SEARCH

SEARCH BY CITATION

Keywords:

  • ABCC-transporter;
  • dendritic cells;
  • macrophages;
  • monocytes;
  • SLCO-transporter

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Abstract:  Human macrophages (MΦ) express cytochrome P450 enzymes verifying their capacity to metabolize a variety of endogenous and exogenous substances. Here we analysed the mRNA and protein expression of transport proteins involved in the uptake or export of drugs, hormones and arachidonic acid metabolites in dendritic cells (DC) and MΦ compared to their precursors – blood monocytes – using cDNA microarray, RT-PCR, Western-blot and immunostaining techniques. The transport proteins studied included members of the solute carrier organic anion transporter family (SLCO) and the multidrug resistance associated proteins (MRP) 1–6 belonging to the ATP-binding cassette subfamily C (ABCC). We found that only mRNA for SLCO-2B1, -3A1, and -4A1 were present in monocytes, MΦ and DC. Most interestingly the expression of SLCO-2B1 was markedly enhanced in MΦ as compared to monocytes and DC. The presence of mRNA for ABCC1, 3, 4, 5 and 6 in all three cell types was demonstrated. On protein level ABCC1/MRP1 which has been identified as leukotriene C4 transporter was found to be the most abundant transporter in MΦ and DC. Blocking the ABCC1/MRP1 activity with the specific inhibitor MK571 resulted in a phenotypic change in DC but not in MΦ. Our data show that human blood monocytes and monocyte derived MΦ as well as DC express a specific profile of transporters involved in uptake and export of exogenous molecules like allergens or drugs, but also of endogenous substances in particular of inflammatory lipid mediators like leukotrienes and prostaglandins.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

The multidrug resistance related protein (MRP, gene name: ATP binding cassette C transporters, ABCC) family and the solute carrier organic anion transporting (SLCO) family function as efflux and influx transporters, respectively, of a variety of large organic anions or their conjugates in hepatic detoxification, drug distribution, renal clearance and drug resistance of tumor cells (1–5). Thus, these transport proteins are part of the metabolism and elimination of drugs, xenobiotics and certain endogenous molecules such as hormones.

Previously we showed that human macrophages (MΦ) express a specific pattern of cytochrome P450 (CYP) isoenzymes verifying their capacity to participate in the extrahepatic metabolism (6). In recent publications we could also demonstrate that epidermal keratinocytes and dermal fibroblasts express several transport associated proteins such as SLCO-2B1, -3A4 and -4A1 (7) as well as ABCC1 and ABCC3-7 (8,9) indicating a role of skin cells in active uptake and release of large organic molecules.

Influx transport polypeptides of the SLCO superfamily were first identified in rats as multispecific sodium-ion-independent transporter for various organic anions but also neutral compounds (10,11). In humans SLCO-1A2 was first cloned from liver and the gene designed as SLC21A3. Tamai and co-workers (12) discovered in 2000 three novel transporters SLCO-2B1, -3A4, and -4A1 and until now this protein family is expanding (2). Some of the SLCO transporters namely SLCO-1B1 are selectively expressed in liver, but most of the SLCOs are found in multiple tissue, however, with an organotropic profile. Functionally, the SLCOs represent polyspecific organic anion carriers with partially overlapping and partially distinct preferences for a wide range of amphipathic organic solutes including bile salts, steroid conjugates, numerous drugs and xenobiotics. Remarkably, virtually all of the SLCOs are able to transport either leukotrienes or prostaglandins or both. This property suggests an absorption mechanism for arachidonic acid metabolites different from that of the uptake by specific receptors.

The ATP binding cassette efflux transporters of the ABCC family are capable of transporting a structurally diverse array of endo- and xenobiotics and their metabolites across the cell membrane (3,5). The first ABC transporter to be identified was the 170 kDa P-glycoprotein, which is named multidrug resistance protein 1 (MDR1). Subsequently further transporter mediating multidrug resistance cDNAs were cloned and referred to as multidrug resistance associated protein (gene name ABCC1-6). Like the SLCO transporter ABCCs are widely expressed in the body except for ABCC2 which is mainly found at the bile canalicular membranes in liver. Abrogation of ABCC1 expression led not only to hypersensitivity against anticancer drugs but also to an impairment of the inflammatory response (13). This was attributed to a decreased LTC4 release. Thus ABCC1 appears to represent an important mechanism for LTC4 release. Moreover, it was found that ABCC1/MRP1 transporter activity is required for DC differentiation in an LTC4 independent manner (14). Meanwhile, it was shown that several members of the ABCC family are capable of transporting also prostaglandins (15).

Taken together, these observations strongly suggest that the different import and export proteins have an impact not only on drug metabolism but also on inflammation due to their ability to take up and to release inflammatory lipid mediators.

