SEARCH

SEARCH BY CITATION

Keywords:

  • Arabidopsis;
  • confocal;
  • Golgi;
  • green fluorescent protein;
  • mRFP1;
  • Nicotiana;
  • reticulum;
  • secretion;
  • translocation;
  • yellow fluorescent protein

Abstract

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

Fluorescent protein markers are widely used to report plant membrane traffic; however, effective protocols to quantify fluorescence or marker expression are lacking. Here the 20 residue self-cleaving 2A peptide from Foot and Mouth Disease Virus was used to construct polyproteins that expressed a trafficked marker in fixed stoichiometry with a reference protein in a different cellular compartment. Various pairs of compartments were simultaneously targeted. Together with a bespoke image analysis tool, these constructs allowed biosynthetic membrane traffic to be assayed with markedly improved sensitivity, dynamic range and statistical significance using protocols compatible with the common plant transfection and transgenic systems. As marker and effector expression could be monitored in populations or individual cells, saturation phenomena could be avoided and stochastic or epigenetic influences could be controlled. Surprisingly, mutational analysis of the ratiometric assay constructs revealed that the 2A peptide was dispensable for efficient cleavage of polyproteins carrying a single internal signal peptide, whereas the signal peptide was essential. In contrast, a construct bearing two signal peptide/anchors required 2A for efficient separation and stability, but 2A caused the amino-terminal moiety of such fusions to be mis-sorted to the vacuole. A model to account for the behaviour of 2A in these and other studies in plants is proposed.

In recent years, studies of membrane traffic and endomembrane organization in plant cells have made increasing use of fluorescent proteins to visualize endomembrane organelles (1–5). Green fluorescent protein (GFP) has also been used to assay biosynthetic traffic to the apoplast or vacuole in plants (3,6–19). As GFP fails to accumulate in a fluorescent form in either destination owing to low pH and proteolysis (3,6,7,17,18), perturbation of anterograde traffic is readily visualized by the accumulation of fluorescence in upstream compartments such as endoplasmic reticulum (ER), Golgi apparatus or prevacuolar compartments (PVC). This strategy is effective in transformed mutant Arabidopsis seedlings (5,16) but has been used most frequently in transient expression, either in protoplasts or transfected leaf epidermis, to investigate the effect of genetically dominant derivatives of putative membrane trafficking proteins (3,6,12,13–15,19). Despite its popularity, there are still significant limitations to the use of these markers, particularly in quantitative studies.

To provide reliable data in such assays, it is important to keep transfection rates sufficiently low to prevent perturbation or saturation of trafficking process (3,6,9,10,18,20). However, the stochastic nature of the transfection process inevitably leads to wide cell-to-cell variation in marker expression. This significantly complicates sampling strategies and the interpretation of observations. Problems become acute if high-magnification imaging is required to visualize changes in marker distribution or organelle morphology. They are exacerbated further when the protein under investigation cannot be visibly tagged or when transfection rates are low. In these circumstances, analyses often rely on subjective scoring of individual transfected cells in the population (3,6,12–14).

Besides morphological information, the accumulation of GFP reporters in fluorescent form in upstream compartments potentially provides quantitative data about perturbation of trafficking processes (1,3). The fluorescence of a secreted GFP marker (secGFP) can be quantified from low-magnification confocal images of transfected tobacco leaf epidermis (1,3) and has been used to estimate the effect of dominant inhibitory Rab GTPases on biosynthetic membrane traffic (3). However, the stochasticity of transient expression in individual fields of view coupled with variable sampling of 3D space limits the ability of this approach to resolve differences in marker accumulation between treatments. Sampling errors are exacerbated at higher magnification and are compounded in vacuolated plant cells by the 3D organization of the cytoplasm into a thin, curved cortical layer connected by dynamic transvacuolar strands (1). Similar considerations significantly complicate the acquisition of quantitative fluorescence data from complex non-planar organs such as the roots of transgenic plants or from lower efficiency transient expression systems such as the commonly used Arabidopsis protoplast transfection systems (13–15,19).

A solution to these limitations is to infer the expression efficiency of the trafficked marker by providing a stoichiometric baseline-reference that can be measured simultaneously in either transfected protoplasts, single cells or whole tissues over a broad range of magnifications. This approach corrects for variability in marker expression and imaging efficiency while providing a means to normalize between experiments in an analogous manner to ratio imaging techniques used, for example, for physiological ion measurements (1). Here we evaluate various strategies to achieve stoichiometric co-expression of appropriate trafficked and reference fluorescent protein markers.

One strategy exploits the 2A peptide from Foot and Mouth Disease Virus (FMDV) to generate ‘self-cleaving’ polyproteins (21). The FMDV 2A peptide (hereafter referred to simply as 2A) is a 20 amino acid peptide that promotes separation of the 2A and 2B viral translation products from a polyprotein. The peptide retains its activity when translocated into other polypeptide contexts (21–26). Current models suggest that 2A acts as an esterase within the ribosome to hydrolyze the link between the nascent polypeptide and the t-RNA in the ribosome P-site prior to formation of the terminal Gly-Pro bond of the 2A sequence (21). Translation can continue after hydrolysis, so sequences upstream and downstream of 2A thus emerge as distinct polypeptides in a fixed stoichiometry (21–26). Previous studies have shown that 2A can be used to generate polyproteins in plants (22–26) and have suggested that differential targeting of cleavage products to endomembrane and cytosolic compartments may be possible (27–30).

Here we show that ratiometric trafficking markers based on the 2A peptide can target proteins to distinct cellular compartments to provide versatile and accurate quantitative trafficking assays in plants. Surprisingly, however, we found that the 2A sequence was required only when both halves of the fusion were translocated across the ER and that in these cases, 2A caused the upstream moiety to be sorted to the vacuole. Furthermore, in contrast to expectations from the literature, we show that the 2A sequence in a range of different fluorescent protein fusions does not efficiently promote disruption of the polypeptide backbone during translation on plant ribosomes. We propose an alternative model to account for the role of 2A in promoting the translocation of two separate polypeptides across the ER membrane during translation of a single open reading frame (ORF). We suggest how previous observations can be reconciled with these findings and discuss their implications for the use of 2A technology in plant cells.

Results

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

Strategies for quantitative transient co-expression of independent markers

We evaluated three strategies to achieve stoichiometric co-expression of two fluorescent proteins. Constructs were expressed using the high-efficiency Agrobacterium-mediated transfection of tobacco leaf abaxial epidermal cells (3,31), which has been used widely in plant membrane trafficking studies with fluorescent protein reporters (3,6–9,11,12). Furthermore, we have previously used this method to establish quantitative imaging protocols for assaying membrane traffic as reported by a secGFP marker (3). In the first approach, leaves were co-inoculated with separate GFP-HDEL and yellow-fluorescent-protein-(YFP)-HDEL strains (Figure 1A and B), which target each fluorescent protein to the ER. However, individual epidermal cells expressed each marker independently, such that the fluorescence intensity of one marker in an individual cell did not predict the expression efficiency of the other (Figure 2A and B). This was confirmed by the low correlation observed in scatter plots of pixel intensities for the GFP and YFP channels (Figure 2C). Thus co-inoculation is not a generally applicable strategy for ratiometry.

image

Figure 1. Schematic representation of constructs. (A–S) The components of each construct described in this paper are named and illustrated according to the following scheme: G or GFP, green fluorescent protein (mGFP5); Y or YFP, yellow fluorescent protein; R or RFP, red fluorescent protein (mRFP1); sp, signal peptide; sec, secreted form of a fluorescent protein; H or HDEL, presence of an ER retrieval signal in addition to signal peptide; nls, nuclear localization signal; ST, Golgi-targeting signal from rat sialyl transferase; N, engineered N-glycosylation site (6); Rab, Arabidopsis Rab GTPase AtRAB-D2a either wild type or mutant forms; m or myc, c-myc epitope tag; nomyc, c-myc epitope tag is missing; f or flag, FLAG epitope tag; 2A, FMDV 2A peptide; 2A*, mutant form of the 2A peptide in which the two terminal residues [G and P, underlined in (T)] were each converted to alanine. (T) Amino acid and nucleotide sequence of the 2A peptide and upstream flanking sequence used in this study, taken from the constructs described by Halpin et al. (22); the arrow indicates the site at which 2A activity disrupts the polypeptide backbone; the underlined residues were converted to alanine in the 2A* sequence.

image

Figure 2. (opposite) Strategies for stoichiometric transient expression of fluorescent markers. Low (A, D, G) and higher (B, E, H) magnification confocal images of tobacco leaf epidermal cells transiently expressing a mixture of GFP-HDEL and YFP-HDEL (A and B), GH–YH (D and E) or Ym-2A-GH (G and H) with the YFP channel shown in red and the GFP channel in green in a single merged image. (C, F, I) Scatter plots of pixel intensities in the GFP channel (x axis) and YFP channel (y axis) for images similar to those shown in A, D and G, respectively; colours indicate the frequency with which particular intensity combinations are observed with blue being the lowest and red the highest. (J–L) Projections in z of 22 1.5-μm confocal optical sections through the cortical cytoplasm of cells expressing Ym-2A-GH with varying efficiency; YFP (red), GFP (green) and merged channel images are shown as indicated. Scale bars 100 μm (A, D, G), 20 μm (B, E, H and J–L). Agrobacterium strains carrying each constructs were infiltrated at OD600 0.03. (M) Coefficients of variance (V) for absolute (open bars) and ratiometric (shaded bars) measurements of GFP fluorescence in nine low-magnification confocal images, such as those in (D) and (G), taken from leaves expressing GH–YH or Ym-2A-GH; bars show the mean value of V and the standard error of four experiments. (N) Absolute (open diamonds) and ratiometric (shaded squares) measurements of GFP fluorescence in epidermal cells of tobacco leaves infiltrated with Agrobacterium strains carrying Ym-2A-GH at various titres; data are the means of two experiments. (O) Average coefficients of variance for each absolute (open bars) and ratiometric (shaded bars) measurement in (N).

In the second approach, we constructed a transfer DNA (T-DNA) in which GFP-HDEL and YFP-HDEL were each transcribed divergently from the same CaMV 35S enhancer elements (GH–YH, Figure 1C). This improved the overlap visible between signals from individual cells (Figure 2D and E) and increased the degree of correlation on a pixel-by-pixel basis in the scatter plot (Figure 2F). We used a quantification procedure (3) to calculate the mean GFP and YFP pixel intensities in nine random low-magnification images such as the one in Figure 2D and asked whether the YFP signal could be used to normalize for image-to-image variation in the GFP signal. The mean coefficient of variance (standard deviation divided by the mean, expressed as a percentage) for the GFP signal in four independent experiments was approximately halved by normalization to YFP, representing a significant improvement in data quality (Figure 2M, GH–YH). Nevertheless, it was clear that considerable variation still existed in the relative expression levels of each marker in individual cells, seriously limiting the predictive value of the single T-DNA approach for analysis of single cells.

