SEARCH

SEARCH BY CITATION

Keywords:

  • 6BH4;
  • 7BH4;
  • calcium;
  • cAMP/MITF;
  • H2O2;
  • HNF-1α;
  • melanogenesis;
  • p53

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Abstract:  Despite many efforts, regulation of skin and hair pigmentation is still not fully understood. This article focuses mainly on controversial aspects in pigment cell biology which have emerged over the last decade. The central role of tyrosinase as the key enzyme in initiation of melanogenesis has been closely associated with the 6BH4 dependent phenylalanine hydroxylase (PAH) and tyrosine hydroxylase isoform I (THI) providing evidence for an old concept of the three enzyme theory in the initiation of the pigmentation process. In this context, it is noteworthy that intracellular L-phenylalanine uptake and turnover to L-tyrosine via PAH is vital for substrate supply of THI and tyrosinase. While PAH acts in the cytosol of melanocytes, THI and tyrosinase are sitting side by side in the melanosomal membrane. THI at low pH provides L-3,4-hydroxyphenylalanine L-DOPA which in turn is required for activation of met-tyrosinase. After an intramelanosomal pH change, possibly by the p-protein, has taken place, tyrosinase is subject to control by 6/7BH4 and the proopiomelanocortin (POMC) peptides α-MSH melanocyte stimulating hormone and β-MSH in a receptor independent manner. cAMP is required for the activation of microphthalmia-associated transcription factor to induce expression of tyrosinase, for transcription of THI and for activation of PAH. The redundancy of the cAMP signal is discussed. Finally, we propose a novel mechanism involving H2O2 in the regulation of tyrosinase via p53 through transcription of hepatocyte nuclear factor 1α which in turn can also affect the POMC response.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Melanogenesis has been the interest of intense research since many decades. The end product melanin is produced in unique organelles of the neurocrest-derived melanocyte. These melanosomes contain a battery of regulatory mechanisms including the key enzyme tyrosinase to orchestrate melanogenesis. Regulation of this process can be also controlled by interaction with keratinocytes which can work in a paracrine fashion. In fact, both cells form an ‘epidermal unit’ where one melanocyte is surrounded by 36 keratinocytes (1).

Research on the biochemistry of melanogenesis started with the discovery of the enzyme tyrosinase in mushrooms already in 1895 by Bertrand and Bourquelot. In 1917, Bloch showed dopa-oxidase activity in human skin and it was Raper who elucidated the first chemical steps in the conversion of L-tyrosine to melanin in 1920 and in 1928 he showed that L-DOPA was the oxidation product from L-tyrosine itself [for review see (2)]. Only in 1942, Hogeboom and Adams demonstrated the first mammalian tyrosinase in the Harding–Passey melanoma and these authors proposed a two-enzyme hypothesis for the formation of melanin involving tyrosinase and dopa oxidase (3). However, here it is noteworthy that Lerner et al.were unable to separate tyrosinase activity from dopa-oxidase activity (4). There has been some controversy since.

Even to date, majority of the pigment cell biologists still believe that a single enzyme is involved in the oxidation of L-tyrosine forming in an orchestrated pathway the melanins.

Many advances have been made in the understanding of the physiology and pathophysiology of the pigmentation process over the last decades. Several cytokines and growth factors have been established to support the transformation of migrating melanoblasts to differentiated functional melanocytes. It was shown that mast cell growth factor (c-kit) is a major player in the migration of melanoblasts from the neural crest to its final destination (5). Endothelin 1 has been implicated in adhesion and differentiation (5). A major discovery was the role of microphthalmia-associated transcription factor (MITF) with its cAMP response element (CRE) in the regulation of tyrosinase transcription (6,7). Not to mention the role of α-MSH/MCR-1 (8,9). Other melanocortins such as ACTH and β-endorphin and recently β-MSH as well as catecholamines, acetylcholine, corticosteroids and oestrogens with their specific receptors have been also invoked in melanogenesis (10–14). Moreover, the IP3/DAG/protein kinase C (PKCβ) signal transduction system has been shown to be involved (5,13,15,16). Then it was recognised that the cofactor (6R)-L-erythro-5,6,7,8-tetrahydrobiopterin (6BH4) and its 7-isomer can play a major role in the regulation of the pigmentation process leading to the final end products eumelanin and pheomelanin in melanosomes (17,18). Here, it is important to remember that the number and the maturation stage of melanosomes per melanocyte correlate with skin colour, implicating these lysosomal organelles as major players in the pigmentation process (19). However, in the last decade several groups suggested a role for the tumour suppressor p53 in the regulation of pigmentation (20). Only very recently p53 was identified as a transcription factor for proopiomelanocortin (POMC), highlighting once more the importance of the MCR-1/α-MSH signal in control of pigmentation (21).

This article will focus on newer yet still controversial concepts of melanocyte biology and biochemistry.

Support for a ‘three enzyme theory’ in the initiation of melanogenesis

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Tyrosinase (EC 1.14.18.1) is regarded as the key enzyme in melanogenesis. It is a binuclear copper-containing enzyme with structural homology to the oxygen-binding protein haemocyanin (22,23). It is a true membrane glycoprotein with a single transmembrane helix close to its C-terminal. The N-terminal of the enzyme is located inside the melanosome matrix, meanwhile the C-terminal is sitting in the melanocyte cytosol. Two serine (ser) residues close to the C-terminal are phosphorylated by cytosolic PKCβ leading to a 2.5-fold activation of the enzyme (15,24). A recent report by Sasaki et al. on the induction of follicular melanogenesis by prostaglandin F2α supports this route (25). Tyrosinase has two copper atoms in its active site, Cu(II) A and Cu(II) B which are primarily coordinated to histidine residues. In its Cu(II) oxidation state, the enzyme is inactive representing met-tyrosinase. Consequently met-tyrosinase has first to be activated by the reduction of the two Cu(II) centres to Cu(I) by single electron donors for example by L-DOPA, ascorbic acid and superoxide anion (O2) and possibly by nitric oxide (26). For a long time, it has been known that the best activator and substrate for human tyrosinase is L-DOPA and not L-tyrosine (2,27,28). Nowadays, it is proven that both the substrate L-tyrosine and the activator L-DOPA have separate binding sites on tyrosinase (28,29). Only recently it was shown that L-DOPA is formed in melanosomes from L-tyrosine by tyrosine hydroxylase isoform I (THI, EC 1.14.16.2) (30). It was demonstrated by immuno-gold electron microscopy that both enzymes are present side by side in the melanosomal membrane using L-tyrosine as substrate (30). In this context, it is noteworthy that optimal substrate concentrations differ significantly for both enzymes. THI uses micromolar concentrations of L-tyrosine while tyrosinase needs millimolar amounts (27,31). Taking into consideration that the supply for L-tyrosine depends on facilitated diffusion (32,33), it was shown that the concentration of L-tyrosine for melanogenesis depends on the conversion of the essential amino acid L-phenylalanine by intracellular phenylalanine hydroxylase activity (PAH, EC 1.14.16.1). Here it is of interest that epidermal PAH activities correlate linearly with skin phototypes I–VI (Fitzpatrick classification) where dark skin has the highest activities (17). Moreover, enzyme activities significantly increase after UV-exposure (34) as shown in vitro in epidermal suction blister cell extracts and in vivo by Fourier-Transform Raman spectroscopy by following the conversion of L-phenylalanine at 1004 cm−1 to L-tyrosine at 850 cm−1 after application of only 1 MED UVB to the skin (35).