Macrophages and dendritic cells (DC) are important in the regulation of inflammation and as antigen presenting cells, in the initiation of the immune response (16–18). Little is known about the expression of influx and efflux transport proteins in these cells. This might be essential for the understanding of the metabolic capacity and the uptake and release of inflammatory lipid mediators. Therefore, we analysed the expression pattern of SLCO influx transport proteins and of ABCC efflux transporters, in human MΦ and DC in comparison to their progenitor cells, the blood monocytes.

Material and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Cells

Isolation of monocytes from human blood

Peripheral blood mononuclear cells (PBMC) were separated from purchased single donor buffy coats (Institut für Transfusionsmedizin, Universitätsklinikum Aachen, Germany) by density gradient centrifugation using Ficoll Paque (Pharmacia, Erlangen, Germany). Monocytes were isolated from PBMC either by plastic adherence or by a negative immuno-magneto-sorting procedure. Briefly, PBMC were incubated at a density of 2 × 106 cells/ml in RPMI 1640 containing 5% pooled human AB serum (Sigma, Steinheim, Germany) for 30 min on tissue culture dishes. During this period monocytes become adherent. They were washed three times with serum free medium to remove remaining lymphocytes. For negative sorting of lymphocytes PBMC were incubated at 4°C with M450-anti-CD19 and CD2 (Dynal Biotech, Hamburg, Germany) coated Dynal-Beads for 35 min. Bound lymphocytes were magnetically removed. Both methods resulted in a purity of monocytes of at least 95% as estimated by Giemsa staining of cytospin preparations.

Macrophages and dendritic cells cultures

To obtain MΦ, monocytes were cultured for 7 days in bacterial grade petri dishes in RPMI 1640 (Sigma, München, Germany) medium with 5% pooled human AB serum (Sigma, Steinheim, Germany).

For the generation of DC monocytes were cultured in six-well plates at a density of 1 × 106 cells/ml in 3 ml RMPI 1640 medium supplemented with 2% human serum in the presence of 1000 U/ml IL-4 and 1000 U/ml GM-CSF (R&D-Systems, Wiesbaden, Germany) for 7 days. Replacement of 1 ml cytokine containing medium every other day was done according to the protocol of Jonuleit et al. (19). Maturation of DC was induced by treating the cells with a cocktail of pro-inflammatory cytokines (IL-1-beta, IL-6, TNF-alpha, R&D Systems) together with PGE2 (Sigma) as described (16).

Blocking experiments were performed with DC and MΦ using the ABCC1 specific inhibitor MK571 [3-[[3-[2-(7-chloroquinolin-2-yl)vinyl]phenyl]-(2-dimethyl-carbamoylethylsulfanyl)methylsulfanyl] propionic acid] obtained from Alexis Biochemicals (Grünberg, Germany) at concentrations of 2.5 and 25 μm according to the protocol by van de Ven et al. (14). The protein antagonist was added to the cultures at days 0, 3 and 6.

Analysis of gene expression of transporter molecules

RNA isolation

Total RNA was extracted from cells of at least six different donors using the High Pure RNA Isolation Kit (Roche Diagnostics, Mannheim, Germany). RNA extraction was performed according to the manufacturer′s protocol. The RNA concentration of each sample was measured using the Nanodrop photometer (Nanodrop Technologies, Montchanin, DE, USA) and equal amounts of RNA were used for reverse transcription. Purified tRNA from human liver was used as control (Clontech, Palo Alto, CA, USA).

RT-PCR

Reverse transcription and PCR was performed using the GeneAmp RNA PCR kit (Perkin Elmer, Weiterstadt, Germany) according to the manufacturer′s instructions. Detection of specific mRNA for the SLCO and ABCC gene families was achieved by using primers (Table 1), bridging at least one intron to exclude signals caused by contamination of cDNA with genomic DNA. β-Actin was used as an internal standard as described before (8). After an initial denaturation step of 5 min at 99°C amplification was carried out with 35 cycles of 1 min denaturation at 94°C, 1 min annealing at 53°C and 1 min extension at 72°C. Amplification was terminated with an extension step of 10 min duration after the last cycle. No RT (Fig. S1) and no cDNA control experiments (Fig. S2) for all cell types and primer pairs have been performed. PCR products were separated on 1.8% agarose gels (1x TBE) and stained with ethidium bromide.