In the third approach, we took advantage of the of the ‘self-cleaving’ FMDV 2A peptide (21,22,27) to link YFP and ER-targeted GFP-HDEL in a single construct, Ym-2A-GH (Figure 1G; the legend to Figure 1 explains the nomenclature used for this and other 2A constructs). Following transfection with this construct, there was a close correlation between the YFP and GFP signals for individual cells over a wide range of intensities (Figure 2G and H). The YFP accumulated in the cytoplasm and nucleoplasm, while GFP was confined to the ER and nuclear envelope (Figure 2H; see also Figure 3A–C), consistent with cleavage between the two fluorescent proteins and localization according to the ER targeting and retention sequences on the GFP moiety. The improved correlation between GFP and YFP intensities was confirmed by the scatter plot of individual pixel intensities in Figure 2I and by z-projections of higher magnification images of the cortical cytoplasm (Figure 2J–L). GFP and YFP signals substantially co-localized as the ER and cytoplasm are not readily resolved even at this level of magnification. The mean coefficient of variance was more than halved when the ratio was calculated (Figure 2M, Ym-2A-GH) and the improvement in the quality of the ratiometric data was manifest over a 30-fold range of Agrobacterium titres (from OD600 0.013 to 0.40, Figure 2N). Thus, although the absolute accumulation of GFP varied approximately 10-fold, the ratio of GFP:YFP varied only 1.4-fold. The ratio was unchanged above OD600 0.05 and was linear up to this point, suggesting that an OD600 close to 0.05 is optimal for use of constructs like Ym-2A-GH. The coefficient of variance for the ratio data was threefold lower than that of the absolute fluorescence data for bacterial titres of 0.05 or less (Figure 2O). We concluded that, in principle, 2A constructs offered an effective strategy to produce stoichiometric levels of reference and target markers suitable for ratiometric analysis of GFP expression levels in individual cells and in cell populations, with YFP accumulation reliably predicting GFP expression efficiency in each cell.

image

Figure 3. Targeting of translation products of 2A peptide fusions to different compartments. Confocal images of tobacco leaf epidermal cells transiently expressing (A–C) Ym-2A-GH, (D) Ym-2A-secGf, (E–G) nlsRm-2A-GH, (H) nlsRm-2A-secGf, (I–K) STN-Rm-2A-GH, (L) STN-Rm-2A-secGf, (M–O) secN-Rm-2A-GH, (P) secN-Rm-2A-secGf. YFP and RFP channels are shown in red and the GFP channel in green. Merged channel images are indicated. (M–P) Chlorophyll fluorescence is indicated in blue. Shown are single sections (A–C and E–H) and projections (D and I–P). Scale bar is 5 μm.

Constructs for ratiometric assays of membrane traffic

Images of cells expressing Ym-2A-GH indicated that the GFP moiety could be targeted to the ER while YFP remained cytosolic (Figures 2H and 3A–C). To obtain a 2A-based ratiometric fluorescent marker of biosynthetic membrane traffic, we replaced the ER-retrieval signal (HDEL) on the GFP moiety of Ym-2A-GH with a sequence encoding the FLAG epitope tag (Figure 1F). It was expected that the GFP moiety of the new construct, Ym-2A-secGf, would be trafficked to the apoplast, perhaps with a fraction being sorted to the vacuole as reported previously for secGFP in tobacco epidermis (3). In either location, GFP accumulation and fluorescence is known to be poor (3,6,7,11). Consistent with this prediction, when expressed in plant cells, GFP accumulation from Ym-2A-secGf was almost undetectable under conditions that revealed clear GFP fluorescence in the ER of cells expressing comparable amounts of Ym-2A-GH as judged by YFP accumulation (compare Figure 3C and D). As described in later sections, the difference between these two extremes of GFP accumulation, normalized to the level of expression of the reference (YFP) marker, provides a quantitative ratiometric assay of GFP trafficking.

While the Ym-2A-secGf construct successfully combined a trafficked GFP marker with a cytoplasmic YFP reference in stoichiometric quantities, we sought to extend the utility of the ratiometric approach and to test the versatility of the 2A peptide for targeting proteins to distinct endomembrane compartments. Therefore, we assembled a series of constructs in which the intended location of the reference marker was altered and YFP was replaced by red fluorescent protein (mRFP1) (32) to simplify spectral separation of the two fluorescence signals.

Targeting the reference to the nucleus provides a more convenient object for reliable semi-automated quantitative measurements. As shown in Figure 3E–G, nlsRm-2A-GH (Figure 1L) successfully targeted mRFP1 to the nucleus via a nuclear localization signal at its amino-terminus, while GFP was targeted to the ER as before. When the ER-retrieval signal on the GFP-HDEL moiety of nlsRm-2A-GH was replaced by the FLAG epitope tag to generate nlsRm-2A-secGf (Figure 1K), RFP fluorescence was still detected in the nucleus, but little GFP accumulated in the endomembrane system (compare Figure 3G and H), consistent with the expected export of the secGFPf moiety from the ER.

Targeting the reference marker to the ER may provide a better quantitative (intensity) and qualitative (morphology) reference for perturbation of the early secretory pathway as it would co-localize precisely with the accumulated trafficking marker. A 2A-based polyprotein that generated an ER-localized reference marker would require both the amino-terminal (RFP) and carboxy-terminal (GFP) moieties to be translocated across the ER membrane. In such a configuration, the timing of the proposed 2A cleavage is expected to be critical. If chain separation occurs before the signal peptide of the second fluorescent protein encounters the translocation channel, this signal peptide could be inserted independently into the translocon, carboxy-terminus first, allowing translocation as normal into the ER lumen. In contrast, if the nascent GFP-HDEL or secGf moiety emerged from the ribosome before 2A-mediated separation had occurred, the signal peptide would enter the translocation channel amino-terminus first and would be expected to act as a stop-transfer signal owing to its hydrophobic nature (33–35). This would cause the GFP moiety to accumulate on the cytoplasmic face of the ER membrane where the ER-retrieval signal would not encounter the luminal retrieval receptor.

To test whether the 2A peptide was able to generate stoichiometric quantities of ER-localized reference and trafficked markers, we constructed a secreted-RFP/ER-GFP dual reporter (secN-Rm-2A-GH) and a Golgi-RFP/ER-GFP dual reporter (STN-Rm-2A-GH) (Figure 1R and O) using either a cleavable signal peptide or the Golgi-targeting signal of rat sialyl transferase (ST), as described previously (6). We also constructed plasmids in which the HDEL signal of the GFP moiety was replaced by the FLAG epitope tag to test whether ER residency of the reference GFP marker was dependent on this retrieval signal as expected. The RFP moieties of these constructs incorporated N-glycosylation sites to allow glycan processing to be assessed in trafficking assays (6).

When expressed in tobacco leaf epidermis, STN-Rm-2A-GH efficiently targeted RFP to mobile punctate structures typical of the Golgi apparatus, while GFP fluorescence appeared to be confined exclusively to the ER (Figure 3I–K). Red fluorescent protein was not observed in the ER except at the early stages of transient expression, when faint ER labelling could sometimes be detected most probably due to the transport of new protein through the ER to the Golgi (6). When the HDEL signal on the GFP moiety was replaced with the FLAG epitope tag to generate STN-Rm-2A-secGf (Figure 1N), GFP accumulation was dramatically reduced relative to STN-Rm-2A-GH (compare Figure 3K and L), consistent with secretion of secGFPf. Thus, it appears that the GFP moieties were indeed translocated into the lumen of the ER where GFP-HDEL was retained by virtue of its carboxy-terminal HDEL signal while secGFPf was exported and were not simply associated with the cytoplasmic face of the ER membrane via an uncleaved signal peptide.

When secN-Rm-2A-GH and secN-Rm-2A-secGf were expressed in tobacco leaf epidermis, GFP accumulated in the ER in an HDEL-dependent fashion as expected, but RFP was unexpectedly observed to accumulate in the vacuole rather than the apoplast (Figure 3M–P). Indeed, the apoplast was evident as a dark line between adjacent cells (Figure 3M and P). It has been shown that mRFP1 is stable and fluorescent in the apoplast of tobacco epidermal cells [(3); see also Figure 4R below] so the absence of signal suggests that the RFP moiety of secN-Rm-2A constructs has not been transported there to any significant extent. In cells that expressed STN-Rm-2A-GH and STN-Rm-2A-secGf to comparatively high levels, RFP fluorescence was also observed in the vacuole (Figure 3I). This suggested that the RFP-2A moieties of both constructs were unexpectedly sorted to the vacuole with high efficiency after leaving the Golgi.

image

Figure 4. (on previous page) 2A acts as a vacuolar-sorting determinant in tobacco leaf epidermis. Confocal images of tobacco leaf epidermal cells transiently expressing various fluorescent proteins as indicated. (A–D′) secN-Rm-2A-GH infiltrated at OD600 0.25 and examined 48 h later. RFP (red) is visible in the vacuole (A and C′) and associates with the ER network marked by GFP (green) and is also clearly visible in distinct punctate structures that excluded the ER marker (D, arrows). B′–D′ show single sections through the vacuole of cells whose cortical cytoplasm is shown in projection (B–D). Chlorophyll fluorescence is indicated in blue. (E–G) secN-Rm-2A-secGf similarly imaged to reveal RFP and GFP in transit through the endomembrane system; each protein labels the ER network and putative PVC (arrows) and Golgi stacks (arrowheads). (H) A projection of cells expressing secN-Rm-2A-secGf, indicating that GFP but not RFP is detectable in the cell wall (arrowheads). (I–P) secN-Rm-2A-GH infiltrated either alone (I–L) or with a strain expressing YFP-RAB-F2b[S24N] (M–P). In the absence of the YFP-RAB-F2b[S24N], RFP signal is absent from the cell wall and confined to the vacuole (I and asterisked cells in M); however, in cells co-expressing the Rab GTPase mutant (numbered 1–5 in M–P), strong RFP fluorescence is detected in the apoplast in addition to the vacuole (arrowheads). The arrow indicates RFP that has apparently diffused from cells 1, 4 and 5 into the adjoining wall between two non-infected cells. RFP is in red, GFP in green and YFP in blue. (Q) Schematic representation of secRFP and secRFP-2A constructs. (R and S) secRFP accumulates exclusively in the apoplast (R) while secRFP-2A is almost exclusively vacuolar (S). (A, B′–D′) and (E–G) are single sections; (B–D, H, I–P) and (R and S) are projections. Scale bars 20 μm (I–P and R and S), 5 μm (H) and 2 μm (E–G).

