final perspectives
  7. References
  • 1
    Campisi J. Replicative senescence: an old lives’ tale? Cell 1996: 84: 497500.
  • 2
    Beausejour C M, Krtolica A, Galimi F et al. Reversal of human cellular senescence: roles of the p53 and p16 pathways. EMBO J 2003: 22: 42124222.
  • 3
    Bond J A, Wyllie F S, Wynford-Thomas D. Escape from senescence in human diploid fibroblasts induced directly by mutant p53. Oncogene 1994: 9: 18851889.
  • 4
    Ramirez R D, Herbert B S, Vaughan M B et al. Bypass of telomere-dependent replicative senescence (M1) upon overexpression of Cdk4 in normal human epithelial cells. Oncogene 2003: 22: 433444.
  • 5
    Rheinwald J G, Hahn W C, Ramsey M R et al. A two-stage, p16(INK4A)- and p53-dependent keratinocyte senescence mechanism that limits replicative potential independent of telomere status. Mol Cell Biol 2002: 22: 51575172.
  • 6
    Shay J W, Pereira-Smith O M, Wright W E. A role for both RB and p53 in the regulation of human cellular senescence. Exp Cell Res 1991: 196: 3339.
  • 7
    Greider C W. Telomere length regulation. Annu Rev Biochem 1996: 65: 337365.
  • 8
    Makarov V L, Hirose Y, Langmore J P. Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 1997: 88: 657666.
  • 9
    Griffith J D, Comeau L, Rosenfield S et al. Mammalian telomeres end in a large duplex loop. Cell 1999: 97: 503514.
  • 10
    De Lange T. Protection of mammalian telomeres. Oncogene 2002: 21: 532540.
  • 11
    Harrington L, Robinson M O. Telomere dysfunction: multiple paths to the same end. Oncogene 2002: 21: 592597.
  • 12
    Karlseder J, Smogorzewska A, De Lange T. Senescence induced by altered telomere state, not telomere loss. Science 2002: 295: 24462449.
  • 13
    Karlseder J, Broccoli D, Dai Y, Hardy S, De Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 1999: 283: 13211325.
  • 14
    Takai H, Smogorzewska A, De Lange T. DNA damage foci at dysfunctional telomeres. Curr Biol 2003: 13: 15491556.
  • 15
    Verdun R E, Crabbe L, Haggblom C, Karlseder J. Functional human telomeres are recognized as DNA damage in g2 of the cell cycle. Mol Cell 2005: 20: 551561.
  • 16
    Verdun R E, Karlseder J. The DNA damage machinery and homologous recombination pathway act consecutively to protect human telomeres. Cell 2006: 127: 709720.
  • 17
    Park H Y, Gilchrest B A. Signaling pathways mediating melanogenesis. Cell Mol Biol (Noisy-le-grand) 1999: 45: 919930.
  • 18
    Abdel-Malek Z, Swope V, Collins C, Boissy R, Zhao H, Nordlund J. Contribution of melanogenic proteins to the heterogeneous pigmentation of human melanocytes. J Cell Sci 1993: 4: 13231331.
  • 19
    Iwata M, Corn T, Iwata S, Everett M A, Fuller B B. The relationship between tyrosinase activity and skin color in human foreskins. J Invest Dermatol 1990: 95: 915.
  • 20
    Kadekaro A L, Kavanagh R J, Wakamatsu K, Ito S, Pipitone M A, Abdel-Malek Z A. Cutaneous photobiology. The melanocyte vs. the sun: who will win the final round? Pigment Cell Res 2003: 16: 434447.
  • 21
    Eller M S, Ostrom K, Gilchrest B A. DNA damage enhances melanogenesis. Proc Natl Acad Sci U S A 1996: 93: 10871092.
  • 22
    Freeman S E, Hacham H, Gange R W, Maytum D J, Sutherland J C, Sutherland B M. Wavelength dependence of pyrimidine dimer formation in DNA of human skin irradiated in situ with ultraviolet light. Proc Natl Acad Sci U S A 1989: 86: 56055609.
  • 23
    Parrish J A, Jaenicke K F, Anderson R R. Erythema and melanogenesis action spectra of normal human skin. Photochem Photobiol 1982: 36: 187191.
  • 24
    Gilchrest B A, Zhai S, Eller M S, Yarosh D B, Yaar M. Treatment of human melanocytes and S91 melanoma cells with the DNA repair enzyme T4 endonuclease V enhances melanogenesis after ultraviolet irradiation. J Invest Dermatol 1993: 101: 666672.