Table 1.   Primers used for RT-PCR analysis
 Sense primer locationAntisense primer locationPCR product
MRP1TGGGACTGGAATGTCACG 241–259AGGAATATGCCCCGACTTC 483–501261
MRP2CTGCCCTCTTCAGAATCTTAG 4072–4091CCCAAGTTGCAGGCTGGCC 4294–4312241
MRP3CAGTCAGCCGCTCACCTATC 3458–3477TCATCCAGTTCAGAGCAAAT 3747–3766309
MRP4CCATTGAAGATCTTCCTGG 12–30GGTGTTCAATCTGTGTGC 243–250239
MRP5GGATAACTTCTCAGTGGG 336–353GGAATGGCAATGCTCTAAAG 697–716381
MRP6CCATTGGGCTGTTTGCCTCC 3019–3038GGTTGACCTCCAGGAGTCC 3237–3255237
SLCO1A2AAGAAGAGGTCAAGAAGGAAAAAT 924–948GGAGCATCAAGGAACAGTCAGGTC 1561–1584661
SLCO2B1CGTGCGGCCAAGTGTGTTCCATAA 295–318ACAAGGATAGCCCCATAGCCAATC 530–553259
SLCO1B1TGTCATTGTCCTTTTACCTATTAT 1349–1372TGTAAGTTATTCCATTGTTTCCAC 1519–1543195
SLCO3A4CTCAAATCCTTCGCCTTCATCCTG 2090–2113AGGGTCAGAGTAGAGGCAAAGAAC 2194–2218129
SLCO4A1CACGGCGGGCACTCAGCATTTCCT 2283–2306CGATCGGGTATAAAACACATTCTA 2499–2522240
β-ActinACCCACACTGTGCCCATCTA 488–507CGGAACCGCTCATTGCC 761–777290

Gene expression profiling using DNA-array-technology

Custom-made gene-array (Memorec)

Total-RNA from monocytes, MΦ and DC of a single donor was extracted using the High Pure RNA Isolation Kit (Roche Diagnostics). RNA was quantified by using spectrophotometry (NanoDrop Technologies, Montchanin, DE, USA) and quality was checked via the 2100 Bioanalyzer system (Agilent Technologies, Palo Alto, CA, USA).

Linear amplification of total RNA, labelling and hybridization was done according to the manufacturer’s guidelines (20). Amplified RNA (aRNA) samples were quantified by spectrophotometry and quality was checked by capillary electrophoresis (Bioanalyser 2001, Agilent). Two micrograms of aRNA from each probe were labelled by reverse transcription with Cy5 and Cy3 fluorescent nucleotides, respectively, and subjected to Customized PIQOR™Microarrays (Memorec Biotec GmbH, Cologne, Germany). Customized PIQOR™Microarrays (Memorec Biotec GmbH) consisted of 258 spotted in quadroduplicates cDNAs (200–400 bp) including ten positive controls (six housekeeping genes and four in vitro transcripts of E. coli DNA fragments) and two negative controls (herring-sperm-DNA and buffer). Processing of microarrays was performed using a fully automated hybridization station according to manufacturer’s guidelines (a-Hyb, Memorec). Image capture and signal quantification of hybridized PIQOR™ cDNA arrays were done with the ScanArray Lite (Packard BioScience, Billerica, MA, USA) and ImaGene software version 4.1 (BioDiscovery, Los Angeles, CA, USA).

Human Genome U133 A 2.0 Array (Affymetrix)

Experimental procedures for the Human Genome U133A 2.0 Arrays were performed according to the Affymetrix GeneChip® Expression Analysis Technical Manual (Affymetrix, Santa Clara, CA, USA). Briefly, total RNA (each 750 ng) was reverse transcribed into double-stranded cDNA using HPLC-purified T7-(dt) 24 primers and the GeneChip® Expression 3′ Amplification one-Cycle Target Labeling and Control Reagents-Kit (Affymetrix, Santa Clara, CA, USA). Subsequently, the purified double-stranded cDNA was used as template to synthesize biotinylated complementary RNA probes. Hybridization to the Affymetrix Human Genome U133 A 2.0 Array, containing 22283 probesets representing approximately 14 500 well-characterized human genes, was performed for 16 h at 45°C and 60 rpm. After washing and staining the probe array according to the program EukGE-WS2v5 using the Fluidics Station 450 the probe arrays were scanned using the GeneChip® Scanner 3000 (Affymetrix).

The microarray expression analysis was carried out using Bioconductor (21) packages under R1. Background correction and normalization were done with the GCRM algorithm A. MAS 5.0 (Affymetrix) was used for detection the calls.

Phenotypic analysis of macrophages and dendritic cells

The DC- phenotype was controlled (Fig. S3) by staining the cells with fluorescence labelled anti-CD1a-, CD14-, CD80-, -CD83 and -CD86 and HLA-DR antibodies (Dianova, Hamburg, Germany) using FACS analysis (see below). Moreover, the mRNA expression of the corresponding proteins was detected by microarray analysis (Memorec, see additional data). The phenotype of MΦ was also detected by FACS-analysis using the function associated antibodies against CD163 and MRP8/14 (27E10) (Dianova) (22,23) and anti HLA-DR antibody.

Flow cytometry and antibodies

After cultivation of DC or MΦ, cells were harvested and subsequently incubated for 30 min at 4°C with the antibodies diluted in PBS containing 0.1% bovine serum albumine. The cells were washed three times with PBS and fixed with 1% paraformaldehyde.

