SEARCH

SEARCH BY CITATION

Keywords:

  • Dendritic cell;
  • IL-10;
  • NKT cell;
  • tolerance

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

The mechanism by which CD1d-restricted Vα14 natural killer T (NKT) cells participate in transplant tolerance has yet to be completely clarified. Recently, we showed that repeated activation of NKT cells by their specific glycolipid ligand, α-galactosylceramide, leads to a change in function to an immune regulatory role with IL-10 production. Moreover, these cells were shown to be able to induce regulatory dendritic cells (DCs). In this study, we showed that NKT cells from transplant tolerant recipients of cardiac allograft produced higher levels of IL-10, which is required for the maintenance of tolerance; this was proved by adoptive transfer experiments. In addition, DCs from wild-type (WT) tolerant recipients but not NKT cell-deficient recipients showed a higher IL-10-producing profile, a more immature phenotype, and tolerogenic capability. CD4 T cells from WT tolerant recipients but not NKT cell-deficient recipients also produced higher levels of IL-10 upon alloantigen stimulation and showed lower proliferative activity that was reversed by blocking the IL-10 receptor. These data indicate the existence of IL-10-dependent immune regulatory interplay among NKT cells, DCs, and CD4 T cells, even in the absence of artificial stimulation of NKT cells with synthetic glicolipids, which is required for the maintenance of transplant tolerance.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

CD1d-restricted Vα14 natural killer T (NKT) cells are a unique lymphoid lineage that play a critical role in various immune regulations (1,2). Previously, we showed that NKT cells are required for the maintenance of costimulation blockade-induced transplant allograft tolerance (3). Similarly, Ikehara et al. (4) demonstrated that NKT cells are essential for the acceptance of xenogenic islets treated with anti-CD4 mAb. Furthermore, Sonoda et al. (5) reported that the long-term survival of corneal allografts is dependent on NKT cells. As for the underlying mechanism, we demonstrated that CXCL16/CXCR6 interaction can direct the recruitment and retention of NKT cells within cardiac allografts through its dual function in migration, due to its soluble form, and adhesion, due to its mucin-like stalk (6). However, although we demonstrated the role of a chemokine/receptor interaction in NKT cell-mediated transplant tolerance, the precise mechanism is yet to be completely clarified.

The ligands for NKT cells are glycolipids, including α-galactosylceramide (α-GalCer) and isoglobotrihexosylceramide (iGb3) (1,7,8). Upon stimulation, NKT cells rapidly produce a large number of cytokines, including IFN-γ, IL-4, and IL-10 (1,2), which have been shown to be involved in various NKT cell-mediated immune responses (9–11). However, whether the cytokines secreted from NKT cells are required for the maintenance of transplant tolerance remains unknown.

Recently, we showed that repeated stimulation of NKT cells with α-GalCer alters their cytokine profile to a low IFN-γ content, but IL-10 levels remain unaltered (12). This IL-10 production by NKT cells is essential for generating regulatory dendritic cells (DCs) that produce higher levels of IL-10 and reduced levels of IL-12 (12). Further, the induced regulatory DCs could generate IL-10-producing regulatory CD4 T cells when adoptively transferred (12). However, it remains unclear whether a similar NKT cell- and IL-10-dependent cellular cascade operates in a same host without the adoptive transfer, and whether the mechanism functions in the absence of treatment with artificial NKT cell stimulants such as α-GalCer.

To explore these issues, this study investigated the cytokine profile and regulatory activity of NKT cells, DCs, and CD4 T cells in cardiac transplant recipients. We found that NKT cells from tolerant mice induced by CD40 ligand (CD40L) blockade showed higher IL-10 production. The adoptive transfer of NKT cells from wild-type (WT) mice but not IL-10-deficient (IL-10 KO) mice was found to prolong allograft survival in Vα14 NKT cell-deficient (NKT KO) recipients in which the Jα18 (formerly designated Jα281) gene of the T cell receptor was destroyed (13). Moreover, in NKT cell-competent tolerant recipients, tolerogenic DCs that produced higher levels of IL-10 and suppressed the allogeneic CD4 T cell proliferative response were induced. CD4 T cells from the tolerant recipients but not the NKT KO recipients also produced higher levels of IL-10 and showed lower proliferation when stimulated with alloantigen. In summary, we demonstrated an IL-10-dependent regulatory mechanism by which NKT cells mediate transplant tolerance.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