2A acts as a sorting determinant for the Rab-F2 PVC in plant cells

To establish whether the RFP moiety of secN-Rm-2A constructs passes through the endomembrane system en route to the vacuole, we sought to visualize it in transit at steady state. Therefore, leaves were infiltrated with the secN-Rm-2A-GH strain at OD600 0.25, five times the usual titre and were examined by confocal microscopy 18 h after the onset of transient expression (48 h post-infiltration) when steady-state levels of RFP in transit through the endomembrane system would be at their highest (Figure 4A–D′). Under these conditions, RFP was visible in the vacuole (Figure 4A, C′), but much of the RFP moiety was associated with the ER network marked by GFP (Figure 4A, B and D). Red fluorescent protein was also clearly visible in distinct punctate structures that excluded the ER marker and probably represented intermediates on a vacuolar pathway (Figure 4D, arrows). When cells expressing secN-Rm-2A-secGf under similar conditions were imaged to reveal both RFP and GFP in transit through the endomembrane system, each labelled the ER network (Figure 4E–H), while GFP, but not RFP, was detectable in the cell wall at these high-expression levels (Figure 4H, arrowheads). Both markers, however, labelled small bright punctate structures (arrows in Figure 4E–G). These probably represent the same punctate RFP-labelled intermediates observed with secN-Rm-2A-GH (Figure 4D, arrows). Similar structures were previously observed with secreted and vacuolar GFP markers and identified as a PVC (3,12), suggesting that RFP may follow the same route to the vacuole. To test this possibility, we asked whether transport of the RFP moiety of secN-Rm-2A-GH to the vacuole was dependent on Rab GTPases of the Rab-F2 subclass. It has been shown that a YFP-tagged member of this subclass, AtRAB-F2b (ARA7) of Arabidopsis, localizes predominantly to this PVC in tobacco leaf epidermis and that the S24N mutant of this protein (YFP-RAB-F2b[S24N]) causes the vacuolar marker aleuGFP to be mis-sorted to the vacuole (12). The secN-Rm-2A-GH was infiltrated either alone (Figure 4I–L) or with a strain expressing YFP-RAB-F2b[S24N] and epidermal cells were imaged 54 h later (Figure 4M–P). In the absence of YFP-RAB-F2b[S24N], RFP signals were absent from the cell wall and confined to the vacuole (Figure 4I and asterisked cells in Figure 4M). However, in cells co-expressing YFP-RAB-F2b[S24N], strong RFP fluorescence was detected in the apoplast in addition to the vacuole.

It is notable too that RFP and GFP moieties of secN-Rm-2A-secGf were additionally observed in punctate structures that were larger and fainter than the PVC (arrowheads in Figure 4E–G). Similar structures have previously been observed with secGFP and identified as Golgi (3). Interestingly, the secN-RFP signal in these structures relative to the ER and PVC was significantly lower than that of secGFP, suggesting that its residence time in the Golgi may be lower. It also confirms that separation of RFP and GFP moieties occurs before the Golgi. We concluded that both the RFP and GFP moieties of the secN-RFPmyc-2A and STN-RFPmyc-2A fusions were translocated across the ER membrane, but that the RFP moieties were then sorted from the Golgi to the vacuole via the conventional PVC/Rab-F2-dependent pathway rather than following the default pathway to the apoplast.

We next investigated the location of the vacuolar-sorting signal within the RFP moiety of the 2A constructs. To test whether the signal resides within the 2A peptide itself, this sequence was fused to the carboxy-terminus of secRFP (Figure 4Q), a previously described secreted RFP molecule (3), and expressed in tobacco epidermal cells. While secRFP accumulated exclusively in the apoplast without appearing in the vacuole, as reported previously (3), secRFP-2A, which carried the 2A sequence was almost exclusively vacuolar (Figure 4R and S). The 2A sequence is, therefore, sufficient for vacuolar targeting of mRFP1 in the plant endomembrane system.

2A fusions behave similarly in tobacco epidermis and Arabidopsis seedlings

We were interested in knowing whether the 2A-based markers would exhibit similar behaviour in other plant species, particularly the genetic model organism Arabidopsis thaliana. Therefore, all of the constructs mentioned above were used to generate stable transformants in Arabidopsis and the roots and leaves of T3 homozygous plants were analysed by confocal microscopy. In every case, we observed efficient separation of YFP or RFP moieties from ER-resident or secGFP in the leaves. Notably, the STN-RFPm-2A and secN-RFPm-2A proteins accumulated clearly in the vacuoles of leaves as observed in tobacco leaf epidermis (Figure 5). Similar behaviour was observed in roots (data not shown) with the exception of STN-RFPm-2A-GH where RFP signals were clearly associated with the ER, particularly in meristematic and elongating cells. Thus, the 2A-based constructs behave similarly in the two most common dicot models, Arabidopsis and tobacco, and may, therefore, have general utility.

image

Figure 5. 2A fusions in Arabidopsis seedlings. Confocal microscopy of leaves of transgenic Arabidopsis plants expressing (A–C) Ym-2A-GH, (D) Ym-2A-secGf, (E–G) nlsRm-2A-GH, (H) nlsRm-2A-secGf, (I–K) STN-Rm-2A-GH, (L) STN-Rm-2A-secGf, (M–O) secN-Rm-2A-GH, (P) secN-Rm-2A-secGf. YFP and RFP channels are shown in red and the GFP channel in green. Merged channel images are indicated. (A–H) and (L) are single sections and while (I–K) and (M–P) are projections. Scale bars 50 μm (A–D) and 10 μm (E–P).

2A fusions involving YFP and RFP are not cleaved with equal efficiency

Confocal analysis suggested that the 2A fusions were cleaved with high efficiency as upstream and downstream moieties accumulated predominantly in distinct compartments. To investigate the efficiency of cleavage directly, protein extracts were prepared from transfected tobacco leaves or transgenic Arabidopsis seedlings and analysed on immunoblots using anti-GFP or anti-c-myc antisera. The Ym-2A, nlsRm-2A and STN-Rm-2A fusions each gave rise to bands of the expected molecular weight when probed with anti-c-myc antisera in tobacco (Figure 6A), although the YFPm-2A moiety accumulated as two bands in Arabidopsis (Figure 6C, lanes 2 and 3). Occasionally, a second higher band was seen, suggesting some heterogeneity of cleavage or some instability at one or other terminus of the primary cleavage product (data not shown). The same result was obtained with secN-Rm-2A-GH and secN-Rm-2A-secGf (data not shown). None of the fusions involving RFP gave rise to detectable uncleaved translation product. In contrast, a faint band corresponding to the uncleaved YFP fusions was consistently detectable with Ym-2A-GH and Ym-2A-secGf (Figure 6A and C, arrowheads).

image

Figure 6. Immunoblot analysis of 2A fusions in transfected tobacco leaves. Immunoblot analysis using anti-c-myc antiserum (A and C) or anti-GFP/YFP antiserum (B and D) of protein extracts prepared from tobacco leaves (A and B) or Arabidopsis transgenic seedlings (C and D) expressing Ym-2A-GH (lane 2), Ym-2A-secGf (lane 3), nlsRm-2A-GH (lane 4), nlsRm-2A-secGf (lane 5), STN-Rm-2A-GH (lane 6), STN-Rm-2A-secGf (lane 7) or non-transfected/non-transgenic plants used as a control (lane 1). Major bands of the expected mobility were detected in all cases, however, full-length, uncleaved, translation product was detected to varying extents with the YFP fusions (lower arrowheads) and mRFP1 fusions (upper arrowheads). (E) Immunoblot analysis using anti-GFP/YFP antiserum of Ym-2A-GH and nlsRm-2A-GH tested over a 10-fold range of Agrobacterium titres (OD600 as indicated). (F) Immunoblot analysis using anti-GFP/YFP antiserum of Ym-2A-GH over a 20-h period from 50 to 70 h post-infiltration. Lanes labelled U (E and F) show extracts of un-infiltrated leaf. Arrows indicate the positions of markers whose molecular weight is indicated in kDa.

We also probed the same protein extracts with anti-GFP antibodies. This revealed major bands of the expected molecular weight (29 kDa) for all constructs. Consistent with the fluorescence data, ER-resident GFP expressed from the -2A-GH constructs was more abundant than the secreted protein of the -2A-secGf constructs. Faint bands corresponding to the uncleaved product were detectable with the STN-Rm-2A fusions (Figure 6B and D, lanes 6 and 7, upper arrowheads), but significantly more uncleaved Ym-2A-GH and Ym-2A-secGf fusion proteins were detected in both tobacco and Arabidopsis (Figure 6B and D, lanes 2 and 3, lower arrowheads). Even allowing for the fact that Ym-2A fusions bear twice as many GFP epitopes as the RFP-based fusions, it is clear that a greater proportion of the YFP fusions accumulated in the uncleaved form. The ratio of full-length and cleaved translation product did not change when Ym-2A-GH or nlsRm-2A-GH were expressed using a 10-fold range of Agrobacterium titres (Figure 6E) or when Ym-2A-GH was monitored over a 20-h period starting approximately 20 h after the onset of transient expression (50–70 h post-infiltration; Figure 6F).

Thus, it appears that the 2A fusions with RFP at their amino-termini were cleaved with greater efficiency than those with YFP at that position. It is notable that the uncleaved YFP fusions were barely detected by the c-myc antibody so, despite the fact that c-myc occurs only once in the fusion protein whereas the anti-GFP epitopes occur twice, the c-myc epitope is apparently not recognized efficiently in the context of the full-length Ym-2A fusions.

Ratiometric analysis of membrane traffic in cell populations

We selected nlsR-2A-secGf and YFP-2A-secGf to test the effectiveness of ratiometric approaches for quantifying biosynthetic membrane traffic in tobacco epidermal cells. The YFP-2A-secGf is suitable for use with the quantification method used in Figure 2 as the cytosolic YFP and endomembrane-localized GFP signals are distributed similarly in low-magnification images of transfected cells. The incomplete cleavage of this fusion may not compromise its use in trafficking assays because the uncleaved product appeared to be transported efficiently through the endomembrane system as judged by the lack of intracellular GFP signal in confocal images (Figure 3D). We reasoned that the YFP domain on the cytoplasmic face of endomembrane compartments will experience a constant environment during transit, while the GFP moiety will encounter the same luminal/apoplastic environments as the cleaved secGf product. Thus, the YFP and GFP fluorescence intensities from the uncleaved transmembrane molecule were expected to respond like those of the separated YFP and GFP moieties when biosynthetic trafficking is inhibited.