  • 25
    Cui R, Widlund H R, Feige E et al. Central role of p53 in the suntan response and pathologic hyperpigmentation. Cell 2007: 128: 853864.
  • 26
    Khlgatian M K, Hadshiew I M, Asawanonda P et al. Tyrosinase gene expression is regulated by p53. J Invest Dermatol 2002: 118: 126132.
  • 27
    Kichina J, Green A, Rauth S. Tumor suppressor p53 down-regulates tissue-specific expression of tyrosinase gene in human melanoma cell lines. Pigment Cell Res 1996: 9: 8591.
  • 28
    Nylander K, Bourdon J C, Bray S E et al. Transcriptional activation of tyrosinase and TRP-1 by p53 links UV irradiation to the protective tanning response. J Pathol 2000: 190: 3946.
  • 29
    Setlow R B, Carrier W L. Pyrimidine dimers in ultraviolet-irradiated DNA’s. J Mol Biol 1966: 17: 237254.
  • 30
    Eller M S, Yaar M, Gilchrest B A. DNA damage and melanogenesis. Nature 1994: 372: 413414.
  • 31
    Gilchrest B A, Eller M S. DNA photodamage stimulates melanogenesis and other photoprotective responses. J Investig Dermatol Symp Proc 1999: 4: 3540.
  • 32
    Pedeux R, Al-Irani N, Marteau C et al. Thymidine dinucleotides induce S phase cell cycle arrest in addition to increased melanogenesis in human melanocytes. J Invest Dermatol 1998: 111: 472477.
  • 33
    Eller M S, Maeda T, Magnoni C, Atwal D, Gilchrest B A. Enhancement of DNA repair in human skin cells by thymidine dinucleotides: evidence for a p53-mediated mammalian SOS response. Proc Natl Acad Sci U S A 1997: 94: 1262712632.
  • 34
    Maeda T, Eller M S, Hedayati M, Grossman L, Gilchrest B A. Enhanced repair of benzo(a)pyrene-induced DNA damage in human cells treated with thymidine dinucleotides. Mutat Res 1999: 433: 137145.
  • 35
    Goukassian D A, Eller M S, Yaar M, Gilchrest B A. Thymidine dinucleotide mimics the effect of solar simulated irradiation on p53 and p53-regulated proteins. J Invest Dermatol 1999: 112: 2531.
  • 36
    Hadshiew I M, Gilchrest B.A. Age-associated decreases in human DNA repair capacity: implications for the skin. Age 1999: 22: 4557.
  • 37
    Khlgatian M, Hadshiew I M, Eller MS, Giese H, Vijg J, Gilchrest B A. Thymidine dinucleotide pre-treatment reduces DNA mutation frequency. J Invest Dermatol 1999: 112: 557A.
  • 38
    Ruenger T, Li G Z, Luo D, Eller M S, Gilchrest B A. Exposure of fibroblasts to telomere 3′ overhang specific DNA enhances repair of UVB-induced DNA photoproducts and provides protection against UVB-induced mutagenesis. J Invest Dermatol 2002: 119: 328A.
  • 39
    Arad S, Konnikov N, Goukassian D A, Gilchrest B A. T-oligos augment UV-induced protective responses in human skin. FASEB J 2006: 20: 18951897.
  • 40
    Hadshiew I M, Eller M S, Gasparro F P, Gilchrest B A. Stimulation of melanogenesis by DNA oligonucleotides: effect of size, sequence and 5′ phosphorylation. J Dermatol Sci 2001: 25: 127138.
  • 41
    McKay B C, Francis M A, Rainbow A J. Wildtype p53 is required for heat shock and ultraviolet light enhanced repair of a UV-damaged reporter gene. Carcinogenesis 1997: 18: 245249.
  • 42
    Eller M S, Puri N, Hadshiew I M, Venna S S, Gilchrest B A. Induction of apoptosis by telomere 3′ overhang-specific DNA. Exp Cell Res 2002: 276: 185193.
  • 43
    Eller M S, Li G Z, Firoozabadi R, Puri N, Gilchrest B A. Induction of a p95/Nbs1-mediated S phase checkpoint by telomere 3′ overhang specific DNA. FASEB J 2003: 17: 152162.
  • 44
    Li G Z, Eller M S, Hanna K, Gilchrest B A. Signaling pathway requirements for induction of senescence by telomere homolog oligonucleotides. Exp Cell Res 2004: 301: 189200.
  • 45
    Eller M S, Liao X, Liu S et al. A role for WRN in telomere-based DNA damage responses. Proc Natl Acad Sci U S A 2006: 103: 1507315078.