Mice

WT C57BL/6 (B6) (H-2b) and BALB/c (H-2d) mice were purchased from Japan Clea (Hamamatsu, Japan). NKT KO (Jα18−/-) (13), IL-4 KO (14), IL-10 KO (15), and IFN-γ KO (16) mice, described elsewhere, were backcrossed to the B6 mice for more than nine generations. All mice were bred and maintained in our animal facilities under specific pathogen-free conditions and used at 6–10 weeks of age. The animals were used in accordance with the guidelines of the RIKEN Research Center for Allergy and Immunology, and the study was approved by the animal committee of RIKEN.

Reagents

Fluorescence-conjugated or -unconjugated mAbs against mouse CD4 (GK1.5), CD11c (HL3), CD16/CD32 (2.4G2), CD40 (HM40-3), CD80 (16-10A1), CD86 (GL1), CD40L (MR1), NK1.1 (PK136), I-Ab (AF6-120.1), TCRβ (H57-597), IL-4 (11B11), and IL-10R (1B1.3a), and control rat IgG1 (A110-1) were purchased from BD Biosciences (San Jose, CA). PE-conjugated mouse CD1d tetramer was generated as described previously (12). α-GalCer was kindly provided by Kirin Brewery. Anti-NK1.1, anti-CD11c, and anti-CD90 microbeads were purchased from Miltenyi Biotec (Bergisch-Gladbach, Germany). CpG (TCCATGACGTTCCTGATGCT) was synthesized in Hokkaido System Science (Sapporo, Japan). Thymidine was purchased from Amersham Biosciences (Buckinghamshire, UK)

Cardiac transplantation

WT BALB/c or B6 mice were used as donors, while WT or NKT KO, IL-4 KO, and IL-10 KO B6 mice were used as recipients. Intra-abdominal heterotopic heart transplantation was performed according to the technique described previously (17). Rejection was defined as the complete cessation of palpable beat and was confirmed by direct visualization after laparotomy. For tolerance induction, the recipients were intravenously (i.v.) injected with 0.25 mg/mouse of anti-CD40L mAb on day 0 and intraperitoneally (i.p.) injected on days 2 and 4 post-transplant.

Cytokine production

Single cell suspensions were prepared from the spleens of syngeneic recipients at day 60 post-transplant, allogenic WT B6 recipients without any treatment (reject) at day 8 post-transplant, allogenic WT B6 recipients with the treatment of anti-CD40L mAb (tolerant) at day 60 post-transplant, or allogenic NKT KO B6 recipients with the treatment of anti-CD40L mAb at day 30 post-transplant. DCs, NKT cells and CD4 T cells were sequentially sorted from the pooled spleen cells from three mice as follows: DCs were sorted by using autoMACS® (Miltenyi Biotec), and then NKT cells and CD4 T cells were sorted by using Moflo® (Cytomation, CO), according to the manufacturer's instructions. DCs, NKT cells and CD4 T cells were defined as CD11c+, CD1 tetramer+/TCRβ+ and CD4+, respectively. The resulting purity of CD11c+ cells was >96%, and that of NKT and CD4 T cells was >98%. Thus, the CD4 T cell fraction contains very few NKT cells, and vice versa.

NKT cells (2 × 104/well) were cocultured with 35 Gy-irradiated T-cell-depleted (using MACS®) splenocytes from NKT KO mice (8 × 104/well) in 96-well round bottom plates for 3 days. The stimulator cells were pulsed with 100 ng/mL of α-GalCer for 4 h before the irradiation. DCs (1 × 105/well) were stimulated with 1 μM of CpG in the 96-well round bottom plates for 2 days. CD4 T cells (1 × 105/well) were cocultured with 35 Gy-irradiated T-cell-depleted splenocytes from WT BALB/c mice at a cell number ratio of 1:2 in the 96-well round bottom plates for 4 days. IL-4, IFN-γ, IL-10 or IL-12 level in the supernatant was evaluated using a standard sandwich ELISA (BD Biosciences), according to the manufacturer's instructions.