Ym-2A-secGf or Ym-2A-GH was expressed either alone or with the dominant N121I mutant of the Arabidopsis Rab GTPase, AtRAB-D2a (ARA5; AtRab1b; At1g02130), a homologue of mammalian Rab1 (36) that is known to block ER to Golgi transport (3,6,19). The two extremes of the assay were set by the signal from the secGFP marker alone (Figure 7A) and the GFP-HDEL marker (Figure 7C). Consistent with previous observations [(3,6) and H. Betts and I. Moore, unpublished observations], absolute measurements of GFP fluorescence intensity indicated that the dominant-negative AtRAB-D2a[N121I] mutant had little or no effect on the accumulation of GFP-HDEL already trapped in the ER (Figure 7D and E) but increased the accumulation of secGFP (Figure 7B and E) to 50–75% of the GFP-HDEL value (Figure 7E). When the ratiometric approach, which normalizes for expression level and imaging efficiency using the co-expressed YFP signal, was used to analyse the same images, the results differed in three notable ways (Figure 7F). First, the statistical significance of the data was improved as illustrated by the lower coefficients of variance (Figure 7G). Second, AtRAB-D2a [N121I] caused secGFP to accumulate to levels comparable to those of ER-resident GFP-HDEL (expressed from Ym-2A-GH), whereas the absolute expression data in Figure 7E and previous studies suggested a figure of only 50–75% of GFP-HDEL. This can be explained most simply by a previously undetected reduction in transient expression efficiency in leaf areas co-infiltrated with the AtRAB-D2a [N121I] mutant strain. Third, the Rab mutant also caused a small but significant (P = 0.05) increase in the accumulation of GFP-HDEL owing most probably to escape of some GFP-HDEL molecules from the ER in cells expressing Ym-2A-GH alone.

image

Figure 7. Absolute and ratiometric measurements of GFP trafficking in tobacco leaf epidermal cells. (A–D′) Low-magnification images of Ym-2A-secGf expressed alone (A and A′) or co-expressed with AtRAB-D2a[N121I] (B and B′) and compared with Ym-2A-GH expressed alone (C and C′) or co-expressed with AtRAB-D2a[N121I] (D and D′). GFP channel (A–D) is green and YFP channel (A′–D′) is red. Scale bar is 100 μm. (E and F) absolute (E) and ratiometric (F) measurements of secGFPf and GFP-HDEL accumulation in cells expressing Ym-2A-secGf (Y2AsecG) or Ym-2A-GH (Y2AGH) with or without AtRAB-D2a[N121I] (D2aNI); means of three experiments normalized to the value for Ym-2A-GH; error bars are SE. (G) Average coefficient of variance for absolute (open bars) and ratiometric (shaded bars) measurements of GFP accumulation; n = 5 except for Y2AGH + D2aNI where n = 3. Agrobacterium strains were used at OD600 0.05 (Ym-2A-secGf and Ym-2A-GH) or 0.03 (AtRAB-D2a[N121I]), and images were acquired 70–74 h after infiltration.

Ratiometric analysis of membrane traffic in individual cells

The 2A-based ratiometric approach can also be applied to individual cells imaged at high magnification where it can establish whether the accumulation or mis-localization of a trafficking marker results from inhibition of biosynthetic trafficking or from high rates of marker synthesis. For example in Figure 8A, we infer that cell 2 is presumably co-expressing the co-infiltrated dominant inhibitory AtRAB-D2a[N121I] mutant as it accumulates more GFP than neighbouring cells or control cells (Figure 8B) with similar nlsRFP accumulation. This approach is potentially versatile, as it can be applied to transfected protoplasts or to specific cells of transgenic plants where the low-magnification method described above is not readily employed.

image

Figure 8. (on previous page) Use of 2A-based ratiometric markers for analysis of individual tobacco leaf epidermal cells. Single optical sections of cells from infiltrated leaves expressing (A) nlsRm-2A-secGf and AtRAB-D2a [N121I], (B) nlsRm-2A-secGf, only, or (C) nlsRm-2A-GH; in (C) transects used for image analysis are displayed as white lines. In (A), the expression level of the marker is similar in cells 1 and 2 and similar to the control cells in (B) as indicated by the intensity of the red nuclei, however, only cell 2 accumulates secGFP (green); note that the weak GFP signal below nucleus 1 is in the adjacent cell 3; chlorophyll fluorescence is indicated in blue. (D) GFP intensity in the nuclear envelope and adjacent cytoplasm plotted against nuclear RFP intensity in individual cells expressing either nlsRm-2A-secGFPf (shaded squares) or nlsRm-2A-GH (open squares); each datum represents a measurement from a single cell; the dotted line through the data for nlsRm-2A-GH shows the best fit (R 2 = 0.85) for nlsRFP values from 0 to 150 above which GFP-HDEL accumulation plateaus. (E–H) Projections of a series of optical sections from tobacco leaf epidermis expressing the ratiometric marker nlsRm-2A-secGf and C-terminally tagged AtRAB-D2a[N121I]-YFP. Cell 1 expresses both constructs to high level as indicated by the nlsRFP signal (red) and YFP signal (blue) and accumulates high levels of secGFPf (green); cell 2 expresses less of the marker and accumulates less secGFPf; cell 3 expresses only the marker and indicates the extent of secGFPf accumulation in control cells while cell 4 expresses only the YFP-tagged Rab GTPase and indicates that there is minimal bleed-through into the GFP channel under these conditions; (E–H) show the individual detection channels and merged image as indicated. (I) Quantitative analysis of secGFPf accumulation relative to the expression of YFP-tagged AtRAB-D2a wild type (shaded squares) and N121I mutant (open squares) in individual tobacco leaf epidermal cells; to assess the extent of secGFPf accumulation, GFP fluorescence is expressed as a percentage of the GFP fluorescence that would be expected if nlsRm-2A-GH was expressed at the same level as nlsRm-2A-secGf in each cell, based on its individual RFP signal and the slope of the line in (D) which was obtained from control cells expressing nlsRm-2A-GH only; GFP data is corrected for bleed-through of YFP fluorescence into the GFP channel using a function determined by analysis of cells that expressed only the YFP-tagged wild-type Rab GTPase. (J–M) Projections of optical sections through the cortical cytoplasm of cells from leaf areas co-transfected with the Ym-2A-secGf and nlsRm-2A-D2a[NI] constructs; (J–M) show the individual detection channels and merged image as indicated. (N) Ratiometric measurements of secGFPf accumulation in cells expressing Ym2AsecGf alone or together with nlsRm-2A-D2a[NI] or AtRAB-D2a[N121I] compared with Ym2AGH. Bars indicate means of three experiments normalized to the value for Ym-2A-secGf; error bars are SE. Scale bars in all images are 20 μm. Infiltrations were performed with nlsRm-2A-secGf and nlsRm-2A-GH strains at OD600 0.05 (A–C), 0.04 (D and I) or 0.02 (E–H); AtRAB-D2a -YFP and AtRAB-D2a[N121I]-YFP strains at OD600 0.02; and AtRAB-D2a[N121I] and nlsRm-2A-D2a[NI] at OD600 0.03.

Therefore, to quantify GFP accumulation ratios in individual cells, we developed an image analysis tool that can be used in conjunction with the nlsR-2A constructs. To measure signals unambiguously from specific cells, analysis was performed on the nucleus and perinuclear region of a series of confocal sections along the z-axis. Starting from a position in the nucleus, a series of transects was drawn across the cytoplasm into the surrounding vacuole (see Figure 8C). The maximum GFP signal along each transect was then extracted and averaged, while the nuclear RFP intensity was automatically extracted from the 3D data set from a user-defined seed. Figure 8D shows that in cells expressing nlsRm-2A-GH, under the imaging conditions used, there was a linear correlation (R 2 = 0.85) between the RFP and GFP fluorescence for RFP pixel intensities up to 150, after which GFP-HDEL signal plateaued at less than the maximum possible pixel intensity (255), suggesting saturation of the ER-retrieval mechanism at these expression levels. Similar analysis of cells expressing nlsRm-2A-secGf showed that little GFP accumulated in the nuclear envelope or ER over the entire range of RFP expression values (Figure 8D, shaded squares). The slopes of fitted lines indicated that GFP-HDEL accumulated in the ER 1000-fold more efficiently than secGFPf (GFP-HDEL = 1.2 × nlsRFP; secGFPf = 0.0009 × nlsRFP), providing a far greater dynamic range in this assay method in comparison to the low-magnification approach described hitherto (3) (Figures 2 and 7).

Ratiometric analysis of membrane traffic with quantification of effector levels

In the assays described so far, the presence or absence of the dominant inhibitory mutant in any cell could only be inferred from the value of the secGFPf ratio. Clearly if the protein can be visualized by tagging with a third fluorescent protein, its relative abundance in each cell could be determined directly and correlated with its effect on marker trafficking. Tagging AtRAB-D2a[N121I] with YFP at its amino-terminus renders it inactive and apparently unstable (data not shown), but fusions to the carboxy-terminus were stable and appeared to exhibit some residual inhibitory activity. We, therefore, asked whether this low activity could be quantified using the nlsRm-2A-secGf trafficking assay. As shown in Figure 8E–H, accumulation of the secGFP marker was clearly dependent on the abundance of both RFP and AtRAB-D2a[N121I]-YFP in the same transfected cell (compare cells 1 and 2 with cell 3). Using the image analysis tool described above, the YFP, RFP and GFP signal intensities in such images were quantified in cell populations co-infected with nlsRm-2A-secGf and either wild-type or mutant YFP-tagged AtRAB-D2a. For each cell, the YFP intensity was plotted against the GFP-to-RFP ratio. To provide a standard against which to compare the relative data generated by this analysis, the secGFP signal in each cell was expressed as a percentage of the GFP signal that would be expected for nlsRm-2A-GH expressed at the same level. Thus, the RFP intensity was used to read off the expected GFP-HDEL intensity from the slope of the dotted line in Figure 8D derived from cells expressing nlsRm-2A-GH in the same experiment. Wild-type AtRAB-D2a-YFP had no effect on secGFPf accumulation, but AtRAB-D2a[N121I]-YFP caused secGFPf to accumulate to approximately 10% of GFP-HDEL in the most highly expressing cells, confirming that it retained some residual inhibitory activity (Figure 8I). Note that this small increase would not be measurable using the previous low-magnification approach (Figure 7).