Monoclonal antibodies used for cell surface marker staining included anti-human CD163 (clone 5C6-FAT), anti-human MRP8/14 (clone 27E10, both BMA Biomedicals AG, Augst, Switzerland), anti-human CD1a (BD Pharmingen, Heidelberg, Germany), all of them fluorescein isothiocyanate (FITC)-conjugated, and R-Phycoerythrin (PE)-conjugated anti-human HLA-DR (clone HL-39, Immunotools GmbH, Friesoythe, Germany). Flow cytometry analysis was performed using the FACS Calibur and CELL Quest Pro software (Becton Dickinson, Heidelberg, Germany).

Immunocytological analysis of ABCC expression in macrophages

Cytospin preparations of MΦ (0.1 × 106 cells) were stained with monoclonal antibodies against MRP/ABCC 1, 2–6 from Kamiya Biomedical Company (Seattle, WA, USA) in an indirect immunoperoxidase technique using gamma-aminoethylcarbazole as substrate and counterstaining with haematoxylin (25).

Western-blot detection of transporter protein expression in antigen presenting cells

Cells were lysed using an MSE Soniprep150 sonicator and lysate samples were denatured by suspensions in Laemmli sample buffer containing 5% mercaptoethanol. Equal amounts of protein (50 μg/lane) were separated by 7.5% SDS-PAGE and transferred onto a PVDF membrane using the semidry Western blotting method. Binding of the ABCC1/MRP-1 antibody was visualized using the ECL detection system from Amersham Pharmacia Biotech (Braunschweig, Germany) and β-actin was applied as loading control.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Gene expression analysis of transport proteins

Messenger RNA expression of ABCC and SLCO transporters was studied by RT-PCR in monocytes, monocyte derived MΦ and monocyte derived mature DC from six individual blood donors and adult liver tissue. Representative results of RT-PCR-studies from two donors are displayed in Fig. 1. mRNA expression for efflux transport proteins ABCC1, 3, 4, 5 and 6 was detectable in monocytes, MΦ and DC. No major differences in expression patterns could be detected within all donors or the three different cell types studied (Fig. 1a). As already reported for MΦ (26) the liver specific transporter ABCC2 was not expressed in the cells (data not shown). With respect to influx transporter of the SLCO family we found that mRNA for SLCO-2B1, -3A1 and -4A1 was expressed in all cell types analysed but expression of SLCO-2B1 was significantly lower or even absent in monocytes compared to DC and particularly to MΦ (Fig.1b). SLCO-1A2 and SLCO-1B1 were not present in any of the probes analysed, but were detected in adult liver tissue. No RT (Fig. S1) and no cDNA (Fig. S2) control RT-PCR experiments revealed no false positive results.

image

Figure 1.  RT-PCR analysis of mRNA expression for transport proteins in monocytes (Mo), macrophages (MΦ) and dendritic cells (DC) of two donors. (a) ABCC efflux transport proteins. (b) SLCO influx proteins. β-Actin expression was used as internal standard. Purified tRNA from human liver (Liv) was used positive control for SLCO1A2 and SLCO1B1 detection.

Download figure to PowerPoint

Real time PCR data was confirmed by oligonucleotide (Table 2a) or cDNA (Table 2b) microarray analysis. Human Genome U133A 2.0 Array studies of MΦ from two blood donors revealed a strong signal for mRNAs of export transporter ABCC1 and ABCC3 (Table 2a). With respect to the influx transport proteins we found SLCO-2B1 and SLCO-4A1 to be significantly expressed in MΦ. Other transporters studied were found to be absent or expressed in one donor only (Table 2a).

Table 2.   Microarray analysis of transport protein expression in antigen presenting cells. (a) Oligonucleotide microarray (Affymetrix Human Genome U133A 2.0) detection of transport proteins specific mRNAs in macrophages of two donors. (b) cDNA microarray analysis of differential expressed genes in dendritic cells (DC) and macrophages (MΦ) compared to monocytes (Mo) of a single donor
 Donor 1Donor 2
  1. 1Numbers indicate signal intensity, a = absent, below the detection level.

  2. 2Values are given in fold increase or decrease (−),

  3. a = absent, below the detection level.

(a)1
ABCC114371154
ABCC2aa
ABCC36741077
ABCC4114a
ABCC5515a
ABCC665165
SLCO1A2aa
SLCO2B1869592
SLCO1B1aa
SLCO3A4143a
SLCO4A1330303
SLCO1C1aa
 DC/MΦMΦ/Mo
(b)2
ABCC1−1.31.1
ABCC2aa
ABCC3−4.01.6
ABCC42.01.1
ABCC51.91.3
ABCC6aa
SLCO1A2aa
SLCO2B1a16
SLCO1B1aa
SLCO3A1a−2.3
SLCO4A1aa

Expression of influx and efflux transport proteins was further studied using custom made cDNA microarrays to compare expression levels within the different antigen presenting cells. As shown in Table 2b, the transporter SLCO-2B1, ABCC1 and ABCC3-5 which were found to be present in the oligonucleotide array analysis could also be detected using the cDNA microarray. Additionally SLCO-3A1 was found to be expressed by monocytes. Most interestingly, MΦ revealed 16fold higher mRNA expression of SLCO-2B1 than monocytes. This is in agreement with the results obtained by RT-PCR (Fig.1b). mRNA expression levels for ABCC transport proteins analysed do not significantly vary between the different cell types (Table 2b).