Preparation and adoptive transfer of NK1.1+ cells

The spleens of WT, IL-4 KO, IL-10 KO, IFN-γ KO or NKT KO B6 mice were removed. NK1.1+ cells were enriched using autoMACS® in accordance with the manufacturer's protocol. In all the experiments, the resulting purity of NK1.1+ cells was >97%, and the percentage of NKT cells was 36–44% in the NK1.1+ fraction isolated from WT, IL-4 KO, IL-10 KO or IFN-γ KO B6 mice. NK1.1+ cells (3 × 106) were i.v. injected into the NKT KO B6 recipients 1 day before heart transplantation. Anti-CD40L mAb was injected as described above.

Surface phenotype of DCs

Splenic CD11c+ DCs were sorted using autoMACS®. After incubation with anti-CD16/CD32 for 10 min, the DCs were stained with PE-conjugated anti-CD11c mAb and APC-conjugated anti-CD40, CD80, CD86 or I-Ab mAb. Subsequently, these cells were analyzed using FACS Calibur® (Becton Dickinson, San Jose, CA).

Mixed leukocyte reaction

For examining the tolerogenic property of DCs, CD4 T cells (1 × 105/well) from naïve WT or NKT KO B6 mice were cocultured with 35 Gy-irradiated T-cell-depleted splenocytes isolated from WT BALB/c mice at a cell number ratio of 1:2 in the 96-well round bottom plates. DCs from B6 recipients were added at a concentration of 1 × 104/well at the beginning of the mixed leukocyte reaction (MLR). In some wells, anti-IL-10 receptor (IL-10R) mAb (10 μg/mL) or control rat IgG1 (10 μg/mL) was added. The proliferative responses of CD4 T cells were measured after 7 days by assessing the amount of thymidine incorporated in the last 8 h of culture.

For examining their proliferative activity, CD4 T cell samples were prepared from B6 recipients as described above. CD4 T cells (1 × 105/well) were cocultured with 35 Gy-irradiated T-cell-depleted splenocytes from the WT BALB/c mice at the indicated cell number ratio in the 96-well round bottom plates for 5 days. The proliferative responses were measured by assessing the amount of thymidine incorporated in the last 8 h of culture. Anti-IL-10R mAb (10 μg/mL), anti-IL-4 mAb (10 μg/mL) or control rat IgG1 (10 μg/mL) was added to some of the wells in the 96-well round bottom plates to examine the effect of these cytokines on the proliferative activity.

Statistical analysis

Comparisons were performed using Student's t test or Mann-Whitney U test. A value of p≤0.05 was considered as significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

IL-10 produced by NKT cells is required for maintaining transplant tolerance

IFN-γ, IL-4 and IL-10 have been shown to be involved in various NKT cell-mediated immune responses (9–11). Therefore, we first examined the cytokine profile of NKT cells in the cardiac transplant recipients. For this, we obtained NKT cells from the spleens of recipients who underwent syngeneic or allogeneic cardiac transplantation with or without anti-CD40L mAb treatment. The isolated NKT cells were stimulated with α-GalCer in vitro then their cytokine production was examined. We found that NKT cells from tolerant recipients produced higher levels of IL-10 and IL-4 and lower levels of IFN-γ than those from syngeneic and allogeneic recipients who showed rejection (Figure 1).

image

Figure 1. NKT cells from tolerant mice produce lower lety levels of IFN-γ and higher levels of IL-10. Syngeneic heart transplantation, allogeneic heart transplantation without any treatment, and allogenic heart transplantation with the anti-CD40L mAb treatment were performed and the spleens were harvested at the indicated time points as described in Materials and Methods. NKT cells were isolated from the spleens of the recipients; subsequently, these NKT cells were stimulated with α-GalCer-pulsed APC for 3 days. IL-4, IFN-γ, and IL-10 production was evaluated in the supernatants using a standard sandwich ELISA. **p<0.01 as compared with ‘Reject’ group. Pooled samples from three mice per group were analyzed and each bar represents mean ± SD of triplicate well. Representative data from three independent experiments are shown.

