Reduction in miR-141 is Induced by Leukemia Inhibitory Factor and Inhibits Proliferation in Choriocarcinoma Cell Line JEG-3

Authors

  • Diana M. Morales-Prieto,

    1. Klinik für Frauenheilkunde und Geburtshilfe, Abteilung für Geburtshilfe, Placenta-Labor, Friedrich-Schiller-Universität Jena, Jena, Germany
    Search for more papers by this author
  • Ekkehard Schleussner,

    1. Klinik für Frauenheilkunde und Geburtshilfe, Abteilung für Geburtshilfe, Placenta-Labor, Friedrich-Schiller-Universität Jena, Jena, Germany
    Search for more papers by this author
  • Udo R. Markert

    1. Klinik für Frauenheilkunde und Geburtshilfe, Abteilung für Geburtshilfe, Placenta-Labor, Friedrich-Schiller-Universität Jena, Jena, Germany
    Search for more papers by this author

Udo R. Markert, Klinik für Frauenheilkunde und Geburtshilfe, Abteilung für Geburtshilfe, Placenta-Labor, Friedrich-Schiller-Universität Jena, Bachstr. 18, 07743 Jena, Germany.
E-mial: markert@med.uni-jena.de

Abstract

Citation Morales-Prieto DM, Schleussner E, Markert UR. Reduction in miR-141 is Induced by Leukemia Inhibitory Factor and Inhibits Proliferation in Choriocarcinoma Cell line JEG-3. Am J Reprod Immunol 2011; 66 (Suppl. 1): 57–62

Problem

Starting from the peri-implantation period, leukemia inhibitory factor (LIF) is a major regulator of trophoblast functions. Micro-RNAs (miRNA) are short non-coding RNA sequences, which regulate expression of genes at post-transcriptional level. The influence of LIF on miRNA expression in trophoblastic cells has not yet been analyzed and was focus of this investigation.

Method of study

JEG-3 choriocarcinoma cells have been stimulated with LIF for 1, 2, 4, 6, and 24 hr. The expression of miR-9, miR-141, miR-21, miR-93, and let-7g has been analyzed by real-time PCR. Subsequently, miR-141 has been silenced and over-expressed to test its role in the proliferation of JEG-3 cells after 24 and 48 hr.

Results

MiR-141 has been significantly downregulated by more than 50% after LIF stimulation, while miR-21 and miR-93 expression has been significantly upregulated. Silencing of miR-141 completely inhibited the proliferation of JEG-3 cells, while over-expression had no effect.

Conclusion

LIF regulates expression of miRNA in trophoblastic cells, which may be responsible for several functional effects induced by LIF.

Introduction

Leukemia inhibitory factor (LIF) induces tyrosine phosphorylation of signal transducer and activator of transcription 3 (STAT3) in several trophoblast and choriocarcinoma cell types and lines (summarized in1). This event triggers several trophoblastic functions, such as migration, invasion or induction and suppression of expression of a variety of genes.2,3 Because functional effects have been observed after several days, it cannot be excluded that parts thereof are secondary or indirectly induced. We argue that micro-RNA (miRNA) may be involved in the regulation of these previously observed LIF-induced functions. For this reason, we have selected a panel of five miRNAs which have been described to influence STAT3 expression or which are known to be expressed on full activation of STAT3.

MiRNAs constitute a novel group of regulatory molecules that play a pivotal role in the control of gene expression at post-transcriptional level. The number of miRNAs described thus far arises approximately 1000 (MiRBase V16), which may regulate up to 30% of the human genome.4 The signature of miRNA expression is regulated in a tissue- and developmental stage-specific manner, and thereby, it may be used as a biomarker for the identification of certain physiological or pathological events including malignancies. Current reports have demonstrated specific patterns of miRNAs regulating changes in uterine gene expression5,6 or miRNAs that are specifically expressed in embryonic stem cells and whose expression is altered during embryonic development.7 Likewise, some miRNAs are found less expressed in choriocarcinoma cells than in normal trophoblast, which suggests a role in carcinogenesis.8