Use of 2A to monitor the expression level of cytoplasmic effectors

As direct tagging is likely to be problematic for many effector proteins, we next asked whether the 2A peptide could be used to provide a stoichiometric marker for the expression level of proteins such as AtRAB-D2a[N121I] which exhibit little or no activity when tagged at either terminus. Linking such a protein to a fluorescent marker via the 2A peptide is predicted to leave just a single additional proline residue at the amino-terminus of the tagged protein, which may, therefore, retain functionality. Thus, we fused the AtRAB-D2a[N121I] ORF downstream of the nlsRFPm-2A coding sequence to generate nlsRm-2A-D2a[NI]. nlsRFPm-2A was chosen because it appeared to be more efficiently cleaved than YFPm-2A and should give a readily measurable signal in the nucleus of each transfected cell. This construct was then used in conjunction with Ym-2A-secGf to assay GFP trafficking. When individual cells were imaged at high magnification, it was evident that high GFP-to-YFP ratios correlated with high-RFP fluorescence in the nuclei (Figure 8J–M).

In these and other membrane trafficking experiments, nlsRm-2A-D2a[NI] typically exhibited a weaker inhibitory influence on trafficking of secreted and Golgi markers than untagged AtRAB-D2a[N121I] (Figure 8N). Assays of secGFP accumulation using the low-magnification ratiometric method with Ym-2A-secGf confirmed that nlsRm-2A-D2a[NI] increased secGFPf accumulation by approximately half as much as native AtRAB-D2a[N121I]. This lower activity may reflect either lower expression efficiency, some sensitivity to the additional amino-terminal proline or inefficient separation of the Rab and RFP moieties leaving dysfunctional full-length protein. When immunoblots of extracts from cells expressing nlsRm-2A-D2a[NI] and control constructs were probed with anti-c-myc antibodies, we observed that approximately 50% of the protein accumulated in the unseparated form (Figure 9A). This result was surprising given the efficient separation of the RFP and GFP moieties in the 2A fusions described above. Therefore, we further investigated the mechanism responsible for cleavage of 2A-fusion proteins.

image

Figure 9. Analysis of fusion proteins with or without functional 2A sequences or signal peptides in tobacco epidermal cells. For each construct extracts were prepared from cells expressing two independently constructed plasmids. Arrows indicate the positions of markers and their molecular weights are given in kDa. (A) Immunoblot analysis of 2A fusions to AtRAB-D2a using anti-c-myc antiserum. Lanes: 1, uninfected tissue; 2 and 3, nlsRm-2A-D2a wt; 4 and 5, nlsRm-2A-D2a[NI]; 6 and 7, control nlsRm-2A-GH. (B) Immunoblot analysis using anti-GFP/YFP antiserum of constructs carrying wild-type or mutant 2A sequences. Lanes: 1, uninfected tissue; 2 and 3, Ym-2A*-GH; 4 and 5, Ym-2A-GH; 6 and 7, nlsRm-2A*-GH; 8 and 9, nlsRm-2A-GH. (C) Immunoblot analysis using anti-GFP/YFP antiserum of 2A fusions with or without a signal peptide. Lanes: 1, uninfected tissue; 2, Ym-2A-GH control; 3 and 4, Ym-2A-Gf; 5, nlsRm-2A-GH control; 6 and 7, nlsRm-2A-Gf; 8 and 9, Ym-2A-nlsRf. (D–L) Projections of series of confocal images of tobacco leaf epidermal cells expressing nlsRm-2A-GH (D–F), nlsRm-2A*-GH (G–I) and nlsRm-2A-Gf (J–L); RFP is in red, GFP in green, chlorophyll in blue, (F, I and L) merged channels. Scale bars 20 μm.

The FMDV 2A peptide exhibits little activity at the carboxy-terminus of YFP and RFP in tobacco leaf epidermis

The cleavage efficiency of the 2A protein is known to be influenced by sequences upstream but not by sequences downstream (21). Thus, the accumulation of uncleaved 2A fusion protein in cells expressing nlsRm-2A-D2a[NI] suggested that the apparently efficient cleavage of other nlsRFP-2A fusions may have resulted either from instability of the uncleaved fusion protein or from cleavage by a mechanism that is independent of 2A. One possibility for such a mechanism was cleavage by signal peptidase between the signal peptide and the GFP sequence of the various 2A-GH and 2A-secGf fusions.

To test these possibilities, we assembled a series of fusions that either lacked the signal peptide or carried a mutant form of the 2A sequence (here designated 2A*) in which the two terminal residues were each converted to alanine (Figure 1T, underlined). Either substitution is sufficient to prevent 2A-mediated polypeptide separation during translation in vitro or in mammalian cells (21,29,37). As shown in Figure 9B, Y m-2A*-GH and nlsRm-2A*-GH, which carried the mutant 2A sequence, gave rise to almost identical ratios of monomeric and dimeric translation products as the corresponding wild-type clones, although the mutant sequence sometimes resulted in lower quantities of expressed protein. Confocal analysis of transfected cells also indicated efficient separation of the GFP-HDEL moiety from the upstream YFP or RFP moiety of the 2A* fusions (Figure 9D–I and data not shown). Conversely, when the signal peptide was eliminated from Ym-2A-GH or nlsRm-2A-GH fusions, giving rise to Ym-2A-Gf and nlsRm-2A-Gf, or when nlsRFP was placed downstream of Ym-2A, the translation product accumulated predominantly as the uncleaved fusion (Figure 9C). Images of transfected cells confirmed that in the absence of a signal peptide, the GFP and RFP moieties of nlsRm-2A-Gf accumulated at the same ratio in nucleus and cytoplasm of infected cells (Figure 9J–L). Together, these results indicate that the presence of a signal peptide, but not a functional 2A sequence is critical for separation of the GFP moiety from the upstream RFP and YFP moieties in the Ym-2A-GH and nlsRm-2A-GH constructs. In the case of the nlsRm-2A-D2a proteins, as we do not have antibodies to detect the AtRAB-D2a moiety, it remains unclear whether the monomeric nlsRFPmyc species arose from partial 2A-mediated cleavage or instability of the Rab moiety in the fusion protein.

Given previous reports of successful separation of GFP-2A fusions in plant and animal cells and in vitro translation systems, we asked whether the presence of the c-myc epitope tag immediately upstream of the 2A sequence in all of our fusions influenced the results. Ynomyc-2A-Gf is identical to Ym-2A-Gf except for the absence of the myc sequence between the C-terminus of YFP and the 2A peptide (Figure 1D and E). As shown in Figure 10, this construct exhibited the same intracellular distribution as Ym-2A-Gf in transfected cells and accumulated predominantly as a dimer when analysed by immunoblot (Figure 10G). Thus, the behaviour of 2A in the constructs described here is not determined by the presence of the c-myc sequence at its amino-terminus.

image

Figure 10. Confocal and immunoblot analysis of Ynomyc-2A-Gf. Projections of series of confocal images of tobacco leaf epidermal cells expressing (A–C) Ynomyc-2A-Gf and (D–F) Ym-2A-Gf; YFP is in red and GFP is in green. (G) Immunoblot analysis of transfected tobacco leaf tissues using anti-GFP/YFP antiserum. Lane 1, uninfected tissue; lanes 2 and 3, independent Ynomyc-2A-Gf constructs; lanes 4 and 5, independent Ym-2A-Gf constructs. The minor bands detected (arrowhead) represent the cleaved translation products. Arrows indicate the positions of markers whose molecular weight is indicated in kDa.

The 2A sequence is required for correct assembly and targeting of STN-RFP-2A-GH translation products

The conclusion that nlsRFPmyc-2A is cleaved inefficiently in plant cells raised questions about the mechanism responsible for the correct insertion of RFP and GFP moieties into the ER during translation of STN-Rm-2A-GH and secN-Rm-2A-GH. As discussed earlier, because the upstream RFP moiety of these constructs is translocated through the ER, if cleavage did not occur the signal peptide of the GFP moiety would be expected to enter the ER translocation channel amino-terminus first where it would act as a stop-transfer signal leaving the GFP moiety, its signal-peptidase cleavage site, and its ER-retrieval signal on the cytoplasmic face of the ER membrane. In contrast, GFP appeared to be separated efficiently from the RFP moiety and to accumulate in the ER lumen (e.g. Figure 3I–P and 6B). To investigate whether 2A is indeed essential for the correct processing of STN-Rm-2A-GH, a derivative carrying the mutant 2A sequence was constructed. When this was expressed in tobacco leaf epidermal cells, the mutant 2A sequence caused a dramatic reduction in the accumulation of both the RFP and the GFP moieties (Figure 11A–F). When transfected cells were imaged under conditions that allowed the accumulated protein to be visualized, it was clear that some RFP was present in structures typical of the Golgi, but a significant proportion was associated with the ER which also accumulated a small quantity of GFP (Figure 11G and H). Immunoblot analysis confirmed that very little STN-Rm-2A*-GH translation product accumulated and that all the visibly accumulated protein was full length (Figure 11I). Thus, the presence of a wild-type 2A sequence is responsible for the efficient processing, sorting and stable accumulation of STN-Rm-2A-GH translation products. As discussed below, in light of the results with mutant 2A peptides in other proteins, it may be that correct processing of STN-Rm-2A-GH and secN-Rm-2A-GH constructs is dependent on a property of the 2A peptide that is unrelated to its self-cleaving activity.

image

Figure 11. The 2A sequence is important for proper assembly and targeting of STN-Rm-2A-GH. Projections of series of confocal images of tobacco leaf epidermal cells expressing STN-Rm-2A-GH (A–C and G) or STN-Rm-2A*-GH (D–F and H). RFP is in red and GFP in green. (G and H) merged channels from images acquired with enhanced sensitivity allowing the translation products of STN-RFPm-2A*-GH to be visualized (chlorophyll is in blue). Scale bars 20 μm (A–C and D–F) and 10 μm (G and H). Agrobacterium strains were inoculated at OD600 0.06. (I) Immunoblot analysis using anti-GFP/YFP antiserum. Lane 1, uninfected tissue; lane 2, nlsRm-2A-GH; lane 3, nlsRm-2A*-GH; lanes 4 and 5 two independently constructed STN-Rm-2A*-GH fusions; lane 6, STN-Rm-2A-GH. The weak bands in lanes 4 and 5 (arrowhead) represent the uncleaved translation product of STN-Rm-2A*-GH. Arrows indicate the positions of markers whose molecular weight is indicated in kDa.

Discussion

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

The ratiometric assay described here offers greatly improved quantitative assays of biosynthetic membrane traffic in plant cells using fluorescence microscopy. We show that two polypeptides derived from a single ORF can be differentially targeted between cytoplasmic and endomembrane compartments if a signal peptide is positioned between the polypeptides. However, contrary to expectation, the use of a self-cleaving peptide such as the FMDV 2A peptide was unnecessary unless both polypeptides were translocated across the ER membrane. Furthermore, it was shown that the FMDV 2A peptide resulted in low rates of polypeptide separation in plant cells when placed downstream of mRFP1 or GFP derivatives.