Download figure to PowerPoint

Next, we examined the manner in which these changes in the NKT cell cytokine profile affect transplant tolerance. We prepared an NKT cell-containing population (NK1.1+ cells) from WT, IL-4 KO, IL-10 KO, IFN-γ KO or NKT KO mice then adoptively transferred them into NKT KO recipients. The percentage of NKT cells in the NK1.1+ population was 36–44%, and there was no change in the number of NKT cells harvested from the cytokine KO mice compared with the WT mice (data not shown). Because the adoptive transfer of NK cells alone (NK1.1+ cells from NKT KO mice) did not affect cardiac allograft survival in the NKT KO recipients (Figure 2), these NK1.1+ cells could be assumed to be the source of NKT cells. The adoptive transfer of NK1.1+ cells from the WT mice prolonged cardiac allograft survival in the NKT KO recipients (Figure 2) to a similar extent seen in WT recipients who underwent anti-CD40L mAb treatment (see Figure 5 or ref. 6). Prolonged survival was induced in the NKT KO recipients reconstituted with NK1.1+ cells from the IFN-γ KO or IL-4 KO mice (Figure 2), indicating that IFN-γ and IL-4 from NKT cells are not required for inducing and/or maintaining transplant tolerance (Figure 2). However, NK1.1+ cells from the IL-10 KO mice did not restore the capacity for inducing and/or maintaining transplant tolerance in the NKT KO recipients (Figure 2). Thus, NKT cell-derived IL-10 is essential for the induction and/or maintenance of transplant tolerance.

image

Figure 2. NKT cell-derived IL-10 is required for transplant tolerance. Heart transplantation was performed using WT BALB/c mice as donors and NKT KO B6 mice as recipients. The NKT KO recipients were adoptively transferred with 3 × 106 NK1.1+ cells that were isolated from the indicated mice 1 day before the heart transplantation. Data of recipients with no transfer is also shown. Anti-CD40L mAb was used to induce transplant tolerance as described in Materials and Methods. *p<0.05 analyzed by Mann-Whitney U test. NS, not significant.

Download figure to PowerPoint

image

Figure 5. Cardiac allograft survival in IL-4 KO and IL-10 KO mice. Allogenic heart transplantation with the anti-CD40L mAb treatment was performed using WT BALB/c mice as donors and WT, IL-4 KO and IL-10 KO B6 mice as recipients. **p<0.01 analyzed by Mann-Whitney U test. NS, not significant.

Download figure to PowerPoint

Emergence of regulatory DCs in the tolerant recipients

To test whether DCs and CD4 T cells in tolerant recipients acquire a regulatory capacity in a NKT cell-dependent manner, we next examined these cells in the recipients. We obtained DCs from the spleens of recipients who underwent syngeneic or allogeneic (including WT and NKT KO) cardiac transplantation with or without anti-CD40L mAb treatment. DCs from tolerant (WT) recipients produced higher levels of IL-10 and lower levels of IL-12 following cytosine guanine sequence (CpG) stimulation in comparison with those from syngeneic and allogeneic recipients who showed rejection and did not receive any treatment (Figure 3A). When NKT KO mice that had received anti-CD40L mAb treatment but shown rejection (Figure 2 and ref. 6) were used as recipients, the IL-10 levels of DCs decreased while the IL-12 level increased compared with those of the DCs from tolerant WT recipients (Figure 3A). A similar cytokine profile was also obtained when a lipopolysaccharide (LPS) was used as a stimulant (data not shown). These results indicate that IL-10high IL-12low DCs are induced in tolerant recipients, and their presence is correlated with the existence of NKT cells.