Figure 1a shows the linear increase of epidermal PAH activities in different skin phototypes highlighting the importance of intracellular L-phenylalanine turnover in melanogenesis (17).

image

Figure 1.  Epidermal phenylalanine hydroxylase (PAH) activities and 6-tetrahydrobiopterin (6BH4) levels correlate with skin phototypes I-VI (Fitzpatrick classification). (a) PAH activities increase with skin colour; (b) 6BH4 levels increase with skin colour These results underline the importance of the essential amino acid l-phenylalanine and its turnover to l-tyrosine in epidermal cells for the pigmentation process (17).

Download figure to PowerPoint

In summary, nowadays there is convincing evidence that three enzymes, i.e. PAH, THI and tyrosinase are crucial for the initiation of melanogenesis supporting the old concept of a ‘three enzyme theory’.

The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

The activities of PAH, THI and tyrosinase are controlled by the cofactor 6BH4 which in turn acts as the essential electron donor for PAH to produce L-tyrosine from L-phenylalanine and for THI to convert l-tyrosine to L-DOPA (36,37). Moreover, 6BH4 is an allosteric inhibitor of tyrosinase (29,38).

In support for the above suggested ‘three enzyme theory’ of melanogenesis, it has been documented that both melanocytes and keratinocytes hold the capacity for autocrine de novo synthesis/regulation and recycling of 6BH4 (17). Moreover, it was demonstrated that melanosomes contain indeed 6BH4 as well as its isomer 7BH4 at physiological concentrations (18,39). Epidermal 6BH4 levels also correlate with skin phototypes I–VI with increasing levels from fair to the dark skin and 6BH4de novo synthesis increases after UV – exposure supporting their close relationship with skin pigmentation (34) (Fig. 1b).

In conclusion, 6BH4 is a major player in the regulation of constitutive and de novo skin colour. Given the evidence that PAH and THI activities are preceding the initiation of active tyrosinase and that these steps are controlled by 6BH4, we propose a modified Raper-Mason scheme adding those two additional steps (Fig. 2).

image

Figure 2.  The three-enzyme cascade in initiation of melanogenesis – the modified Raper Mason Scheme. The uptake of l-phenylalanine occurs by Ca2+/ATPase facilitated uptake via LAT1 (large amino acid transporter) [1] Intracellular PAH metabolises the turnover to l-tyrosine in the presence of 6BH4. [2] l-tyrosine is the substrate for TH I [3] in the presence of 6BH4 to produce l-Dopa which in turn binds to met-tyrosinase [4] to activate the enzyme including the reduction of Cu(II) to Cu(I) on the enzyme active site. After phosphorylation of ser505 and ser509 in the C-terminal of the enzyme, l-tyrosine can bind to the enzyme and the reaction proceeds at the melanosomal pH of 6.8 starting melanogenesis [5].

Download figure to PowerPoint

Pigmentation is synchronised by a pH change during melanosome maturation

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Melanosomes are lysosome derived organelles (19,40). For a long time, it was believed that the intramelanosomal pH is acidic. It was suggested that the transfer of proteins from the rough endoplasmic reticulum (RER) through the Golgi apparatus followed by completion of melanosome maturation from stage I–IV includes an intramelanosomal pH switch from pH 5 to 6.8 (41–43). Early stage melanosomes would have a low pH which is close to optimal for THI (31). The low pH is also needed for keeping L-DOPA stable to auto-oxidation (30). However, the optimum for tyrosinase activity is at pH 6.5–7.0. Moreover, tyrosinase processing also relies on neutral pH as shown by Chen et al. in the presence of NH4Cl and bafilomycin A1 (44). Increased melanogenesis upon stimulation with bafilomycin A1 and NH4Cl was shown implying neutral pH in melanosomes (41,42,45). The switch from pH 5.0 to 6.8 seems to depend on the proton pump p-protein in the melanosome membrane (41–43). Here it is noteworthy that only very recently it was shown by Anbar et al. that systemic as well as topical proton pump inhibitors prevent pigmentation in guinea pigs supporting the importance of the intramelanosomal pH switch (46). Further support stems from the observation that patients with vitiligo who received those inhibitors do indeed depigment and only respond poorly to any kind of treatment (47). In this context it is also noteworthy that low pH is required for the processing of POMC-derived peptides including ACTH, α-MSH, β-MSH and β-endorphin (16,48,49). The cleavage occurs by the calcium-dependent prohormone convertases 1 and 2 (PC1 and PC2), the PC2 regulatory protein (7B2), Furin and PACE 4 which all need low pH for their activities (49). At this point, it should be emphasised that melanosomes hold the full machinery including Furin for POMC-processing and functioning (49–52).

POMC-derived peptides can directly control melanogenesis in a receptor independent manner

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Lerner and McGuire were the first to recognise the influence of α-MSH and β-MSH on skin pigmentation in humans (53). Later much research has been directed to demonstrate a G-coupled MC1-receptor dependent regulation of pigmentation by ACTH and α-MSH via MITF/cAMP (8,16,48). Pawelek’s group showed that MSH is internalised into melanosomes (54). Moreover, the same group demonstrated internal MSH-binding sites (55). However, recently it was demonstrated that α-MSH as well as β-MSH can regulate tyrosinase activity directly in the melanosome in a receptor independent manner (18,30,38,48,49). In 1999 Moore et al. proved the formation of a stable 1:1 complex between α-MSH and 6BH4 (56) and as tyrosinase activity is inhibited by 6BH4 and its isomer 7BH4 by forming an allosteric inhibitor complex (29), it was then recognised that both α-MSH as well as β-MSH can reactivate these inhibitions by binding 6BH4 and 7BH4 respectively (18,57). The validity of this mechanism is supported by the determination of intramelanosomal 6- and 7BH4 as well as α-MSH and β-MSH concentrations (18,30).