  • 46
    Puri N, Eller M S, Byers H R, Dykstra S, Kubera J, Gilchrest B A. Telomere-based DNA damage responses: a new approach to melanoma. FASEB J 2004: 18: 13731381.
  • 47
    Boukamp P, Mirancea N. Telomeres rather than telomerase a key target for anti-cancer therapy? Exp Dermatol 2007: 16: 7179.
  • 48
    Saretzki G. Telomerase inhibition as cancer therapy. Cancer Lett 2003: 194: 209219.
  • 49
    Ohashi N, Yaar M, Eller M S, Truzzi F, Gilchrest B A. Features that determine telomere homolog oligonucleotide-induced therapeutic DNA damage-like responses in cancer cells. J Cell Physiol 2007: 210: 582595.
  • 50
    Simonsson T. G-quadruplex DNA structures –variations on a theme. Biol Chem 2001: 382: 621628.
  • 51
    Xu X, Hamhouyia F, Thomas S D et al. Inhibition of DNA replication and induction of S phase cell cycle arrest by G-rich oligonucleotides. J Biol Chem 2001: 276: 4322143230.
  • 52
    Bates P J, Kahlon J B, Thomas S D, Trent J O, Miller D M. Antiproliferative activity of G-rich oligonucleotides correlates with protein binding. J Biol Chem 1999: 274: 2636926377.
  • 53
    Qi H, Lin C P, Fu X et al. G-quadruplexes induce apoptosis in tumor cells. Cancer Res 2006: 66: 1180811816.
  • 54
    Saretzki G, Sitte N, Merkel U, Wurm R E, Von Zglinicki T. Telomere shortening triggers a p53-dependent cell cycle arrest via accumulation of G-rich single stranded DNA fragments. Oncogene 1999: 18: 51485158.
  • 55
    Yaar M, Eller M S, Panova I et al. Telomeric DNA induces apoptosis and senescence of human breast carcinoma cells. Breast Cancer Res 2007: 9: R13.
  • 56
    Li G Z, Eller M S, Firoozabadi R, Gilchrest B A. Evidence that exposure of the telomere 3′ overhang sequence induces senescence. Proc Natl Acad Sci U S A 2003: 100: 527531.
  • 57
    Goukassian D A, Helms E, Van Steeg H, Van Oostrom C, Bhawan J, Gilchrest B A. Topical DNA oligonucleotide therapy reduces UV-induced mutations and photocarcinogenesis in hairless mice. Proc Natl Acad Sci U S A 2004: 101: 39333938.
  • 58
    Rogakou E P, Pilch D R, Orr A H, Ivanova V S, Bonner W M. DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 1998: 273: 58585868.
  • 59
    Stucki M, Jackson S P. gammaH2AX and MDC1: anchoring the DNA-damage-response machinery to broken chromosomes. DNA Repair (Amst) 2006: 5: 534543.
  • 60
    Hao L Y, Strong M A, Greider C. W. Phosphorylation of H2AX at short telomeres in T cells and fibroblasts. J Biol Chem 2004: 279: 4514845154.
  • 61
    Van Steensel B, Smogorzewska A, De Lange T. TRF2 protects human telomeres from end-to-end fusions. Cell 1998: 92: 401413.
  • 62
    Von Kobbe C, Thoma N H, Czyzewski B K, Pavletich N P, Bohr V A. Werner syndrome protein contains three structure-specific DNA binding domains. J Biol Chem 2003: 278: 5299753006.
  • 63
    Yu C E, Oshima J, Fu Y H et al. Positional cloning of the Werner’s syndrome gene. Science 1996: 272: 258262.
  • 64
    Martin G M, Sprague C A, Epstein C J. Replicative life-span of cultivated human cells. Effects of donor’s age, tissue, genotype. Lab Invest 1970: 23: 8692.
  • 65
    Schulz V P, Zakian V A, Ogburn C E et al. Accelerated loss of telomeric repeats may not explain accelerated replicative decline of Werner syndrome cells. Hum Genet 1996: 97: 750754.
  • 66
    Machwe A, Xiao L, Orren D K. TRF2 recruits the Werner syndrome (WRN) exonuclease for processing of telomeric DNA. Oncogene 2004: 23: 149156.
  • 67
    Opresko P L, Otterlei M, Graakjaer J et al. The Werner syndrome helicase and exonuclease cooperate to resolve telomeric D loops in a manner regulated by TRF1 and TRF2. Mol Cell 2004: 14: 763774.
  • 68
    Lee J H, Paull T T. ATM activation by DNA double-strand breaks through the Mre11-Rad50-Nbs1 complex. Science 2005: 308: 551554.