image

Figure 3. Characteristics of DCs in tolerant mice. (A) Splenic DCs from B6 recipients were prepared using the procedure described in Materials and Methods. DCs were stimulated with 1 μM of CpG for 2 days, and IL-10 and IL-12 levels in the supernatants were evaluated using a standard sandwich ELISA. *p<0.05 and **p<0.01 as compared with that from allogenic NKT KO recipients. (B) Expression of CD40, CD80 and CD86 in splenic DCs which were isolated from different groups of B6 recipients. The gray histograms represent FACS pattern of unstained DCs. More than four mice per group were examined. Mean ± SD (n>4) of mean fluorescence intensity (MFI) of each histogram is also shown. *p<0.05 and **p<0.01. There were no significant differences between naïve and tolerant groups. (C) MLR of CD4+ T cells from naïve WT or NKT KO B6 mice against BALB/c alloantigen. DCs isolated from naïve or B6 recipients were added to the MLR. Proliferative responses of CD4 T cells were measured by assessing the amount of thymidine incorporated in the last 8 h of culture. Wells without CD4 T cells showed no thymidine incorporation. **p<0.01 as compared with that from allogenic NKT KO recipients. (D) Involvement of IL-10. In some wells of the MLR as in (C), control rat IgG1 (10 μg/mL, indicated by (−)) or anti-IL-10R mAb (10 μg/mL, indicated by (+)) was added. Proliferative response was measured as in (C). p<0.05. NS, not significant. In (A), (C) and (D), pooled samples from three mice per group were analyzed and each bar represents mean ± SD of triplicate well. Representative data from three independent experiments are shown.

Download figure to PowerPoint

We next examined the surface phenotype of DCs in the recipients. Observations revealed that DCs from the tolerant recipients expressed lower levels of costimulatory molecules, CD40, CD80 and CD86, than those from the NKT KO recipients that rejected the cardiac allografts even after anti-CD40L treatment (Figure 3B). However, the expression of MHC class II was not significantly different between these groups (data not shown). These data indicate that DCs from the tolerant recipients show a relatively immature phenotype that resembles that of naïve DCs, whereas those from NKT KO recipients show an activated phenotype (Figure 3B).

Using the MLR, we then investigated whether these IL-10high DCs from tolerant mice have tolerogenic capability. DCs from B6 recipients were added to a MLR comprising CD4 T cell responders from naïve WT B6 mice and T-cell-depleted irradiated splenocytes from BALB/c mice as the stimulator at the beginning of the MLR. The DCs from the tolerant recipients substantially suppressed the MLR, while those from the naïve, syngeneic and NKT KO recipients had no inhibitory effect on the MLR (Figure 3C). These results indicate that the DCs from tolerant mice possess tolerogenic capability for the allogeneic CD4 T cell response, which is obtained only in a NKT cell-competent condition. The DCs from tolerant recipients also suppressed the MLR when CD4 T cells of the NKT KO B6 mice were used as responders (Figure 3C), indicating that after the DCs acquired the tolerogenic capability, the NKT cells did not play an important role in the tolerogenic function of the DCs. Finally, we confirmed the involvement of IL-10 in suppression of the allogenic MLR. When anti-IL-10R mAb was added to the MLR, which was suppressed by the addition of IL-10high DCs from tolerant recipients, the CD4 T cell response was completely recovered (Figure 3D). The IL-10 blockade, on the other hand, did not significantly change the CD4 T cell response, which was added with naïve DCs (Figure 3D). Therefore, the suppressive effect of DCs derived from tolerant recipients seems IL-10-dependent.

Characteristics of CD4 T cells in tolerant mice

The abovementioned data highlights the regulatory ability of DCs from tolerant (NKT cell competent) recipients. It has been indicated that IL-10high IL-12low regulatory DCs can induce regulatory CD4 T cells in vivo (18), and therefore, we further investigated CD4 T cells in the transplant recipients. The isolated CD4 T cells were stimulated with a donor-type alloantigen (irradiated, T-cell-depleted BALB/c splenocytes) then their cytokine production and proliferative responses were examined. The CD4 T cells from WT-tolerant recipients synthesized higher levels of IL-10 and IL-4 and lower levels of IFN-γ compared with those from syngeneic and allogeneic recipients who showed rejection (Figure 4A). These cytokine profiles were not observed in CD4 T cells from NKT KO recipients, suggesting that NKT cells are required for the induction of IL-10-producing CD4 T cells.