Expression of the ABCC transporter on protein level

Specific monoclonal antibodies are only available for the detection of transport proteins of the ABCC family but not for members of the SLCO family. For single cell detection we employed immunostaining (four donors, Fig. 2a) and for their quantification western blot analysis (two additional donors, Fig. 2b). Our results confirmed the recently published data by van de Ven et al. (14) that ABCC1/MRP-1 is present on the protein level in DC. In addition we were able to demonstrate that this transporter is also expressed in MΦ at similar levels compared to DC (Fig. 2b).

image

Figure 2.  Detection of ABCC/MRP efflux transport proteins in antigen presenting cells. (a) Expression of efflux transport proteins in macrophages. Cytospin preparations were stained with monoclonal antibodies against the indicated ABCC/MRP molecules using indirect immunoperoxidase technique with gamma-aminoethylcarbazole as substrate (redbrown). Positive cells are additionally indicated by arrows. (b) Western blot for ABCC1/MRP-1 expression in macrophages and DC of two donors. 50 μg of protein was loaded for each sample.

Download figure to PowerPoint

The ABBC3-6/MRP3-6 molecules were not detected using western blot (data not shown). Staining of single cells using cytospin preparations revealed that monocytes were negative for all investigated transport molecules (data not shown). Positive staining of DC and MΦ were observed only in two of four donors for ABCC3/MRP3 and ABCC5/MRP5 while ABCC1/MRP1 positive cells were found in all donors. A typical staining profile of MΦ is given in Fig. 2a. Notably, the staining was not homogenous and not all cells were positive. There was no obvious difference between MΦ and DC. On the protein level ABCC1/MRP-1 clearly represents the most prominent efflux transport molecule in MΦ and DC. ABCC3/MRP-3 and ABCC5/MRP-5 protein expression appears to be low and variable and ABCC4/MRP-4 and ABCC6/MRP-6 expression is not detectable using currently available specific antibodies.

Effect of ABCC1/MRP-1 inhibition on cell differentiation

Because it was demonstrated that blocking of ABCC1/MRP-1 activity inhibits DC maturation by reducing the expression of DC differentiation associated surface markers, we asked whether this is also the case in MΦ differentiation. To study this MΦ and DC were treated with ABCC1/MRP-1 specific antagonist MK571. The DC- phenotype was controlled by measuring CD1a, CD14, CD80, CD83 and CD86 and HLA-DR expression (Fig. S3) and the efficiency of the ABCC1/MRP-1 inhibition was controlled by measuring CD1a expression of DC using FACS analysis. As expected MK571 treatment reduced the number of CD1a expressing DCs from 16.7 ±7.5 to 6.7± 2.9 at a concentration of 25 μM (data not shown).

To evaluate the influence of ABCC1/MRP-1 blockade on MΦ differentiation or activation we investigated the expression of the MΦ specific antigens CD163 and MRP8/14 (27E10). Macrophages bearing the CD163 (RM3/1) antigen represents an alternatively activated subpopulation with anti-inflammatory properties (22). By contrast MRP8/14 (27E10) positive cells represent classically activated pro-inflammatory MΦ (23) which are only present in acute inflammatory reactions. The results of six independent experiments revealed that ABCC1/MRP-1 inhibition has no effect on these specific antigens (Fig. 3, Table 3). Furthermore, HLA-DR expression as a marker for antigen presentation or the differentiation 25F9 antigen (25) were also not affected by ABCC1/MRP-1 blockade (data not shown).

image

Figure 3.  FACS analysis of untagged (dashed line) macrophages (MΦ) as control and MΦ cultured in the absence (grey line) or presence (black line) of the ABCC1/MRP-1 blocker MK571 (25 μM). y-axis indicates cell number, x-axis fluorescence intensity on a log scale of CD163 and MRP8/14 (27E10).

Download figure to PowerPoint

Table 3.   Effect of the ABCC1/MRP-1 specific inhibitor MK571 on the expression of the function associated macrophage molecules CD163 and MRP8/14 (27E10) as measured by FACS
MK571% CD163+ cells% 27E10+ cells
  1. Mean ± SD, n = 4.