Taken together, these observations invoke a concerted action of 6BH4/7BH4 and α/β-MSH in control of tyrosinase activity in the melanosome in a receptor independent action (Fig. 3).

image

Figure 3.  Regulation of tyrosinase by 6BH4/7BH4 and the melanocortins α-MSH and β-MSH in a receptor independent mechanism. The essential amino acid l-phenylalanine is actively transported into melanocytes via the Na+/Ca++ antiporter system (LAT1) and it is rapidly turned over to l-tyrosine by cytosolic 6BH4 dependent phenylalanine hydroxylase (PAH) [1]. Both l-tyrosine [2] and 6BH4 [2] are transported from the cytosol into the melanosome by facilitated diffusion (18,30,32). l-tyrosine is converted to L-DOPA by TH isoform I at pH 5.0 [3] (18,30). l-DOPA activates tyrosinase by reducing inactive met-tyrosinase [4] to the fully active enzyme which then in turn, after the pH switch via the p-protein [5] took place, initiates melanogenesis (28,29,41,42,45). Tyrosinase activity can also be regulated via 6BH4 [2], and its isomer 7BH4 [6] by forming a 1:1 inhibitor complex with the enzyme which can be reversed by intramelanosomal α-MSH [7] and β-MSH [8] yielding active tyrosinase [9] (18,29,56,57).

Download figure to PowerPoint

cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

The central role of cAMP in control of tyrosinase expression was demonstrated by many pigment cell biologists [for review see (9,24)]. This signal has gained much interest after it was recognised that this second messenger can influence the transcription of tyrosinase via MITF. Transcription of THI is also regulated by cAMP/cAMP response element (CRE). To complete the triad for initiation of pigmentation, cAMP regulates phosphorylation of the important ser16 residue on PAH via protein kinase A (36).

Until recently, it was the dogma that the major source for cAMP in melanocytes is related to the α-MSH/MC1-R signal (8). This was put somewhat into question when it was demonstrated that POMC-knock out mice on a non-Agouti background had black fur (58).

Nowadays, it is evident that G-protein receptors are coupled to cAMP – synthesis via adenylylcyclase do not include only the MC1-R signal. After the discovery of autocrine catecholamine, acetylcholine as well as oestrogen and corticosteroid synthesis in melanocytes, several other receptors for cAMP synthesis have been identified including the β2-adrenoceptor, the muscarinic receptors (M1, M3, M5), the α-and β-estrogen receptors and the CRF/CRF-R1 signal. Here it is of interest that CRF can stimulate POMC and ACTH production (14,59). Only recently the β-MSH/MC4-R has been added to the list (12–14,59,60). In this context it is of note that cAMP controls also the initial step for 6BH4 synthesis via GTP-cyclohydrolase I through a CRE binding domain on the promoter of the enzyme (61). Moreover, the β2-adrenoceptor has a CRE binding domain in its promoter and in addition a 6BH4 regulatory binding site which in turn increases receptor densities and cAMP levels (62). Most importantly, the β2-adrenoceptor signal on melanocytes is indeed very effective in promoting pigmentation (60). This is also the case for the oestrogen receptor signal (12).

In summary, we can conclude that both the transcription and function of tyrosinase, THI and PAH are controlled by cAMP by redundant signalling supporting once more the concept of the ‘three enzyme theory’ in melanogenesis as described above. Moreover, the redundancy of cAMP production in epidermal melanocytes highlights the crucial importance of this second messenger in control of melanogenesis.

The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Very recently p53 has been stressed as a sensor/effector for UV-induced pigmentation (21). These authors fostered once again that sun tanning requires induction of α-MSH/MCR-1 supporting earlier results that UV induces p53 as well as POMC (21,63–66). It was now elegantly shown that POMC is a direct transcriptional target of p53 (21). One current dogma is that induction of melanogenesis requires activation of MITF via α-MSH/MCR-1/cAMP (67). Cui et al. utilised this cascade to follow these events and they were able to show that p53 is rapidly induced after UV (1 h), followed by α-MSH (3–6 h) and finally by induction of MITF (6 h). However, as tyrosinase has no p53 consensus site in its promoter, Cui et al. failed to connect p53 as a direct player in the induction of melanogenesis (20,21,68,69).

Here it should be mentioned that H2O2 induces p53 (70) and NFκB and because UV produces H2O2, we can conclude that this reactive oxygen species (ROS) is the initial event to foster both p53 expression via NFκB and protein stability (71). This assumption could also explain the finding of a non UV-induced pigmentation such as inflammatory/postinflammatory hyperpigmentation, because NADPH oxidase induces the ‘oxygen burst’ which in turn could lead via H2O2 to induction/stabilisation of p53 mimicking the same scenario as observed after UV.

Hence the crucial questions remain, whether p53 is a sensor/effector by playing an indirect role as suggested by Cui et al. or whether p53 plays a direct role in control of pigmentation.

To address this question, it is noteworthy that besides the transcriptional control of tyrosinase by cAMP/CRE/MITF, it was demonstrated that hepatocyte nuclear factor 1α (HNF-1α) is a transcription factor for tyrosinase due to a specific consensus sequence on the tyrosinase promoter (72). In this context, it should be mentioned that HNF-1α is a transcription factor for many genes, by recognising a 16 base inverted palindrome (consensus sequence) which in turn acts as peg to bind the HNF-1α homodimer to the DNA promoter. Moreover, recently it was shown that p53 is a transcriptional regulator of HNF-1α (73). Figure 4a provides the gel shift analysis to prove the binding of HNF-1α to p53. Dimerisation of HNF-1α leads to activation of HNF-1α and depends on dimerisation cofactor (DCoH) (74). Here it is of interest that pterin-4a-carbinolamine dehydratase (PCD, EC 4.2.1.96), the key enzyme for 6 BH4-recycling in its tetrameric form acts as an enzyme (PCD) for turning over the metabolite 4a-carbinolamine, while on the other hand, the dimer of this protein serves as a DCoH for HNF-1α (74,75). Hence, HNF-1α controls the transcription of its own DCoH (73). Moreover, expression and function of PCD/DCoH follow skin photo types I–VI (Fitzpatrick classification) underlining its role in pigmentation (17).

image

Figure 4.  p53 binds to HNF-1α and HNF-1α binds to MITF. (a) p53 gel retardation assay proves the presence of a p53 binding domain on the promoter of the HNF-1α gene. PG –‘polygrip’ known p53 consensus binding site; NON – mutant p53 binding site; PCD – potential p53 binding site in the 5′ flanking region of the PCD gene as indicated by computer analysis failed to bind p53; HNF – 1α-potential p53 binding site in the promoter of the HNF-1α gene. We found GGGGGTGCCCACAGGGCTTGGCT in the HNF-1α promoter nucleotide bases G556-T578 which is in agreement with the established p53 consensus (101). (b) Bandshift analysis proves that MITF and tyrosinase have indeed an HNF-1a binding domain. Both isoforms of pterin-4a -carbinolamine dehydratase (PCD1 and PCD2) and tyrosinase (TYR) served as positive controls. TYR – HNF-1α binding site in the tyrosinase gene promoter (72); PCD1 – distal HNF-1α binding site in the PCD 5′ flanking region; PCD2 – proximal HNF-1α binding site in the PCD 5′ flanking region; MITF – single HNF-1α binding site in the MITF promoter, NEG- negative control HNF-1 consensus based on analysis of 26 genes (102): HNF-1 consensus: TTAATNAWTNAMCAM, human tyrosinase: GTTAATATTCTTAACCA (with M = A or C; N = A,C,G or T; W = A or T).