image

Figure 4. Characteristics of CD4 T cells in tolerant mice. (A) Splenic CD4 T cells from B6 recipients were prepared as described in Materials and Methods. CD4 T cells were cocultured with irradiated BALB/c splenocytes at a cell number ratio of 1:2 for 4 days. IL-4, IFN-γ and IL-10 levels in the supernatant were evaluated using a standard sandwich ELISA. *p<0.05 and **p<0.01 as compared with that from allogenic NKT KO recipients. (B) MLR of CD4 T cells from B6 recipients against BALB/c alloantigen. The proliferative responses were measured by assessing the amount of thymidine incorporated in the last 8 h of culture. *p<0.05 and **p<0.01 as compared with that from allogenic NKT KO recipients. (C) MLR of CD4 T cells from B6 recipients as described in Figure 4A, and 10 μg/mL of anti-IL-10R mAb, anti-IL-4 mAb, or control rat IgG1 was added to some cultures of tolerant CD4 T cells. The proliferative responses were measured by assessing the amount of thymidine incorporated in the last 8 h of culture. **p<0.01 as compared with control Ab. In this figure, pooled samples from three mice per group were analyzed and each bar represents mean ± SD of triplicate well. Representative data from three independent experiments are shown.

Download figure to PowerPoint

Next, we examined the functional activity of CD4 T cells against the alloantigen by measuring their proliferative responses. The proliferative activity of CD4 T cells from tolerant recipients was lower than that of CD4 T cells from other groups when stimulated with the alloantigen (Figure 4B). Further, the proliferative activity of the CD4 T cells from NKT KO recipients was higher than that of CD4 T cells from tolerant recipients, even though both groups received the same anti-CD40L mAb treatment (Figure 4B).

Given that tolerant CD4 T cells showed higher IL-10 and IL-4 levels, we next examined the effects of these cytokines on the lowered proliferative activity using anti-IL-10R mAb and anti-IL-4 mAb in the abovementioned MLR. Our results indicated that blocking of the IL-10 signal restores the proliferative activity of tolerant CD4 T cells (Figure 4C). However, the neutralization of IL-4 could not restore the MLR. In contrast, the addition of anti-IL-4 mAb decreased proliferation (Figure 4C), indicating that it is IL-10 and not IL-4 that play a critical role in the low proliferative activity of CD4 T cells against the alloantigen. These results indicate that IL-10-producing CD4 T cells are generated in tolerant recipients, dependent on the existence of NKT cells.

Importance of IL-10 in transplant tolerance

Finally, we verified the role of IL-10 and IL-4 in the cardiac transplant tolerance model using IL-10 KO and IL-4 KO mice. As shown in Figure 5, anti-CD40L mAb therapy induced prolonged survival of allografts in WT and IL-4 KO recipients, but not IL-10 KO recipients. In IL-10 KO recipients, all the allografts were rejected within 36 post-transplant days. These results are consistent with those shown in Fig. 4, and indicate the importance of IL-10 in the maintenance of cardiac transplant tolerance induced by CD40L blockade.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References

It has been demonstrated that NKT cells participate in several immune regulatory responses such as anterior chamber-associated immune deviation (ACAID) (9), inhibition of autoimmune disease (1,2) and transplant tolerance (3–6). Further, by using models other than those available for organ transplantation, the role of IL-10 in NKT cell-mediated immune regulation has also been demonstrated. Sonoda et al. (19) indicated that NKT cell-derived IL-10 is essential for differentiating antigen-specific regulatory T cells (with CD8 marker) in the systemic tolerance of ACAID. Furthermore, we recently demonstrated that upon repeated stimulation NKT cells change their cytokine profile to a low IFN-γ level while retaining their IL-10 level, an important balance for subsequent generation of regulatory DCs and regulatory CD4 T cells (12). Similar induction of tolerogenic DCs by activation of NKT cells has also been reported in experiments conducted with NOD mice (20). However, it remained unclear whether a similar cellular cascade involving IL-10 operates in NKT cell-mediated transplant tolerance in which no artificial NKT cell stimulant is administered.