028.3 ± 17.637.2 ± 7.8
2.5 μM26.9 ± 13.737.4 ± 7.3
25 μM25.0 ± 12.537.3 ± 5.5

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

In order to define the molecular events that mediate DC migration into afferent lymphatic vessels, Randolph et al. (27) identified a role for the lipid transporter multidrug resistance protein 1 (MDR-1). Blocking transport activity of MDR-1 prevented the DC from migrating out of the epidermis of human skin explants. Recently, it was reported that an additional multidrug resistance family member, ABCC1, is also expressed by DC and is necessary for their entrance into afferent lymphatic vessels (24). DC mobilization from the epidermis and trafficking into lymphatic vessels is greatly reduced in ABCC1−/− mice, but migration is restored by exogenous cysteinyl leukotrienes LTC4 or LTD4. Therefore ABCC-1 regulates DC migration to lymph nodes, apparently by transporting LTC4, which in turn promotes chemotaxis to CCL19 and mobilization of DC from the epidermis. Moreover, ABCC1 appears to play an important role in DC differentiation because blocking of ABCC1 transport activity (14) reduced maturation associated membrane molecules, in particular CD1a. Our experiments using DC and the ABCC1/MRP-1 inhibitor MK571 support this assumption.

Recent studies gave further evidence that influx transporters such as SLCOs and efflux transporters are involved in active transmembrane transport of leukotrienes and prostaglandins (29,30). Therefore, it seems important to characterize the expression pattern of these transport proteins in antigen presenting cells. The study presented here revealed that several efflux transport proteins of the ABCC family – except for ABCC2 – were detectable on the mRNA level in all antigen presenting cells without any significant differences (Fig. 1). The fourfold decrease in DC of ABCC3 expression detected by cDNA microarray (Table 2b) was not observed in any RT-PCR experiments and may not be representative. In contrast, at protein level ABCC1/MRP-1 appeared to be the most abundant protein in MΦ and DC (Fig. 2). This is in agreement with previous work indicating that ABCC1 is expressed in many tissues MΦ such as the alveolar MΦ of the lung (31). However, unlike its function as a promoter of DC differentiation, ABCC1 appears not to be directly involved in the differentiation or in activation of MΦ since the expression of important markers, e.g. 25F9, MRP8/14 (27E10) and CD163 is not affected by inhibiting the ABCC1 activity (Fig. 3). 25F9 antigen is reported to appear during in vitro maturation of monocytes into MΦ (25). In contrast the expression of the MRP8/14 (27E10) is decreased during differentiation, but increased in inflammation and migration through endothelial cells thus thought to be associated with early inflammatory processes and the classical activation of MΦ (20,20a). Moreover, the MΦ specific CD163 receptor is associated with anti-inflammatory properties and the alternative activation of MΦ (22,32,33). Probably the function of ABCC1 in MΦ is restricted to cell migration and release of inflammatory mediators as shown in a mice model of peritonitis (34) rather than in MΦ maturation or activation.

With respect to skin (6), our data give evidence that antigen presenting cells are the main source for ABCC1. The functions of ABCC1 in keratinocytes and antigen presenting cells may differ. In the epidermis ABCC1 may protect the skin from invading xenobiotics (35) whereas in the immune cells of the dermis ABCC1 might serve as leukotriene efflux pump in particular of LTC4. ABCC2 which has also been described to be capable of LTC4 transport is not expressed in these cell types (29).

In addition to leukotriene transport, ABCC1 expressed in MDCK cell monolayers has been shown to extrude glutathione conjugates of PGA1 (30). Furthermore, in inside-out membrane vesicles derived from insect cells or HEK293 cells, ABCC4 catalysed the time- and ATP-dependent uptake of prostaglandin E1 (PGE1) and PGE2 (15). These transporters have been show to be constitutively expressed on the mRNA level in the studied cell types (Fig. 1a).

With respect to the import transport molecules of the SLCO family, SLCO-2B1 was found to be the most abundant transporter in MΦ at mRNA level, while the SLCO-3A4 and SLCO4A1 showed no significant differences in expression in the three cell types investigated (Fig. 2b, Table 2). Most interestingly, MΦ revealed higher mRNA expression of SLCO-2B1 than monocytes (Fig. 1a and Table 2b) suggesting that this transport polypeptide is involved in MΦ maturation or activation. Moreover, a recent study of our group showed that a micro-structured surface – reflecting a physical stimulus – but not LPS treatment induces a more than sixfold increase in SLCO-1B1 mRNA expression pointing to a role in specific types of inflammation (Paul N.E. et al., unpublished data).

Several members of this protein family such as SLCO-1A2, -1B1, -3A4 and –4A1 have exhibited tracer PGE2 transport when expressed in Xenopus oocytes (1). SLCO-2B1 does not directly mediate prostaglandin transport but PGA1 and PGA2 have been shown to stimulate SLCO-2B1 dependent uptake of estrone-3-sulphate (36). Transport activity for LTC4 and LTE4 has been shown for human SLCO-1B1 but this transporter was not detected in the analysed cell types (Fig. 1b).