We focused on five miRNAs previously published to correlate with tumor grade, to be implicated in pregnancy, or to be related with members of the signaling intracellular cascade of LIF. For instance, miR-141, belonging to the miR-200 cluster, is found upregulated in nasopharyngeal and ovarian carcinomas in comparison with normal tissues and correlates with poor prognosis.9,10 As biological marker, levels of miR-141 are increased in plasma from pregnant women.11 Also, expression of miR-9 may serve as a biomarker, which correlates with tumor grade and metastatic status in breast and cervical cancer.12,13 Its inhibition results in increased levels of phospho-STAT3 in embryonic stem cells.14 Among the miRNAs selected for the present investigation, to date, miR-21 is the most extensively studied. Because of its over-expression in at least six different solid cancers (lung, stomach, prostate, colon, pancreas, and breast), it has been considered an oncomir (reviewed in15). MiR-21 can be induced by STAT3.7 Mir-93 seems to be related with the trophoblast response to hypoxia as it is upregulated in hypoxic trophoblast cells.16 MiR-93 shares some features with miR-141 and miR-21 as they all are expressed in human embryonic stem cells, but their effects in cell maintenance or differentiation seem to be dissimilar. While miR-93 expression remains similar also in adult tissue, miR-141 attenuates differentiation and miR-21 expression intensifies it.17–20 Finally, we selected let-7g, a member of one of the currently most important miRNA families (let-7), which is aberrantly expressed in human cancer.21 Let-7g and also miR-21 were expressed in vitro as well as in vivo via STAT3 activation after IL-6 stimulation.22

Although the LIF-induced STAT3 activation in trophoblastic cells seems to be crucial for many cell functions, thus far, the LIF-induced miRNA expression in these cells has not yet been investigated. Therefore, in the present study, we aim to analyze the kinetics of the expression of miR-9, miR-21, miR-93, miR-141, and let-7g after LIF treatment in JEG-3 cells. Being the most affected, influence of miR-141 on proliferation has been analyzed by its experimental over-expression and silencing.

Materials and methods

Cell Cultures

JEG-3 (DSMZ, Braunschweig, Germany) is an adherent human choriocarcinoma cell line preserving several trophoblast-like capacities including production of pregnancy-related hormones and cytokines. JEG-3 cells cultures were performed at 106 cells/175 cm2 flask and maintained under standard conditions (37°C, 5% CO2, humid atmosphere) in Ham’s F-12 Nutrient Mixture with l-glutamine (Gibco, Paisley, UK) supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco) and 1% penicillin/streptomycin antibiotic solution (Gibco).

Quantitative Real-time PCR

JEG-3 cells were seeded in 12-well plates, allowed to attach, and deprived of serum overnight. Thereafter, cells were challenged with 10 ng/mL LIF (Millipore, Schwalbach, Germany) up to 24 hr, and total RNA (containing miRNAs) was isolated with TRIzol (Invitrogen, Darmstadt, Germany). Mature miRNAs were reverse-transcribed, and real-time PCR was performed using TaqMan miRNA assays with specific primers for the selected miRNAs (Applied Biosystems, Darmstadt, Germany; see Table I). Each real-time PCR was performed in duplicates, including no-template controls. For normalization, several endogenous controls were tested, and RNU48 was selected after showing high stability and expression in our model. Fold changes were determined using the ‘delta-delta Ct’ method relative to the expression at the beginning (0 hr) before LIF stimulation was initiated. The experiments were repeated independently five times for miR-9, miR-141, and let-7g and four times for miR-21 and miR-93. Differences in the quantified gene expression were statistically assessed using the non-parametric Wilcoxon test and considered significant when < 0.05.