Ratiometric trafficking assays using FMDV 2A fusions

Imaging protocols to quantify intracellular accumulation of secGFP in transfected tobacco leaf epidermis have been described (3), but the ratiometric constructs described here improve these assays in several ways. The ratiometric approach reduces the error associated with variable transfection rates and variable sampling of 3D space within and between experiments. It normalizes, too, for systematic variations in transfection rates between treatments. It also allows saturation phenomena to be identified and data to be collected only from cells with appropriate expression levels (see for example Figure 8D). These allow the influence of a test construct to be established with greater accuracy and statistical support. The ratiometric constructs can also be used to quantify marker expression and trafficking in individual cells using an image analysis tool developed specifically for the purpose. This quantification procedure has a far greater sensitivity, accuracy and dynamic range; with secreted and ER-resident GFP markers exhibiting a 1000-fold difference in accumulation compared with the approximately fivefold difference they exhibit in our previous protocol (3). The method is also more versatile, being applicable to transfected protoplasts that are commonly used for trafficking studies (13–15,19) and also to specific cell types of transgenic plants (3,5). The approach also allows multiple data points to be extracted from cells in a single transfection experiment. Variability in marker expression can be positively exploited to plot accumulation against expression and it is this that provides the high dynamic range in estimated trafficking rates noted above. Importantly, nlsRm-2A and Ym-2A fusions behave similarly in the two commonly used model dicots, tobacco and Arabidopsis.

Cleavage products containing the 2A peptide are sorted from the Golgi to plant vacuoles

It is shown that the 2A sequence contains an efficient vacuolar-sorting signal for tobacco epidermal cells. Consequently, when a cleavage product bearing the 2A sequence at its carboxy-terminus was located in the endomembrane system, it was sorted to the vacuole rather than being secreted. The Arabidopsis endomembrane system also sorted 2A-containing proteins to the vacuole, suggesting that the sorting mechanism is conserved. This property of 2A-based proteins will restrict its suggested use for modification of plant cell wall and endomembrane metabolism (25–28,38) and can explain some previous failures of 2A-based co-expression strategies. For example, when two secreted plant defensins, linked via the FMDV 2A peptide, were expressed in Arabidopsis (28), the protein upstream of 2A remained intracellular, while the subunit at the carboxy-terminus was secreted. In light of our observations, it now seems likely that the amino-terminal subunit was sorted to the vacuole owing to the 2A-derived sequence at its carboxy-terminus, a conclusion that is consistent with the circumstantial evidence discussed by François et al. (28).

The secN-Rm-2A-GH may be useful for assaying vacuolar sorting. The secN-Rm-2A moiety appears to follow the same vacuolar pathway as proteins bearing sequence-specific vacuolar-sorting signals as it traffics through a PVC on a Rab-F2-dependent pathway, as described for aleuGFP (12). The GFP-HDEL signal can be used to monitor expression levels to avoid saturation of the sorting receptor, as its accumulation is unlikely to be affected by specific intervention in the vacuolar-sorting process. As mRFP1 is stable in both the vacuole and apoplast, the proportion of the protein in each location is readily observed, although diffusion of RFP in the apoplast (Figure 4P, arrow) may complicate the analysis of sorting events in individual cells.

The 2A peptide does not promote efficient cleavage at the carboxy-terminus of GFP or RFP derivatives in plant cells

Our observations indicate that in plant cells, the 2A peptide promotes minimal polypeptide separation when placed downstream of GFP and RFP derivatives. Previous reports have indicated that 2A cleavage activity can exhibit wider sequence-specific variation in plants than in animals, so these data do not necessarily contradict reports of successful 2A-mediated cleavage in plants (21,23,29,39). As FMDV is presumably optimized to function at 37°C rather than at 21°C, at which our plants were incubated, we incubated plants at 17, 21 or 30°C but saw no differences in cleavage efficiency, suggesting that temperature is not a significant factor (data not shown). YFP and mRFP1-based fusions carrying downstream signal peptides exhibited different efficiencies of polypeptide cleavage. However, this may reflect differences in the efficiency of signal peptide insertion and cleavage rather than differences in 2A-mediated cleavage, as mutation of 2A had little or no effect on any YFP-2A or RFP-2A fusion. Whatever the mechanism, as these fusions all have an identical 15-residue linkers and epitope tag sequence immediately upstream of 2A, sequences still further upstream must play important roles in determining cleavage efficiency, perhaps by formation of interfering secondary structures in the ribosome exit channel. Consistent with this, deletion of the c-myc sequence had no effect on cleavage.

Unfortunately, the inefficient cleavage of 2A-based markers with mRFP1 or YFP as the amino-terminal moiety prevented us from using 2A technology to circumvent the inherent sensitivity of AtRAB-D2a to tagging of its amino-terminus, so other strategies will be needed to determine the expression levels of such proteins in individual cells. The poor activity of 2A in mediating chain separation downstream of common fluorescent proteins must also be considered if it is to be used for applications such as stoichiometric expression of FRET pairs (FRET is fluorescence resonance energy transfer).

Our conclusion that 2A works inefficiently downstream of GFP is at odds with that of El Amrani et al. (27). They reported on a construct in which an ER-targeted GFP derivative (GFP with a signal peptide and carboxy-terminal KDEL signal for retrieval to the ER) was followed by 2A and a phleomycin-resistance marker, Ble. Immunoblot analysis of transgenic cells showed that the GFP and Ble moieties were efficiently separated and that GFP was detectable in the ER. However, constructs lacking functional 2A sequences were not studied, so it is unclear whether the 2A sequence contributed to the separation of GFP and Ble moieties. Indeed, the conclusion that GFP was efficiently retained in the ER after 2A-mediated separation, which would leave the 2A sequence at the C-terminus of the GFP-KDEL moiety, is at odds with the highly conserved extreme C-terminal location of ER-retrieval signals in animals, fungi and plants (40,41). Furthermore, it was not demonstrated directly that the Ble protein was indeed cytosolic (27). The observations of El Amrani et al. are, however, compatible with an alternative interpretation that is consistent with our findings. We suggest that in most cases, the entire GFP-2A-Ble fusion was translocated intact into the ER by the signal peptide at its amino-terminus. It was then exported to the Golgi and, as retrieval to the ER was ineffective owing to the internal location of the KDEL motif, it was transported either to the cell wall by default or was sorted to the vacuole by virtue of the 2A peptide (see above). In either location, proteolysis at the carboxy-terminus of GFP, which is known to occur in tobacco and Arabidopsis cells (6,9,16,17), would cause separation of GFP and Ble. Indeed, the low stability of GFP in the apoplast and vacuoles of tobacco leaf epidermis (3,6) could account for the low accumulation of the GFP moiety relative to the ER-resident GFP control (27). The weak GFP fluorescence detected in the ER may represent newly synthesized protein in transit at steady state, as observed previously (3).

The roles of 2A and signal/anchor sequences in differential targeting of polyprotein-derived polypeptides in plants

A surprising conclusion from our analysis of the ratiometric markers in plant cells is that the 2A sequence was not required for targeting and separation of proteins that accumulated on different sides of the ER membrane. It appears that the signal peptide sufficed to give efficient cleavage, presumably by signal peptidase, ensuring that the sequence at its carboxy-terminus was translocated into the ER lumen while amino-terminal moieties remained on the cytosolic side.

Similar considerations may apply when the 2A peptide is used to deliver two proteins to other organelles. Ralley et al. (24) added a chloroplast transit peptide to each of two bacterial enzymes involved in carotenoid metabolism and linked them via the 2A peptide. Both enzymes were detected in the plastids of transgenic plants. The downstream enzyme accumulated at the native molecular weight indicating that the transit peptide had been removed. However, the molecular weight of the upstream moiety could not be determined and constructs lacking a functional 2A sequence were not investigated. Consequently, it is not clear that cleavage occurred at the 2A peptide nor that the 2A sequence was essential for polypeptide separation. It remains possible that another mechanism such as transit peptide cleavage was responsible for processing the polyprotein.

In contrast to our findings with tobacco and Arabidopsis, in transfected mammalian cells, ER- and Golgi-targeted protein moieties located downstream of YFP-2A required the 2A peptide for translocation into or through the ER membrane (29). It is unclear whether this difference arises from some detail of the fusions used or from differences in the ability of plant and mammalian cells to act on internally positioned signal peptides.

The role of 2A during co-translational insertion of dual constructs into the ER

In contrast to constructs carrying a single internal signal peptide in which 2A contributed little to targeting or separation of the upstream and downstream moieties, a construct that carried more than one signal peptide or signal anchor sequence was dependent on a functional 2A sequence for correct targeting, efficient separation and stable accumulation (STN-Rm-2A-GH). Similarly, when maize β- and δ-zein proteins, each carrying its own signal peptide, were expressed in transgenic tobacco as a fusion protein linked by 2A, β-zein-2A and δ-zein moieties were readily detected, but when the zeins were fused directly without 2A, the fusion was highly unstable and no separation of β- and δ-zein moieties was observed (25). In each of these studies, therefore, 2A appears to promote the stable accumulation of two separate polypeptides targeted to the ER membrane or lumen. In the absence of 2A-mediated cleavage, the second signal peptide is expected to act as a stop-transfer signal preventing the downstream sequence from entering the lumen or membrane of the ER. It is unclear why the resulting fusion proteins are unstable in these cases, but it may be that the second transmembrane domain interferes with proper protein folding. We suggest two non-exclusive explanations to account for the requirement for 2A when targeting two polypeptides to the ER.

One possibility is that 2A-mediated polypeptide separation occurs during translation of some proportion of proteins. These separated molecules may then be independently inserted into the ER using their respective signal peptide or signal anchor sequences. In contrast, those translation products that are not separated during translation may be unstable, as observed for the 2A* constructs and are, therefore, not detected. This model is consistent with the observation that 2A may effect limited polypeptide separation downstream of mRFP1 derivatives. However, it also predicts that significantly less RFP should accumulate from secN-RFPm-2A-GH and STN-RFPm-2A-GH (two signal peptide/anchor sequences) than from nlsRFPm-2A-GH (single signal peptide); yet, we have no evidence from our immunoblot or imaging analyses that this is the case (e.g. Figure 6A).