Even though the substrate specificity of the different transport proteins is only partially known, our findings give evidence for the participation of antigen presenting cells in the metabolism of drugs and most probably also of certain allergens. More work has to be done to understand how influx and efflux transporters work together in these cells to move substrates like leukotrienes and prostaglandins toward, or away from, their cognate receptors.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

This work was supported by the Interdisciplinary Centre of Clinical Research IZKF BIOMAT (University Hospital RWTH Aachen) and by a grant from the European Commission as part of the Integrated project ‘Novel Testing Strategies for In Vitro Assessment of Allergens (Sens-it-iv) LSHB-CT-2005-018681’.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • 1
    Hagenbuch B, Meier P J. The superfamily of organic anion transporting polypeptides. Biochim Biophys Acta 2003: 1609: 118.
  • 2
    Hagenbuch B, Meier P J. Organic anion transporting polypeptides of the SLCO/SLC21 family: phylogenetik classification as SLCO/SLCO superfamily, new nomenclature and molecular/functional properties. Eur J Physiol 2004: 447: 653665.
  • 3
    Haimeur A, Conseil G, Deeley R G, Cole S P C. The ABCC-related and BCRP/ABCG multidrug resistance proteins: biology, substrate specificity and regulation. Curr Drug Metabol 2004: 5: 2153.
  • 4
    Higgins F. Multiple molecular mechanisms for multidrug resistance transporters. Nature 2007: 446: 749757.
  • 5
    König J, Seithel A, Gradhand U, Fromm M F. Pharmacogenetics of human OATP transporters. Naunym Schmiedebergs Arch Pharmacol 2006: 372: 432443.
  • 6
    Baron J M, Schiffer R, Bostanci Ö, Merk H F, Zwadlo-Klarwasser G. Differential expression of transporter proteins involved in drug export in human macrophages as compared to liver cells. Allergy Clin Immunol Int 2004: 1: 9192.
  • 7
    Schiffer R, Neis M, Holler D, et al. Active influx transport is mediated by members of the organic anion transporting family in human epidermal keratinocytes. J Invest Dermatol 2003: 120: 285291.
  • 8
    Baron J M, Höller D, Schiffer R, et al. Expression of multiple cytochrome P450 enzymes and MDR-associated transport proteins in human skin keratinocytes. J Invest Dermatol 2001: 116: 541548.
  • 9
    Dreuw A, Hermanns H M, Heise R, et al. Interleukin-6-type cytokines upregulate expression of multidrug resistance-associated proteins in NHEK and dermal fibroblasts. J Invest Dermatol 2005: 124: 2837.
  • 10
    Jacquemin E, Hagenbuch B, Stieger B, Wolkoff A W, Meier P J. Expression cloning of a rat liver Na (+)-independent organic anionic transporter. Proc Natl Acad Sci USA 1994: 91: 133137.
  • 11
    Mikkaichi T, Suzuki T, Tanemoto M, Ito S, Abe T. The organic anion transporter family. Drug Metab Pharmacokin 2004: 19: 171179.
  • 12
    Tamai I, Nezu J, Uchino H, et al. Molecular identification and characterization of novel members of the human organic anion transporter family. Biochem Biophys Res Com 2000: 273: 251260.
  • 13
    Wijnholds J, Evers R, Van Leusden M R, et al. Increased sensitivitiy to anticancer drugs and decreased inflammatory response in mice lacking the multidrug resistance-associated protein. Nature Med 1997: 3: 12751279.
  • 14
    Van De Ven R, De Jong M C, Reurs A W, et al. Dendritic cells require multidrug restistance protein 1 (ABCC1) transporter activity for differentiation. J Immunol 2006: 176: 51915198.
  • 15
    Reid G, Wielinga P, Zelcer N, et al. The human multidrug resistance protein ABCC4 functions as a prostaglandin efflux transporter and is inhibited by nonsteroidal anti-inflammatory drugs. Proc Natl Acad Sci 2003: 100: 92449249.
  • 16
    Jacobs J J, Lehé C L, Hasegawa H, Elliott G R, Das P K. Skin irritants and contact sensitizers induce Langerhans cell migration and maturation at irritant concentration. Exp Dermatol 2006: 15: 432440.
  • 17
    Lehé C L, Jacobs J J, Hua C M, Courtellemont P, Elliott G R, Das P K. Subtoxic concentrations of allergenic haptens induce LC migration and maturation in a human organotypic skin explant culture model: a novel method for identifying potential contact allergens. Exp Dermatol 2006: 15: 421431.
  • 18