Download figure to PowerPoint

It was also demonstrated by band shift analysis that HNF-1α binds to its consensus sequence on the enhancer of MITF in addition to the tyrosinase promoter. Figure 4b shows the result of the gel shift analysis (73,76). Taken together, HNF-1α controls the transcription of tyrosinase as well as the transcription of MITF which also controls tyrosinase transcription.

However, the POMC/α-MSH/MCR-1/cAMP signal has been stressed as an important player for the mandatory second messenger cAMP to activate MITF (8,16). It is equally tempting to invoke other redundant cAMP signals shown to be present in human epidermal melanocytes and keratinocytes in this cascade which would yield the same downstream event. This has certainly been shown for the estrogens and the catecholamines (60) and those signals would explain the black fur in the POMC−/− mouse (58). However, it is also possible that direct transcription of HNF-1α by p53 promotes transcription of tyrosinase in the absence of MITF/cAMP. Here it is noteworthy that the exclusive importance for MITF for transcription of tyrosinase was recently questioned (6).

In conclusion, we would like to propose that p53 is of overriding importance in initiation of melanogenesis by controlling the transcription factor HNF-1α which in turn controls MITF and tyrosinase. Figure 5 provides our current understanding of this scenario. This concept is supported by a recent publication where microarray analysis of melanocytes before and after UV-exposure showed that all of the proteins involved in p53 regulation/activity are increased after UV-exposure concomitant with pigmentation (77). Moreover, the release of oligonucleotides (T-T) from DNA produces O2 which easily disproportionates to H2O2 possibly inducing transcription of p53 and other factors which could explain the observed increase in pigmentation (78). Taken together, these results support that p53 acts as a direct major player in control of melanogenesis (73,76). The proposed scenario would add a novel role for p53 to its well-established functions (79) (Fig. 6).

image

Figure 5.  The proposed p53/HNF-1α/MITF/cAMP cascade in control of tyrosinase/to initiate melanogenesis UV/H2O2 induces NFκB which in turn induces p53 [1] (70,100) leading to transcription of HNF-1α and POMC [2,3] (21,73). However, short term exposure also leads to stabilisation of p53 (71). HNF-1α induces transcription of its dimerisation cofactor (DCoH) [4] and binds after dimerisation to a concensus site on the tyrosinase promoter [5] (72,74). Moreover, HNF-1α induces transcription of MITF [6], which is also induced by cAMP via CRE [7] to bind to the enhancer region of tyrosinase [8] and GTP-CH I [9]. cAMP is also required for the CRE response on GTP-CH I [10] to initiate 6BH4de novo synthesis and for TH I [11]. So far the α-MSH/MCR-1 cascade has been implicated for the cAMP signal. However, several alternative signal transduction systems can G-couple activate adenylylcyclase on the melanocyte plasma membrane to produce cAMP. These include: [12] (a) epinephrine/norepinephrine/β2-adrenoceptor (60), (b) α-MSH or ACTH(1–39)/MC1-R [for review see (81)], (c) β-MSH/MC4-R, (d) 17β-estradiol/oestrogen receptors (12), (e) acetylcholine/muscarinic receptors (M1, M3, M5) (13), (f) CRF/CRF-R1 (14,59). Moreover, cAMP binds to its response element CRE which acts as a transcription factor for MITF, TH and the β2-adrenoceptor genes. Control of tyrosinase by both HNF-1α as well as alternative/redundant cAMP signalling can explain the black fur in the POMC−/− mouse on non-Agouti background (58). However, transcription of HNF1α can be induced by p53, supporting this tumour suppressor in activation of tyrosinase.

Download figure to PowerPoint

image

Figure 6.  The proposed chronology of p53 in 2007 [adapted from Hussain and Harris 2006 (79)].

Download figure to PowerPoint

Regulation of melanogenesis by calcium

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Besides the synthesis of cAMP the release of the other second messenger calcium into the cell cytosol of melanocytes is of major importance occurring through the IP3/DAG pathway. In melanocytes, this signal is controlled by the norepinephrine/α1-adrenoceptor, by the ACTH 1-17/MC1-R and CRF/CRF-R1 cascade (14,80,81). Support stems from the observation that in the human epidermis the concentrations of POMC-derived peptides differ where ACTH 1–17 > α-MSH > ACTH 1–39 (82). Here it should be noted that melanocytes only form norepinephrine which is the preferred ligand for the α1-adrenoceptor (80). To optimally drive the β2-adrenoceptor cascade, as mentioned above, melanocytes rely on the epinephrine supply from surrounding keratinocytes (83). However, it should be noted that norepinephrine can also serve as agonist for the β2-adrenoceptor (84). This latter signal represents a fine example for paracrine control of pigmentation by surrounding keratinocytes, justifying the old statement from Fitzpatrick and Lerner ‘that keratinocytes support melanogenesis in human skin’ (2). Historically it is of interest that a putative role for the adrenergic receptors in melanogenesis was proposed already in 1991 (85).

The IP3/DAG signal controls also the activation of PKC-β which in turn activates tyrosinase 2.5-fold by phosphorylation of two ser residues in the C-terminal domain of the enzyme, a concept which was recently fostered by Sasaki et al. (15,25) (Fig. 7).

image

Figure 7.  The IP3/DAG signal in human melanocytes. ACTH (1–17) is the most abundant melanocortin in the human epidermis where it binds to the MC1-R and signals IP3/DAG (81,82,103). Also norepinephrine and CRF induce and bind to α1-adrenoceptors and CRF-R1 respectively on melanocytes to produce the IP3/DAG signal (14,80). IP3 increases cytosolic calcium by its removal from intracellular stores on the RER, and this increase in calcium promotes the active transport of l-phenylalanine via LAT1 and its turnover via PAH to l-tyrosine to significantly increase the pool of this substrate for melanogenesis (33–35). DAG activates protein kinase C-β which phosphorylates two serine residues close to the cytosolic C-terminus of tyrosinase to increase its activity (Vmax) 2.5-fold (15).

Download figure to PowerPoint

In the context of the ‘three enzyme theory’ of melanogenesis as mentioned above, the intracellular release of calcium from the RER by IP3 controls the active transport of L-phenylalanine and its turnover to L-tyrosine via the calmodulin dependent Ca2+-ATPase providing sufficient concentrations of L-tyrosine to sustain melanogenesis (33,73).

Moreover, POMC-processing requires calcium. All of the POMC processing convertases (PC1, PC2, Furin, PACE4) have two specific calcium binding domains which are essential for activity (49).

In addition, it has been shown that calcium binds to melanin with a high affinity regulating the redox status of the melanocyte leading to prevention of oxidative stress by ROS (86). In fact calcium binds to melanin with the same affinity as calmodulin (86). This observation emphasises the function of melanin as an important free radical scavenger rather then a weak physical UV-filter with an sun protection factor (SPF) between 2 and 3. Taken together, calcium is an important participant in the concept of melanogenesis.