An alternative hypothesis is that some feature of the 2A peptide that is independent of its role in polypeptide separation facilitates correct insertion of the second signal peptide into the translocation channel while still part of a polyprotein. In this regard, we note that structural predictions for the 2A sequence suggest that it has an α-helical structure with a sharp type-VI reverse turn formed at its C-terminus by the PGP tripeptide. Proteins can adopt secondary structures within the exit tunnel of the ribosome and in the mouth of the Sec61/SecY translocon (33–35). Indeed, it appears that signal sequences can flip orientation within the translocation channel and have tens of seconds to achieve their preferred orientation (35,42). We suggest that this tight turn may have formed at the carboxy-terminus of 2A by the time it emerges from the ribosome exit tunnel, causing the second signal peptide to be presented to the translocon with its amino-terminus oriented towards the cytosol as normal (Figure 12C). In this orientation, rather than acting as a stop-transfer signal, the signal sequence could allow subsequent translation to translocate the remaining sequence into the ER lumen as normal (Figure 12). The mutations in the PGP tripeptide of 2A that disrupt its polypeptide separation activity are also predicted to disrupt formation of the type-VI reverse turn and thus to prevent the second signal peptide from being presented in the manner envisaged here. Consequently, in the case of 2A* fusions, a second signal peptide is expected to enter the translocon amino-terminus-first, partition into the lipid bilayer and act as a stop-transfer signal. Structural and mutational analysis may help to distinguish these possible mechanisms.

image

Figure 12. Schematic model for processing of various polyproteins in plant cells. (A) Polyproteins bearing a single internal signal peptide. The amino-terminal moiety (red) is translated on free ribosomes (1) which are targeted to the translocation channel (black ovals) upon emergence of the signal peptide (blue arrow) which is inserted as normal with the amino-terminus towards the cytosol (2); translation translocates the carboxy-terminal moiety (green) across the ER membrane and signal peptidase cleaves to release it (3); the signal peptide at the carboxy-terminus of the amino-terminal moiety is presumably degraded (4) as the amino-terminal moieties were observed to accumulate in the cytosol and nucleus without preferential accumulation at the ER membrane. (B) Polyproteins bearing two signal peptides or signal anchors. The signal on the amino-terminal moiety targets the ribosome to the translocation channel (1) causing translocation of the nascent chain across the membrane; the second signal peptide enters the translocon amino-terminus first and acts as a signal anchor blocking further translocation (2) and causing the carboxy-terminal moiety to accumulate on the cytoplasmic face of the membrane (3); as the signal peptidase cleavage site is on the cytoplasmic face, it cannot effect chain separation and the resulting fusion protein is unstable (4). (C) Polyproteins bearing two signal peptides or signal anchors and a wild-type 2A sequence. Step 1 proceeds as in (B) but when the 2A signal peptide enters the translocon the tight Type-VI turn at the carboxy-terminus of 2A (yellow line) helps to orient the second signal peptide with its amino-terminus towards the cytoplasm allowing translation to translocate the downstream moiety across the membrane; signal peptidase cleaves the fusion and the signal peptide at the carboxy-terminus of 2A is either degraded (as in A) or my remain attached and membrane associated if it is able to flip orientation in the translocon as nascent signal peptides can (34,42); fusions carrying the mutant 2A* sequence act as in (B) owing to disruption of the type-VI turn in the 2A sequence.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

Molecular cloning

Standard molecular techniques as described by Ausubel et al. (43) were followed. Firstly, several DNA fragments were generated by polymerase chain reaction (PCR) using Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA, USA) using the following primers: (i) myc-2A using primers P1 + P2; (ii) 2A-GFPflag using primers P3 + P5; (iii) 2A-secGFPflag using primers P4 + P5; and (iv) 2A-GFP-HDEL using primers P4 + P6. pBINm-gfp5-ER (K. Siemering, S. Hodge, J. Haseloff, MRC Laboratory of Molecular Biology, Cambridge, UK) was used as a template for GFP fusions and pGUS-2A-GFP (22) was used as a template for 2A. Secondly, by overlapping-PCR, fragment 1 was joined to fragments 2 and 3 using primers P1 + P5 and to fragment 4 using primers P1 + P6. The PCR products were digested with XbaI/BamHI, cloned into the same sites of pBluescript II SK+ (Stratagene, La Jolla, CA, USA) and confirmed by sequencing. YFPmyc was amplified using primers P7 + P8 and pVKH-N-ST-YFP (11) as a template. The product was digested with XhoI and BamHI, cloned into pBluescript and checked by sequencing. The XhoI/BamHI fragment was re-isolated and cloned downstream of an enhanced CaMV 35S promoter in the SalI–BamHI sites of pVKHEn6-Ara5m-ΔGUS vector (6) replacing the previous insert to generate pVKHEn6-YFPmyc (YFPmyc). Ym-2A-Gf, Ym-2A-secGf and Ym-2A-GH were created by cloning XbaI/BamHI fragments (isolated from the appropriate pBluescript derivatives described above) containing 2A-GFPflag, 2A-secGFPflag and 2A-GFP-HDEL into XbaI and BamHI sites of the YFPmyc vector. Ynomyc-2A-Gf was created by cloning XbaI/BamHI fragment containing 2A-GFPflag isolated from Ym-2A-Gf into SpeI and BamHI sites of pVKHEn6-HAvenus (3) from which a stop codon was deleted.

The nlsRFPmyc fragment was amplified using primers P9+P10 and mRFP1 (32) as a template. By overlapping-PCR, myc-2A fragment (see above) was added to it using primers P11 + P12. The PCR (nlsRFPmyc2Astop) product was digested with XhoI and BamHI, cloned into pBluescript and checked by sequencing. nlsRm-2A-secGf and nlsRm-2A-GH were created by cloning XhoI/XbaI fragment containing nlsRFPmyc (isolated from nlsRFPmyc2Astop) into SalI and XbaI sites of Ym-2A-secGf and Ym-2A-GH vectors replacing the YFPmyc fragment. nlsRm-2A-Gf was created by cloning XbaI/BamHI fragment containing 2A-GFPflag isolated from Ym-2A-Gf into the same sites of nlsRm-2A-GH and/or nlsRm-2A-secGf vectors replacing the 2A-GFP-HDEL and/or 2A-secGFPflag fragments.

The STN fragment was amplified using primers P13 + P14 and pVKH-N-ST-YFP (11) as a template. N-RFPmyc fragment was amplified using primers P15 + P16 (and nlsRFPmyc2Astop as a template). The two fragments were joined together by overlapping PCR using primers P13 + P16, the product (STN-RFPmyc) was digested with BamHI and XbaI, cloned into pBluescript and checked by sequencing. STN-Rm-2A-secGf and STN-Rm-2A-GH were created by cloning SpeI/XbaI fragment containing STN-RFPmyc (isolated from pBluescript) into the same sites of Ym-2A-secGf and Ym-2A-GH vectors, respectively, replacing the YFPmyc fragment. secN-Rm-2A-secGf and secN-Rm-2A-GH were created by cloning SalI/BamHI fragment containing N-RFPmyc-2A-secGf and N-RFPmyc-2A-GH isolated from the STN-RFPmyc-2A clones (see above) into the same sites of pVKH-N-secYFP (11) vector replacing the N-secYFP fragment.

In the mutant 2A sequence 2A*, the 2A amino acid sequence PGP (5′-CCT GGG CCC-3′) was altered to PAA (5′-CCT GCA GCT-3′) creating a PstI restriction site using primers P1 + P18 in PCR. GFP-HDEL was then amplified using primers P17 + P6 and the two fragments were joined together using primers P1 + P6. The PCR product (myc-2A*-GFP-HDEL) was digested with XbaI and BamHI, cloned into pBluescript and checked by sequencing. Ym-2A*-GH, nlsRm-2A*-GH and STN-Rm-2A*-GH were created by cloning XbaI/BamHI fragment containing 2A*-GFP-HDEL (isolated from pBluescript) into the same sites of Ym-2A-GH, nlsRm-2A-GH and STN-Rm-2A-GH, respectively, replacing the 2A-GFP-HDEL fragments. YFPmyc-2A-AscI fragment was generated by PCR using primers P7 + P19, the product was digested with XhoI and BamHI, cloned into pBluescript and checked by sequencing. AcsI-nlsRFPflag fragment was generated by PCR using primers P20 + P21, the product was digested with AcsI and BamHI and cloned into the same sites of YFPmyc-2A-AscI in pBluescript. YFPmyc-2A-nlsRFPflag was cut out from the pBluescript vector above using SpeI and BamHI and cloned into the same sites of Ym-2A-GH vector replacing the YFPmyc-2A-GFP-HDEL fragment.

The RAB-D2a fragments were generated by PCR using primers P22 + P23 and corresponding wild-type and N121I-mutant AtRAB-D2a (ARA5; AtRab1b; At1g02130) cDNA sequences as template (6). To create 2A-RabD2a fusions, these PCR products were used together with Ym-2A-GH as a template in overlapping-PCR using primers P24 + P23. The final PCR product (2A-RabD2a) was digested with XbaI and BamHI, cloned into pK18 (44) and checked by sequencing. The nlsRm-2A-RabD2a clones were created by cloning XbaI/BamHI fragments containing the 2A-RabD2a fusions (isolated from pK18 derivatives) into the same sites of nlsRm-2A-secGf and/or nlsRm-2A-GH replacing the 2A-secGFPflag and/or 2A-GFP-HDEL fragments.

To make secRFP-2A, RFP and 2A sequences were amplified using primers P25 + P26 and P27 + P12, respectively, and secN-Rm-2A-GH as a template. The two fragments were joined together by overlapping PCR using primers P25 + P12, the product (RFP-2A) was digested with BamHI and XhoI, cloned into pBluescript and checked by sequencing. secRFP-2A was created by cloning a SalI/BamHI fragment containing RFP-2A (isolated from pBluescript) into the same sites of secN-Rm-2A-GH vector replacing the N-Rm-2A-GH fragment.