    Schröder J M, Reich K, Kabashima K, et al. Who is really in control of skin immunity under physiological circumstances – lymphocytes, dendritic cells or keratinocytes? Exp Dermatol 2006: 15: 913929.
  • 19
    Jonuleit H, Kuhn U, Müller G, et al. Pro-inflammatory cytokines and prostaglandins induce maturation of potent immunostimulatory dendritic cells under fetal calf serum-free conditions. Eur J Immunol 1997: 27: 31353142.
  • 20
    Bosio A, Knörr C, Janssen U, Gebel S, Haussmann H-J, Müller T. Kinetics of gene expression profiling in Swiss 3T3 cells exposed to aqueous extracts of cigarette smoke. Carcinogenesis 2002: 23: 741748.
  • 21
    Gentleman R C, Carey V J, Bates D M, et al. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 2004: 5: R80.
  • 22
    Zwadlo G, Schlegel R, Sorg C. A monoclonal antibody to a subset of human monocytes found only in the peripheral blood and inflammatory tissues. J Immunol 1986: 137: 512519.
  • 23
    Zwadlo G, Voegeli R, Schulze-Osthoff K, Sorg C. A monoclonal antibody to a novel differentiation antigen on human macrophages associated with the down-regulatory phase of the inflammatory process. Exp Cell Biol 1987: 55: 295304.
  • 24
    Eue I, Pietz B, Storck J, Klempt M, Sorg C. Transendothelial migration of 27E10+ monocytes. Int Immunol 2000: 12: 15931604.
  • 25
    Zwadlo G, Bröcker E B, Von Bassewitz D B, Feige U, Sorg C. A monoclonal antibody to a differentiation antigen present on mature human macrophages and absent from monocytes. J Immunol 1985: 134: 14871492.
  • 26
    Baron J M, Zwadlo-Klarwasser G, Jugert F, et al. Cytochrome P450 1B1: a major P450 isoenzyme in human blood monocytes and macrophage subsets. Biochem Pharmacol 1998: 56: 11051110.
  • 27
    Randolph G J, Beaulieu S, Pope M, et al. A physiologic function for p-glycoprotein (MDR-1) during the migration of dendritic cells from skin via afferent lymphatic vessels. Proc Natl Acad Sci U S 1995: 95: 69246929.
  • 28
    Robbiani D F, Finch R A, Jager D, Muller W A, Sartorelli A C, Randolph G J. The leukotriene C(4) transporter ABCC1 regulates CCL19 (MIP-3beta, ELC)-dependent mobilization of dendritic cells to lymph nodes. Cell 2000: 103: 757768.
  • 29
    Jedlitschky G, Keppler D. Transport of leukotriene C4 and structurally related conjugates. Vitam Horm 2002: 64: 153184.
  • 30
    Schuster V L. Prostaglandin transport. Prostaglandins Other Lipid Mediat 2002: 69: 633647.
  • 31
    Flens M J, Zamann G J, Van Der Valk P, et al. Tissue distribution of the multidrug resistance protein. Am J Pathol 1996: 148: 12371247.
  • 32
    Hamann W, Floter A, Schmutzler W, Zwadlo-Klarwasser G. Characterization of a novel anti-inflammatory factor produced by RM3/1 macrophages derived from glucocorticoid treated human monocytes. Inflamm Res 1995: 44: 535540.
  • 33
    Moestrup S K, Moller H J. CD163: a regulated haemoglobin scavenger receptor with a role in the anti-inflammatory response. Ann Med 2004: 36: 347354.
  • 34
    Leite D F P, Echevarria-Lima J, Cardoso Ferriera S, Calixto J B, Rumjanek V M. ABCC transporter inhibition reduces zymosan-induced peritonitis. J Leukoc Biol 2007: 82: 630637.
  • 35
    Li Q, Kato Y, Imai T, Tsuji A. Multidrug resistance-associated protein 1 functions as an efflux pump of xenobiotics in the skin. Pharm Res 2005: 22: 842846.
  • 36
    Pizzagalli F, Varga Z, Huber R D, Folkers G, Meier P J, St-Pierre M V. Identification of steroid sulphate transport processes in the human mammary gland. J Clin Endocrin Metabol 2003: 88: 39023912.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Figure S1. RT-PCR analysis (no RT control) of mRNA expression for transporters in monocytes (Mo), macrophages (MΦ) and dendritc cells (DC). (a) ABCC efflux transport molecules. (b) SLCO influx polypeptides. ST: DNA Molecular Weight Marker XIV (Roche Applied Science).

Figure S2. RT-PCR analysis (no cDNA control) of mRNA expression for (a) ABCC efflux transport molecules. (b) SLCO influx polypeptides. ST: DNA Molecular Weight Marker XIV (Roche Applied Science).

Figure S3. DC- phenotype was analyzed by measuring expression of CD1a, CD14, CD80, CD83 CD86 and HLA-DR via flow cytometry. Grey lines displayed untagged and black lines stained DC. y-axis indicates cell number, x-axis fluorescence intensity on a log scale.

Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
EXD_745_sm_figss1-s3.ppt599KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.