The underestimated importance of H2O2 in melanocyte biology

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References

Generation of H2O2 is a physiological event in the cellular response. In fact, this ROS is a major player for cell survival and integrity (87,88). Melanocytes are especially sensitive to ROS. One reason is low catalase levels in these cells (89). To date many sources for the intracellular production of H2O2 have been identified and it has been shown that this ROS exercises its function twofold in a concentration dependent manner (88). H2O2 in millimolar concentrations can be deleterious to many proteins and peptides leading to deactivation/disruption of many important pathways involved in melanogenesis including 6BH4de novo synthesis and regulation, the cholinergic signal via acetylcholinesterase and butyrylcholinesterase (90), the prohormone convertases PC1, PC2, Furin, PACE4 in POMC processing as well as the POMC derived peptides α-MSH and β-endorphin (91). Most importantly the antioxidant mechanism including catalase, thioredoxin reductase and the methionine sulfoxide reductases A&B are equally target for disruption by H2O2 under certain conditions (88,90–92). Tyrosinase itself is sensitive to ROS due to the presence of 17 cysteines in the C-terminal as well as in the N-terminal regions leading to structural changes of the enzyme. However, deactivation of the enzyme active site due to a methionine residue in position 374 (93), it can be proposed that high concentrations of H2O2 could oxidise this residue to methionine sulfoxide. This event would deactivate the enzyme. This proposed mechanism can explain that H2O2 in high concentrations leads to deactivation of the enzyme as reported earlier (38). However, in this context it is also important to realise that tyrosinase as well as many other of the above mentioned proteins and peptides are upregulated and activated by low concentrations (μm) of H2O2 (38,94). Moreover, concentrations of H2O2 in the micromolar range are extremely useful upregulating a plethora of transcription factors including p53, MITF and NFkB and the antioxidant enzymes catalase, thioredoxin reductase, glutathione reductase and the methionine sulfoxide reductases A & B (73,87,88,92,95). Here it is also important that enzyme activities are directly controlled by H2O2 concentrations which is also the case for PAH, THI and tyrosinase, further supporting the ‘three enzyme theory’ of melanogenesis as stressed above (38,73).

Regulation and protection of tyrosinase against a ROS burst is also provided by both tyrosinase related proteins TRP1 and TRP2 which are located close to tyrosinase in the melanosomal membrane. However, these proteins have sequence homology to tyrosinase especially in their cysteine rich domains which in turn are also targets to H2O2-mediated oxidation, by eliminating this ROS. In fact TRP1 has been recognised as a peroxidase (96), while TRP2 has an additional function as dopachrome tautomerase (97). In addition to TRP1 and TRP2 the calcium binding protein calnexin is present in the melanosomal membrane adding another force for redox homeostasis in the melanosome (98).