Table I.   MiRNA Assays Used for qRT-PCR (Applied Biosystems)
Assay IDAssay nameTarget sequence
002282hsa-let-7gUGAGGUAGUAGUUUGUACAGUU
000397hsa-miR-21UAGCUUAUCAGACUGAUGUUGA
001090mmu-miR-93CAAAGUGCUGUUCGUGCAGGUAG
000463hsa-miR-141UAACACUGUCUGGUAAAGAUGG
000583hsa-miR-9UCUUUGGUUAUCUAGCUGUAUGA
001006RNU48GAUGACCCCAGGUAACUCUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC

Over-expression and Silencing of miR-141

Anti-miR™ miRNA inhibitors are single-stranded nucleic acids specifically designed to bind and to inhibit endogenous miRNA molecules. Conversely, Pre-miR™ miRNA precursor molecules are double-stranded RNA molecules, which mimic endogenous mature miRNA. Owing to their small size, all these molecules can be easily delivered into the cells using transfection reagents similar to those used for small interfering RNA transfection.

To determine the effect of miR-141 on cell proliferation, JEG-3 cells were transfected with either anti-miR inhibitors or pre-miR precursors specifically designed for miR-141 or the respective non-genomic negative controls (assays IDs: AM10860, AM17010, PM10860, AM171010; Applied Biosystems). Transfection was performed by applying Nanofectin (PAA, Cölbe, Germany) as follows: 24 hr before transfection, cells were seeded in 12-well plates to obtain a 70–80% of confluence the day of transfection. The following day, two solutions were prepared: (1) Three microlitres of either anti- or pre-miR solution (5 μm each) was diluted in 32 μL serum-free medium. (2) Three microlitres of nanofectin was diluted in 30 μL of serum-free medium. Solutions 1 and 2 were mixed and incubated for 30 min at room temperature. Subsequently, the mix was added into the wells containing the cells in 500 μL serum-free medium and incubated at 37°C for 4 hr. Transfection was terminated by the addition of 250 μL of medium supplemented with 30% FCS. The next morning, cells were trypsinized and seeded into 96-well plates (1 × 104 cells/well).

Proliferation Assay

Cell proliferation was analyzed using a Cell Titer AQeous MTS assay (Promega, Mannheim, Germany) according to the manufacturer’s instructions. Assays were commenced with 1 × 104 cells in 96-well plates, and cells initiated spontaneous proliferation. After 0- (basal value), 24-, and 48-hr incubation, proliferation was measured by adding methyl tetrazolium salt (MTS) solution 20 μL/well and measuring the absorbance at 490 nm. Three independent cultures have been performed for each time point. Differences in the quantified proliferation rates of JEG-3 cells were statistically assessed by Student’s t-test and considered significant when < 0.05.

Results

MiRNA Expression Kinetics After LIF Stimulation

JEG-3 cells were stimulated up to 24 hr with 10 ng/mL LIF, and the expression of miRNAs was assessed at five different time points by real-time PCR. LIF stimulation significantly reduces the expression of miR-141 after 4 and 6 hr compared with the respective basal expression levels. MiR-93 increases at all time points (significantly after 2 and 24 hr of LIF stimulation up to 9.2-fold), and miR-21 increases significantly after 1, 6, and 24 hr with a maximum of 19.8-fold. After 4 hr of LIF stimulation, miR-21 expression is significantly reduced compared with that at the aforementioned time points. This strong reduction has been obvious in each individual experiment. All other changes, including the 2.3-fold increase in let-7g expression at 2 hr LIF stimulation, were not significant (Fig. 1).

Figure 1.

 Normalized expression kinetics of miRNAs after leukemia inhibitory factor (LIF) induction. JEG-3 cells were stimulated with LIF (10 ng/mL), and miRNA gene expression was measured by real-time PCR at several time points. Results were normalized to the basal (0 hr) expression levels of the respective miRNAs and are expressed as mean. Error bars show standard error of the mean. = 5 independent experiments for miR-9, miR-141, and let-7g, = 4 for miR-21 and miR-93. Values for the exceeding bars and SE are shown respectively on the left side. *< 0.05 (Wilcoxon test) compared with initial values (0 hr); §< 0.05 compared with values at 1, 6, and 24 hr.

Effects of miR-141 Silencing and Over-expression on Proliferation

Because we have observed the most stable LIF-induced changes in miR-141, we decided to analyze its impact on proliferation by silencing and over-expression in JEG-3 cells. Transfection of JEG-3 cells with control substances reduces proliferation at all analyzed time points. Only silencing of miR-141 leads to a block of proliferation, when compared with its respective control, and is, after 48 hr, approximately 50% lower than in cells transfected with a non-genomic control sequence. In all other settings, proliferation is time-dependent. Over-expression of miR-141 does not lead to a further increase in proliferation (Fig. 2).