List of primers

  • P1: GAGCAGAAACTTATCTCTGAGGAGGATTTGTCTAGAGGAGCATGCCAGCTGTTG

  • P2: GGGCCCAGGGTTGGACTCGACG

  • P3: TCGAGTCCAACCCTGGGCCCATGAGTAAAGGAGAAGAACTTTTCA

  • P4: TCGAGTCCAACCCTGGGCCCATGAAGACTAATCTTTTTCTCTTTCTCATC

  • P5: TTTTGGATCCTTACTTATCGTCATCATCCTTATAATCTTTGTATAGTTCATCCATGCCATGTG

  • P6: TTTTGGATCCTTAAAGCTCATCATGTTTGTATAGTTCATCCATGCCATGTG

  • P7: AAAACTCGAGACTAGTGGAGGGGTCGACCATGAGCAAGGGCGAGGAGCTG

  • P8: GGCGGATCCTATCTAGACAAATCCTCCTCAGAGATAAGTTTCTGCTCGGCGGCGGTCACGAAC

  • P9: ATGGCTCCTAAGAAAAAGAGAAAGGTTGGAGCTGGAATGGCCTCCTCCGAGGACGTC

  • P10: CAAATCCTCCTCAGAGATAAGTTTCTGCTCGGCGCCGGTGGAGTGGCGGCCC

  • P11: AAAAGGATCCCTCGAGCCACCATGGCTCCTAAGAAAAAGAGAAAGGT

  • P12: AAAAGGATCCCTAGGGCCCAGGGTTGGACTCGACG

  • P13: AAAAGGATCCACTAGTCCACAATGATTCATACCAACTTGAAGAAAAAG

  • P14: GATGACGTCCTCGGAGGAGGCCATAGTCGAGCCGGTAACGGTTCCATTTG AAACAAGTTC

  • P15: GGCTCGACTATGGCCTCCTCCGAGGACGTCATC

  • P16: AAAATCTAGACAAATCCTCCTCAGAGATAAGTTTCTGC

  • P17: AGTCCAACCCTGCAGCTATGAAGACTAATCTTTTTCTCTTTCTCATC

  • P18: AGATTAGTCTTCATAGCTGCAGGGTTGGACTCGACGTCTCCCG

  • P19: AAAGGATCCTTGAGCTCCGGTCGACGGCGCGCCGGGCCCAGGGTTGGACTCGACG

  • P20: AAAAGGCGCGCCGATGGCTCCTAAGAAAAAGAGAAAG

  • P21: TTTGGATCCTACTTATCGTCATCATCCTTATAATCGGCGCCGGTGGAGTGGCGG

  • P22: GTCGAGTCCAACCCTGGGCCCATGAATCCTGAGTACGACTATCTTTTC

  • P23: ATCTAGGATCCTCAAGTTGAGCAGCAGCCGTTCTTCTGTGCC

  • P24: AAATCTAGAGGAGCATGCCAGCTGTTGAATTTTG

  • P25: AAAACTCGAGACTAGTGTCGACCATGGCCTCCTCCGAGGACGTCATCAAG

  • P26: CAACAGCTGGCATGCTCCTCTAGAGGCGCCGGTGGAGTGGCGGCCC

  • P27: GGGCCGCCACTCCACCGGCGCCTCTAGAGGAGCATGCCAGCTGTTG

Plant material and Agrobacterium tumefaciens-mediated transient expression

Transient expression or co-expression of the constructs in tobacco (Nicotiana tabacum, cv Petit Havana) leaf epidermal cells was performed as described in Batoko et al. (6) and modified according to Zheng et al. (3). Unless otherwise stated, the bacterial OD600 used for infiltration of the lower epidermis was 0.05–0.06 for the fluorescent 2A markers and 0.015–0.03 for the Rab constructs.

Arabidopsis thaliana (ecotype Columbia-0) transgenic lines expressing the fluorescent 2A markers were generated by Agrobacterium-mediated transformation using the vacuum infiltration method described by Bechtold et al. (45). Transgenic plants were selected on Murashige and Skoog (MS) medium (46) (SIGMA-Aldrich, Poole, UK) containing 15 μg/ml hygromycin (Calbiochem, San Diego, CA, USA). Plants were grown either on the MS medium or in soil at 20–22°C under 16-h photoperiod.

Protein extraction and immunoblot analysis

Proteins were extracted from tobacco leaf samples (52–60 h after Agrobacterium infiltration) or whole Arabidopsis seedlings (approximately 100 mg of fresh tissue) by homogenization in two volumes of the extraction buffer: 50 mm sodium citrate, pH 5.5, 150 mm NaCl, 5% SDS (w/v), 0.01% BSA (w/v), 2% β-mercaptoethanol and 17 μl protease inhibitor cocktail (Sigma) per 1 ml of the buffer. The homogenate was boiled for 10 min and cleared by centrifugation at 4°C. The supernatant was transferred to a microcentrifuge tube and stored on ice. Aliquots were frozen in liquid N2 and stored at −80°C until used. Before loading, 5–10 μl of a sample was mixed with a 1–2 μl loading dye and heated to 55–60°C for 5 min. SeeBlue Plus2 (Invitrogen) was used as a pre-stained marker to identify the size of the proteins. Protein samples were first separated on a 12% polyacrylamide gel, electrotransferred onto a polyvinylidene fluoride membrane, blocked and detected as described in Batoko et al. (6). Antisera to full-length GFP (Molecular Probes, Leiden, The Netherlands) or anti-c-myc (Covance, Berkeley, CA, USA) were used at 1/1000 dilution to probe the membrane overnight at 4°C. Alkaline phosphatase-conjugated secondary antibodies (anti-rabbit IgG or anti-mouse IgG; Sigma) were used at 1/10 000 dilution for 1-h incubation at room temperature.

Sampling and confocal imaging

Unless otherwise stated, 52–60 h after tobacco leaf infiltration with Agrobacterium strains, lower epidermis was analysed with a Zeiss LSM 510 META laser-scanning microscope (Carl Zeiss Ltd., Welwyn Garden City, Herts, UK) as described in Zheng et al. (3). Detector gains were set to avoid saturation in the brightest samples in the experiment and amplifier offset was set to minimize pixels with a value of 0 in the vacuoles of the dimmest samples. For quantification of fluorescence intensities at low magnification, the average GFP and YFP pixel intensity was measured in at least nine images of each sample using the Histogram function of the Zeiss AIM software version 3.0 or 3.2. Background fluorescence was similarly estimated from nine images of un-infiltrated areas of the leaf.

For simultaneous imaging of mGFP5, mRFP1 and YFP in tobacco leaf epidermis, two different triple-track line-sequential imaging configurations were used. For the images in Figure 8E–H, we used a HFT458/543 primary dichroic mirror to reflect excitation wavelengths; a NFT635vis secondary dichroic mirror to split emission between channel 1 (long wavelength) and channels 2 and 3 and a NFT515 dichroic mirror to split emission between channels 2 (short wavelength) and channel 3; mGFP5 emission was detected in channel 2 using a BP475-525 filter, YFP in channel 3 using BP535-590IR filter and mRFP1 in channel 1 using the 592–635 nm range of the META detector; in track 1 mRFP1 was detected using 543-nm excitation from a HeNe laser with channel 1 active, in track 2 YFP was detected using 514-nm excitation from an Argon laser with channel 3 active and in track 3 mGFP5 was detected using 405-nm excitation from a blue diode laser with channel 2 active. For the images in Figure 4I–P and for the quantitative analysis presented in Figure 8D and I, we used a NT80/20 mirror to reflect excitation wavelengths; a NFT545 secondary dichroic mirror to split emission between channel 1 (long wavelength) and channels 2 and 3, and a NFT515 dichroic mirror to split emission between channels 2 (short wavelength) and channel 3; mGFP5 emission was detected in channel 2 using a BP500/20IR filter, YFP in channel 3 using BP535-590IR filter and mRFP1 in channel 1 using the 581–635 nm range of the META detector; in track 1 mRFP1 was detected using 543-nm excitation from a HeNe laser with channel 1 active, in track 2 YFP was detected using 514 nm line of an Argon laser with channel 3 active and in track 3 mGFP5 was detected using the 458 nm line of an Argon laser with channel 2 active. Scatter plots with colour-coded frequencies were generated using the default parameters in the co-localization function of Zeiss AIM software version 3.2.

Ratiometric analysis of single cells using nlsRm-2A-secGf and nlsRm-2A-GH

For quantitative analysis, the imaging parameters were set to avoid saturation in the brightest cells in an initial survey of the transfected population. The 3D image stacks were collected with pixel spacing of 0.3 × 0.3 × 2 or 0.22 × 0.22 × 1 μm in x, y and z, respectively, and imported into the Matlab environment (The MathWorks, Natick, MA, USA). Images were spatially averaged with a 3 × 3 × 5 kernel in x, y and z, respectively, and then visualized as a maximum brightness projection. The location of the brightest pixel in z was also recorded. In the nuclear region, this value typically corresponds to the mid-plane of the nucleus where the brightest intensities occur. The average RFP and YFP signals were measured from the nucleus of selected cells using at least three manually defined seed pixels. The seed pixel was also used as an anchor point in x, y and z for transects with a 3 × 3 spatially averaged kernel from a single z-plane to manually defined end-points in the adjacent vacuole. Each transect thus spanned the nuclear envelope and a thin layer of cytoplasm adjacent to the nucleus. The level of ER-localized GFP was estimated from the average of the brightest features along each transect. Analysis was confined to cells whose nuclei exhibited nuclear RFP fluorescence in the range 90–240 (8-bit data) to ensure sufficient marker expression for quantification of secGFP accumulation while avoiding saturation. Similarly, cells exhibiting YFP values above 240 were not considered in the analysis. A bleed-through correction for YFP emission in the GFP detection channel was determined from cells expressing the AtRAB-D2a-YFP fusion at various intensities, in the absence of the ratiometric nlsRm-2A-secGf fusion, that is, cells with nuclear nlsRFP pixel intensity at near background levels.

The GFP-HDEL signal was measured using the same approach from cells transfected with nlsRm-2A-GH, as this approximates the maximum signal possible for a probe that is retained in the ER. To bring this signal into the same range as the test constructs, images were acquired using twofold lower 458-nm excitation intensity (for the GFP-HDEL signal) and twofold-higher 543-nm excitation intensity (for the mRFP1 signal). As fluorescence brightness scales linearly with changes in laser intensity, the corresponding ratio was multiplied by a factor of 4. As both the secGf and the GFP-HDEL signals were corrected for the overall expression level from their corresponding nlsRFP signal, it was possible to express the effect of the Rab constructs on secGf accumulation as a fraction of the maximum GFP-HDEL signal.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References

We are grateful to Dr Claire Halpin, University of Dundee, for providing a cloned 2A sequence and for helpful discussions; to Dr Martin Ryan, University of St. Andrews for sharing information prior to publication; to Dr Julia Legen, University of Oxford, for providing secN-Rm-2A-secGf and secN-Rm-2A-GH; to three undergraduate students, Mariana Morales (for help with constructing the AtRAB-D2a-YFP fusions), Robert Langford (for early studies with the single T-DNA approach), and Jennifer Robertson (for help with early stages of 2A plasmid construction and ratiometric imaging); to Pauline White and Caroline O’Brien for technical assistance; to Dr Dan Bebber, University of Oxford, for advice on statistical analysis and to Dr J. Perez-Gomez, University of Oxford, for helpful comments on the manuscript. This work was supported by BBSRC grant 43/C13425 to I. M. and M.D.F.

References

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and Methods
  6. Acknowledgments
  7. References