In summary, H2O2 is a major player in melanocyte biology. Last but not least it controls the expression of p53 via NFκB (99,100), but it also stabilises p53. One important take home message is that p53 is not only a signal for apoptosis and DNA repair, but it is also an important transcription factor including HNF1-α and POMC.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Support for a ‘three enzyme theory’ in the initiation of melanogenesis
  5. The initial three steps of melanogenesis are regulated by the cofactor (6R)-L-erythro-5, 6, 7, 8-tetrahydrobiopterin
  6. Pigmentation is synchronised by a pH change during melanosome maturation
  7. POMC-derived peptides can directly control melanogenesis in a receptor independent manner
  8. cAMP as a major player in transcription of tyrosinase, tyrosine hydroxylase and in activation of phenylalanine hydroxylase
  9. The p53/HNF-1α/MITF/cAMP-axis in tyrosinase transcription – evidence for direct control of melanogenesis by p53
  10. Regulation of melanogenesis by calcium
  11. The underestimated importance of H2O2 in melanocyte biology
  12. Acknowledgement
  13. References
  • 1
    Fitzpatrick T B, Breathnach A S. [The epidermal melanin unit system.]. Dermatol Wochenschr 1963: 147: 481489.
  • 2
    Fitzpatrick T B, Lerner A B. Biochemical basis of human melanin pigmentation. AMA Arch Derm Syphilol 1954: 69: 133149.
  • 3
    Hogeboom G H, Adams M H. Mammalian tyrosinase and dopa oxidation. J Biol Chem 1942: 145: 273279.
  • 4
    Lerner A B, Fitzpatrick T B, Calkins E, Summerson W H. Mammalian tyrosinase; the relationship of copper to enzymatic activity. J Biol Chem 1950: 187: 793802.
  • 5
    Reid K, Nishikawa S, Bartlett P F, Murphy M. Steel factor directs melanocyte development in vitro through selective regulation of the number of c-kit+ progenitors. Dev Biol 1995: 169: 568579.
  • 6
    Gaggioli C, Busca R, Abbe P, Ortonne J P, Ballotti R. Microphthalmia-associated transcription factor (MITF) is required but is not sufficient to induce the expression of melanogenic genes. Pigment Cell Res 2003: 16: 374382.
  • 7
    Fuse N, Yasumoto K, Suzuki H, Takahashi K, Shibahara S. Identification of a melanocyte-type promoter of the microphthalmia-associated transcription factor gene. Biochem Biophys Res Commun 1996: 219: 702707.
  • 8
    Abdel-Malek Z, Swope V B, Suzuki I et al. Mitogenic and melanogenic stimulation of normal human melanocytes by melanotropic peptides. Proc Natl Acad Sci U S A 1995: 92: 17891793.
  • 9
    Slominski A, Tobin D J, Shibahara S, Wortsman J. Melanin pigmentation in mammalian skin and its hormonal regulation. Physiol Rev 2004: 84: 11551228.
  • 10
    Kauser S, Schallreuter K U, Thody A J, Gummer C, Tobin D J. Regulation of human epidermal melanocyte biology by beta-endorphin. J Invest Dermatol 2003: 120: 10731080.
  • 11
    Iyengar B, Misra R S, Subalakshmi B. ACTH acts directly on melanocytes to stimulate melanogenesis--an in vitro study. Indian J Pathol Microbiol 1995: 38: 399402.
  • 12
    Thornton M J, Nelson L D, Taylor A H, Birch M, Laing I, Messenger A G. The modulation of aromatase and estrogen receptor alpha in cultured human dermal papillacells by dexamethasone: a novel mechanism for selective action of estrogen via estrogen receptor beta? J Invest Dermatol 2006: 126: 20102018.
  • 13
    Grando S A, Pittelkow M R, Schallreuter K U. Adrenergic and cholinergic control in the biology of epidermis: physiological and clinical significance. J Invest Dermatol 2006: 126: 19481965.
  • 14
    Slominski A, Zbytek B, Szczesniewski A et al. CRH stimulation of corticosteroids production in melanocytes is mediated by ACTH. Am J Physiol Endocrinol Metab 2005: 288: E701E706.
  • 15
    Park H Y, Perez J M, Laursen R, Hara M, Gilchrest B A. Protein kinase C-beta activates tyrosinase by phosphorylating serine residues in its cytoplasmic domain. J Biol Chem 1999: 274: 1647016478.
  • 16
    Slominski A, Wortsman J, Luger T, Paus R, Solomon S. Corticotropin releasing hormone and proopiomelanocortin involvement in the cutaneous response to stress. Physiol Rev 2000: 80: 9791020.
  • 17
    Schallreuter K U, Wood J M, Pittelkow M R et al. Regulation of melanin biosynthesis in the human epidermis by tetrahydrobiopterin. Science 1994: 263: 14441446.
  • 18
    Spencer J D, Chavan B, Marles L K, Kauser S, Rokos H, Schallreuter K U. A novel mechanism in control of human pigmentation by (beta)-melanocyte-stimulating hormone and 7-tetrahydrobiopterin. J Endocrinol 2005: 187: 293302.
  • 19
    Orlow S J. Melanosomes are specialized members of the lysosomal lineage of organelles. J Invest Dermatol 1995: 105: 37.
  • 20
    Khlgatian M K, Hadshiew I M, Asawanonda P et al. Tyrosinase gene expression is regulated by p53. J Invest Dermatol 2002: 118: 126132.
  • 21
    Cui R, Widlund H R, Feige E et al. Central role of p53 in the suntan response and pathologic hyperpigmentation. Cell 2007: 128: 853864.
  • 22
    Lerch K. Copper monooxygenases: tyrosinase and dopamine β-hydroxylase. In: SigelH, ed. Metal Ions in Biological Systems. New York: Marcel Decker, 1981: 143186.
  • 23
    Lerch K. Protein and active site structure of tyrosinase. In: BagnaraJ T, ed. Advances in Pigment Cell Research. New York: A. Liss, 1988: 8598.
  • 24
    Korner A, Pawelek J. Activation of melanoma tyrosinase by a cyclic AMP-dependent protein kinase in a cell-free system. Nature 1977: 267: 444447.
  • 25
    Tice R R, Agurell E, Anderson D et al. Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ Mol Mutagen 2000: 35: 206221.
  • 26
    Romero-Graillet C, Aberdam E, Biagoli N, Massabni W, Ortonne J P, Ballotti R. Ultraviolet B radiation acts through the nitric oxide and cGMP signal transduction pathway to stimulate melanogenesis in human melanocytes. J Biol Chem 1996: 271: 2805228056.
  • 27
    Wood J M, Schallreuter K U. Studies on the reactions between human tyrosinase, superoxide anion, hydrogen peroxide and thiols. Biochim Biophys Acta 1991: 1074: 378385.
  • 28
    Olivares C, Garcia-Borron J C, Solano F. Identification of active site residues involved in metal cofactor binding and stereospecific substrate recognition in Mammalian tyrosinase. Implications to the catalytic cycle. Biochemistry 2002: 41: 679686.
  • 29
    Wood J M, Schallreuter-Wood K U, Lindsey N J, Callaghan S, Gardner L G. A specific tetrahydrobiopterin binding domain on tyrosinase controls melanogenesis. Biochem Biophys Res Commun 1995: 206: 480485.
  • 30
    Marles L K, Peters E M, Tobin D J, Hibberts N A, Schallreuter K U. Tyrosine hydroxylase isoenzyme I is present in human melanosomes: a possible novel function in pigmentation. Exp Dermatol 2003: 12: 6170.
  • 31
    Naoi M, Minami M, Maruyama W, Parvez H. Allosteric regulation of tyrosine hydroxylase activity by its cofactor tetrahydrobioterin. In: NaoiM, ParvezS H, eds. Tyrosine Hydroxylase. Utrecht: VSP, 1993: 2336.
  • 32
    Potterf S B, Hearing V J. Tyrosine transport into melanosomes is increased following stimulation of melanocyte differentiation. Biochem Biophys Res Commun 1998: 248: 795800.
  • 33