Figure 2.

 Impact of miR-141 on JEG-3 proliferation. JEG-3 cells were transfected with either pre- or anti-miRNAs, and cell proliferation was measured by MTS at 0, 24, and 48 hr. Results are expressed as mean of three independent experiments. Error bars show standard error. *< 0.05 (Student’s t-test).

Discussion

We have observed a significant influence of LIF on the expression of the miRNAs miR-21, miR-93 (upregulation), and miR-141 (downregulation). The strongest effects were observable 4 and 6 hr after stimulation with LIF when miR-141 was downregulated by far more than 50%. A surprising result was the downregulation of miR-21 after 4 hr of LIF stimulation compared with the earlier and later analyses. Silencing of miR-141 inhibits proliferation of JEG-3 cells, while over-expression does not further induce proliferation. To the best of our knowledge, thus far, no studies have been published on LIF-induced miRNA in any cell type, but several STAT3-induced miRNAs have been described. LIF is well known to phosphorylate and activate STAT3 in a variety of cells including trophoblastic cells, where it induces invasiveness.3

In our experiments, LIF stimulation of JEG-3 cells significantly increased miR-21 expression. This is compatible with previous reports that in head and neck carcinoma, osteosarcoma, ovarian carcinomas, and others, miR-21 promotes proliferation, migration, and invasion.23–25 The significant downregulation of miR-21 after 4 hr of stimulation may be attributable to the initiation of negative intracellular feedback mechanisms, such as induction of suppressors of cytokine signaling 3, but which may then again be overcome by the permanence of LIF stimulation.26 Let-7g was slightly, but not significantly, increased after LIF stimulation, which is in contrast to previous descriptions on let-7g in cancer. In hepatocellular carcinoma, ectopic expression of let-7g inhibits cell migration and growth.27 In gastric cancer, low let-7g is associated with unfavorable outcome in overall survival independent of clinical covariates, including depth of invasion, lymph-node metastasis, and stage.28 LIF-stimulated JEG-3 cells expressed significantly higher levels of miR-93, which is in line with previous observations on tumors. In human glioblastoma, miR-93 suppresses integrin-β8 expression, which promotes tumor growth and angiogenesis.29 In human T-cell leukemia virus 1, miR-93 targets the mRNA for tumor protein 53–induced nuclear protein 1 (TP53INP1), which is a tumor suppressor protein.30 In our experiments, miR-9 did not change considerably. In human embryonic stem cell-derived neural progenitors, loss of miRNA-9 reduces proliferation and increases migration.31 On the other hand, miR-9 targets E-cadherin, which is a suppressor of metastasization and angiogenesis. Its high expression in breast cancer is correlated with the malign properties.32

In JEG-3 cells, LIF significantly downregulated miR-141. Repression of miR-141 induces invasiveness of breast cancer cells by targeting the endothelial mesenchymal transition activators ZEB1 and ZEB2, which downregulate E-cadherin expression.18 Also in colorectal cancer, miR-141 negatively correlates with migration and invasion.9 A different function has been observed for miR-141 in gastric cancer cells, where its over-expression by the application of its precursors inhibited the proliferation.33 In contrast, it is upregulated in nasopharyngeal carcinoma, where it positively correlates with proliferation, migration, and invasion.34 In our hands, silencing of miR-141 inhibits proliferation of JEG-3 choriocarcinoma cells, which goes in line with these results. The observed strong impact of LIF on various miRNA in JEG-3 choriocarcinoma cells underlines the expected involvement of miRNAs in the regulation of essential functions in trophoblastic cells and thus in tuning placentation and other crucial processes in reproduction and pregnancy.

Acknowledgements

The project has been supported by the German Research Foundation (DFG, project Ma1550/7-1). DMMP has a Ph.D. grant from the regional graduate academy of the Friedrich-Schiller-University Jena, Germany.

Ancillary