    Schallreuter K U, Wood J M. The importance of L-phenylalanine transport and its autocrine turnover to L-tyrosine for melanogenesis in human epidermal melanocytes. Biochem Biophys Res Commun 1999: 262: 423428.
  • 34
    Schallreuter K U, Schulz-Douglas V, Bünz A, Beazley W, Körner C. Pteridines in the control of pigmentation. J Invest Dermatol 1997: 109: 3135.
  • 35
    Schallreuter K U, Chavan B, Rokos H, Hibberts N, Panske A, Wood J M. Decreased phenylalanine uptake and turnover in patients with vitiligo. Mol Genet Metab 2005: 86 (Suppl 1): S2733.
  • 36
    Pey A L, Martinez A, Charubala R et al. Specific interaction of the diastereomers 7(R)- and 7(S)-tetrahydrobiopterin with phenylalanine hydroxylase: implications for understanding primapterinuria and vitiligo. FASEB J 2006: 20: 21302132.
  • 37
    Kaufman S. Tetrahydrobiopterin: Basic Biochemistry and Role in Human Disease. Baltimore, USA: John Hopkins University Press, 1997.
  • 38
    Wood J M, Chavan B, Hafeez I, Schallreuter K U. Regulation of tyrosinase by tetrahydropteridines and H2O2. Biochem Biophys Res Commun 2004: 325: 14121417.
  • 39
    Spencer J D. H2O2-mediated oxidation affects POMC-processing and POMC-derived peptides in the human epidermis using vitiligo as a model for oxidative stress. PhD thesis. University of Bradford, UK 2007.
  • 40
    Seiji M, Fitzpatrick T B, Birbeck M S. The melanosome: a distinctive subcellular particle of mammalian melanocytes and the site of melanogenesis. J Invest Dermatol 1961: 36: 243252.
  • 41
    Fuller B B, Spaulding D T, Smith D R. Regulation of the catalytic activity of preexisting tyrosinase in black and Caucasian human melanocyte cell cultures. Exp Cell Res 2001: 262: 197208.
  • 42
    Ancans J, Thody A J. Activation of melanogenesis by vacuolar type H(+)-ATPase inhibitors in amelanotic, tyrosinase positive human and mouse melanoma cells. FEBS Lett 2000: 478: 5760.
  • 43
    Ancans J, Hoogduijn M J, Thody A J. Melanosomal pH, pink locus protein and their roles in melanogenesis. J Invest Dermatol 2001: 117: 158159.
  • 44
    Engler M B, Engler M M, Chen C Y et al. Flavonoid-rich dark chocolate improves endothelial function and increases plasma epicatechin concentrations in healthy adults. J Am Coll Nutr 2004: 23: 197204.
  • 45
    Ancans J, Tobin D J, Hoogduijn M J, Smit N P, Wakamatsu K, Thody A J. Melanosomal pH controls rate of melanogenesis, eumelanin/phaeomelanin ration and melanosomal maturation in melanocytes and melanoma cells. Exp Cell Res 2001: 268: 2635.
  • 46
    Anbar S, Westerhof W, Badawy N, Abdel-Rahman A T, Salem H. The role of H1 and H2 receptor antagonists in inhibition of UVB-induced melanogenesis in guinea pigs. EADV 15th Congress 2006: Abstract FC16.14.
  • 47
    Schallreuter K U, Rokos H. From the bench to the bedside: proton pump inhibitors can worsen vitiligo. Br J Dermatol 2007: 156: 13711373.
  • 48
    Slominski A, Paus R, Wortsman J. On the potential role of proopiomelanocortin in skin physiology and pathology. Mol Cell Endocrinol 1993: 93: C1C6.
  • 49
    Peters E M, Tobin D J, Seidah N G, Schallreuter K U. Pro-opiomelanocortin-related peptides, prohormone convertases 1 and 2 and the regulatory peptide 7B2 are present in melanosomes of human melanocytes. J Invest Dermatol 2000: 114: 430437.
  • 50
    Berson J F, Theos A C, Harper D C, Tenza D, Raposo G, Marks M S. Proprotein convertase cleavage liberates a fibrillogenic fragment of a resident glycoprotein to initiate melanosome biogenesis. J Cell Biol 2003: 161: 521533.
  • 51
    Kauser S, Thody A J, Schallreuter K U, Gummer C L, Tobin D J. A fully functional proopiomelanocortin/melanocortin-1 receptor system regulates the differentiation of human scalp hair follicle melanocytes. Endocrinology 2005: 146: 532543.
  • 52
    Spencer J D, Gibbons N C J, Böhm M, Schallreuter K U. The Ca2+ binding capacity of epidermal furin is disrupted in vitiligo by H2O2-mediated oxidation. Endocrinology 2007, in press.
  • 53
    Lerner A B, McGuire J S. Effect of alpha- and betamelanocyte stimulating hormones on the skin colour of man. Nature 1961: 189: 176179.
  • 54
    Orlow S J, Hotchkiss S, Pawelek J M. Internal binding sites for MSH: analyses in wild-type and variant Cloudman melanoma cells. J Cell Physiol 1990: 142: 129136.
  • 55
    Chakraborty A K, Orlow S J, Bolognia J L, Pawelek J M. Structural/functional relationships between internal and external MSH receptors: modulation of expression in Cloudman melanoma cells by UVB radiation. J Cell Physiol 1991: 147: 16.
  • 56
    Moore J, Wood J M, Schallreuter K U. Evidence for specific complex formation between alpha-melanocyte stimulating hormone and 6(R)-L-erythro-5,6,7,8-tetrahydrobiopterin using near infrared Fourier transform Raman spectroscopy. Biochemistry 1999: 38: 1531715324.
  • 57
    Schallreuter K U, Moore J, Tobin D J. et al. Alpha-MSH can control the essential cofactor 6-tetrahydrobiopterin in melanogenesis. Ann N Y Acad Sci 1999: 885: 329341.
  • 58
    Slominski A, Plonka P M, Pisarchik A et al. Preservation of eumelanin hair pigmentation in proopiomelanocortin-deficient mice on a nonagouti (a/a) genetic background. Endocrinology 2005: 146: 12451253.
  • 59
    Slominski A, Zbytek B, Zmijewski M et al. Corticotropin releasing hormone and the skin. Front Biosci 2006: 11: 22302248.
  • 60
    Gillbro J M, Marles L K, Hibberts N A, Schallreuter K U. Autocrine catecholamine biosynthesis and the beta-adrenoceptor signal promote pigmentation in human epidermal melanocytes. J Invest Dermatol 2004: 123: 346353.
  • 61
    Al Sarraj J, Vinson C, Han J, Thiel G. Regulation of GTP cyclohydrolase I gene transcription by basic region leucine zipper transcription factors. J Cell Biochem 2005: 96: 10031020.
  • 62
    Schallreuter K U, Rokos H, Chavan B, Gillbro J M, Zothner C, Wood J M. Coenzyme Q10 and hydroquinone generated quinones contribute significantly to quinone mediated oxidative stress which can be reduced by 6-tetrahydrobiopterin and thioredoxin reductase. Free Radic Biol Med 2007: submitted.
  • 63
    Lunec J, Pieron C, Sherbet G V, Thody A J. Alpha-melanocyte-stimulating hormone immunoreactivity in melanoma cells. Pathobiology 1990: 58: 193197.
  • 64
    Schauer E, Trautinger F, Kock A et al. Proopiomelanocortin-derived peptides are synthesized and released by human keratinocytes. J Clin Invest 1994: 93: 22582262.
  • 65
    Chakraborty A, Slominski A, Ermak G, Hwang J, Pawelek J. Ultraviolet B and melanocyte-stimulating hormone (MSH) stimulate mRNA production for alpha MSH receptors and proopiomelanocortin-derived peptides in mouse melanoma cells and transformed keratinocytes. J Invest Dermatol 1995: 105: 655659.
  • 66
    Kippenberger S, Bernd A, Bereiter-Hahn J, Ramirez-Bosca A, Kaufmann R, Holzmann H. Transcription of melanogenesis enzymes in melanocytes: dependence upon culture conditions and co-cultivation with keratinocytes. Pigment Cell Res 1996: 9: 179184.
  • 67
    D’Orazio J A, Nobuhisa T, Cui R et al. Topical drug rescue strategy and skin protection based on the role of Mc1r in UV-induced tanning. Nature 2006: 443: 340344.
  • 68
    Bargonetti J, Friedman P N, Kern S E, Vogelstein B, Prives C. Wild-type but not mutant p53 immunopurified proteins bind to sequences adjacent to the SV40 origin of replication. Cell 1991: 65: 10831091.
  • 69
    El-Deiry W S, Kern S E, Pietenpol J A, Kinzler K W, Vogelstein B. Definition of a consensus binding site for p53. Nat Genet 1992: 1: 4549.
  • 70
    Vile G F. Active oxygen species mediate the solar ultraviolet radiation-dependent increase in the tumour suppressor protein p53 in human skin fibroblasts. FEBS Lett 1997: 412: 7074.
  • 71
    Xie Z, Chen D, Jiao D, Bystryn J C. Vitiligo antibodies are not directed to tyrosinase. Arch Dermatol 1999: 135: 417422.
  • 72
    Schallreuter K U, Kothari S, Hasse S et al. In situ and in vitro evidence for DCoH/HNF-1 alpha transcription of tyrosinase in human skin melanocytes. Biochem Biophys Res Commun 2003: 301: 610616.
  • 73
    Schallreuter K U, Wazir U, Kothari S, Gibbons N C, Moore J, Wood J M. Human phenylalanine hydroxylase is activated by H2O2: a novel mechanism for increasing the L-tyrosine supply for melanogenesis in melanocytes. Biochem Biophys Res Commun 2004: 322: 8892.
  • 74
    Thöny B, Auerbach G, Blau N. Tetrahydrobiopterin biosynthesis regeneration and functions. Biochem J 2000: 347: 116.
  • 75
    Schallreuter K U, Moore J, Wood J M et al. Epidermal H2O2 accumulation alters tetrahydrobiopterin (6BH4) recycling in vitiligo: identification of a general mechanism in regulation of all 6BH4-dependent processes? J Invest Dermatol 2001: 116: 167174.
  • 76
    Kothari S. A comparative study of clinically similar leukodermas using DCoH/HNF-1α expression as a marker for transcriptional analyses. PhD thesis. University of Bradford, UK 2005.
  • 77
    Yang G, Zhang G, Pittelkow M R, Ramoni M, Tsao H. Expression Profiling of UVB Response in Melanocytes Identifies a Set of p53-Target Genes. J Invest Dermatol 2006: 126: 24902506.
  • 78
    Atoyan R Y, Sharov A A, Eller M S, Sargsyan A, Botchkarev V A, Gilchrest B A. Oligonucleotide treatment increases eumelanogenesis, hair pigmentation and melanocortin-1 receptor expression in the hair follicle. Exp Dermatol 2007: 16: 671677.
  • 79
    Hussain S P, Harris C C. p53 biological network: at the crossroads of the cellular-stress response pathway and molecular carcinogenesis. J Nippon Med Sch 2006: 73: 5464.
  • 80
    Schallreuter K U, Körner C, Pittelkow M R, Swanson N N, Gardner M L. The induction of the alpha-1-adrenoceptor signal transduction system on human melanocytes. Exp Dermatol 1996: 5: 2023.
  • 81
    Wood J M, Gibbons N C, Schallreuter K U. Melanocortins in human melanocytes. Cell Mol Biol (Noisy-le-grand) 2006: 52: 7578.
  • 82
    Wakamatsu K, Graham A, Cook D, Thody A J. Characterisation of ACTH peptides in human skin and their activation of the melanocortin-1 receptor. Pigment Cell Res 1997: 10: 288297.
  • 83
    Schallreuter K U, Lemke K R, Pittelkow M R, Wood J M, Körner C, Malik R. Catecholamines in human keratinocyte differentiation. J Invest Dermatol 1995: 104: 953957.
  • 84
    Kaufmann A J, Lynham J A, Sanders L, Brown A M, Molenaar P. Contribution of differential efficacy to the pharmacology of human b1- and b2-adrenoceptors. In: RuffoloR R J, ed. Adrenoceptors: Structure, Function and Pharmacology. Luxembourg: Harwood Academic, 1995: 215222.
  • 85
    Howell B F, McCune S, Schaffer R. Lactate-to-pyruvate or pyruvate-to-lactate assay for lactate dehydrogenase: a re-examination. Clin Chem 1979: 25: 269272.
  • 86
    Hoogduijn M J, Cemeli E, Ross K, Anderson D, Thody A J, Wood J M. Melanin protects melanocytes and keratinocytes against H2O2-induced DNA strand breaks through its ability to bind Ca2+. Exp Cell Res 2004: 294: 6067.
  • 87
    Schallreuter K U. Vitiligo. In: HertlM, ed. Autoimmune Diseases of the Skin Pathogenesis, Diagnosis, Management. Wien: Springer, 2005: 367384.
  • 88
    Schallreuter K U, Rübsam K, Gibbons N C J et al. Methionine sulfoxide reductases A and B are deactivated by H2O2 in the epidermis of patients with vitiligo. J Invest Dermatol 2007: in press (Epub October 18 2007).
  • 89
    Yohn J J, Norris D A, Yrastorza D G et al. Disparate antioxidant enzyme activities in cultured human cutaneous fibroblasts, keratinocytes, and melanocytes. J Invest Dermatol 1991: 97: 405409.
  • 90
    Schallreuter K U. Oxidative stress in the human epidermis. G Ital Dermatol Venereol 2005: 140: 505514.
  • 91
    Spencer J D, Gibbons N C, Rokos H, Peters E M, Wood J M, Schallreuter K U. Oxidative stress via hydrogen peroxide affects proopiomelanocortin peptides directly in the epidermis of patients with vitiligo. J Invest Dermatol 2007: 127: 411420.
  • 92
    Gibbons N C, Wood J M, Rokos H, Schallreuter K U. Computer simulation of native epidermal enzyme structures in the presence and absence of hydrogen peroxide (H2O2): potential and pitfalls. J Invest Dermatol 2006: 126: 25762582.
  • 93
    Schweikardt T, Olivares C, Solano F, Jaenicke E, Garcia-Borron J C, Decker H. A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations. Pigment Cell Res 2007: 20: 394401.
  • 94
    Wood J M, Chavan B, Hafeez I, Schallreuter K U. Regulation of tyrosinase by tetrahydropteridines-What is real? A critical reanalysis of H. Wojtasek’s view Biochem Biophys Res Commun 2005: 331: 891893.
  • 95
    Schallreuter K U, Rübsam K, Chavan B et al. Functioning methionine sulfoxide reductases A and B are present in human epidermal melanocytes in the cytosol and in the nucleus. Biochem Biophys Res Commun 2006: 342: 145152.
  • 96
    Halaban R, Moellmann G. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity. Proc Natl Acad Sci U S A 1990: 87: 48094813.
  • 97
    Prota G. Melanins and Melanogenesis. San Diego: Academic Press, 1992.
  • 98
    Jimbow K, Chen H, Park J S, Thomas P D. Increased sensitivity of melanocytes to oxidative stress and abnormal expression of tyrosinase-related protein in vitiligo. Br J Dermatol 2001: 144: 5565.
  • 99
    Hagedoorn P L, Schmidt P P, Andersson K K, Hagen W R, Flatmark T, Martinez A. The effect of substrate, dihydrobiopterin, and dopamine on the EPR spectroscopic properties and the midpoint potential of the catalytic iron in recombinant human phenylalanine hydroxylase. J Biol Chem 2001: 276: 2285022856.
  • 100
    Del Rio M J, Velez-Pardo C. Monoamine neurotoxins-induced apoptosis in lymphocytes by a common oxidative stress mechanism: involvement of hydrogen peroxide (H(2)O(2)), caspase-3, and nuclear factor kappa-B (NF-kappaB), p53, c-Jun transcription factors. Biochem Pharmacol 2002: 63: 677688.
  • 101
    Grillo G, Licciulli F, Liuni S, Sbisa E, Pesole G. PatSearch: A program for the detection of patterns and structural motifs in nucleotide sequences. Nucleic Acids Res 2003: 31: 36083612.
  • 102
    Courtois G, Baumheuter S, Crabtree G R. Purified hepatocyte nuclear factor-1 interacts with a family of hepatocyte specific promoters. Proc Natl Acad Sci U S A 1988: 85: 79377941.
  • 103
    Tsatmali M, Yukitake J, Thody A J. ACTH1-17 is a more potent agonist at the human MC1 receptor than alpha-MSH. Cell Mol Biol (Noisy-le-grand) 1999: 45: 10291034.