In the present study, we therefore examined the cytokine profile of NKT cells in cardiac transplant recipients and found that the profiles from tolerant mice induced by CD40L blockade showed higher IL-10 production. Adoptive transfer of an NKT cell-enriched cell population from the WT mice, which was not observed in the IL-10 KO mice, could reverse the shortened survival time in the NKT KO recipients. Moreover, in the tolerant recipients, IL-10 producing regulatory DCs and CD4 T cells were also induced in an NKT cell-dependent manner. While in a previous study (12) regulatory CD4 T cells were induced in independent hosts which were adoptively transferred with the regulatory DCs, the present observation indicates that the NKT cell-mediated regulatory cellular circuit can actually occur in same host without the adoptive transfer. Collectively, we indicated a novel regulatory mechanism of transplant tolerance mediated by NKT cells, in which no synthetic glycolipid ligand is involved.

IL-10 is a well-documented cytokine with anti-inflammatory and immunosuppressive activity (21). It was originally characterized as a factor generated by mouse Th2 cells thought to inhibit inflammatory processes mediated by Th1 cells in vivo. For example, IL-10 has been shown to suppress delayed-type hypersensitivity, experimental autoimmune encephalomyelitis and T-cell-mediated inflammatory bowel disease in rodents (21). It has also been implicated that IL-10 is important for the induction of regulatory T cells (22). IL-10 affects not only T cells but also other cells; for example, IL-10-treated DCs have been characterized by low levels of costimulatory molecule expression, high levels of IL-10 production and their capability to induce regulatory T cells (23). These characteristics of IL-10-treated DCs are in line with those isolated from the tolerant recipients in the present study (Figure 3). Although previous studies have indicated the importance of IL-10 in the acceptance of transplanted organs (24,25), this study highlighted for the first time the importance of IL-10 in NKT cell-dependent transplant tolerance. In this system, IL-10 appears to play important roles in at least three cellular components, namely, NKT cells, DCs and CD4 T cells.

The precise target of the NKT cell-derived IL-10 in our transplant model remains unknown; however, the present data together with our previous data (12) strongly suggest that DCs are, at least, one of the target cells, because the DCs from tolerant WT recipients produced high levels of IL-10, showed a more immature phenotype, and exhibited tolerogenic capability, while this was not observed in the DCs from NKT KO recipients (Figure 3). We also showed that DCs from tolerant recipients were more immature than those from NKT KO recipients (Figure 3B). This result is consistent with that presented in previous reports showing that IL-10 can reduce the expression of several costimulatory molecules in DCs (23). It has also been shown that IL-10 can convert immature DCs into tolerizing antigen-presenting cells (23,26). Therefore, the production of IL-10 by NKT cells may be attributed to transplant tolerance due to the induction of immature DCs and their subsequent conversion into tolerizing DCs. However, we cannot exclude the possibility that IL-10 produced from NKT cells affects CD4 T cells, or that IL-10 producing CD4 T cells direct DCs toward tolerogenic ones; accordingly, tolerance may be associated with a feedback loop that operates in the regulatory cells (27). Even in the latter case, however, NKT cells appear to be involved in the regulatory loop, similar to that in NKT KO recipients where these regulatory DCs and IL-10-producing CD4 T cells were not induced (Figures 3 and 4). It would therefore be of interest to further determine if IL-10 production by DCs and/or conventional CD4 T cells is also required for the induction and/or maintenance of transplant tolerance.

Research groups including ours have indicated that NKT cells are required for allo- and xenograft tolerance induced by ICAM-1/LFA-1, CD28/B7, CD40/CD40L or CD4 blockade (3,4,6). However, recently, Beilke et al. (28) reported that islet allograft tolerance induced by LFA-1 or CD40L blockade is dependent on NK cells but not NKT cells. Possible reasons for this discrepancy are as follows. First, the reports differ with respect to the transplanted organ. In the case of LFA-1 and CD40L blockade, for example, we used the allogenic cardiac transplant model, while Beilke et al. performed islet transplant experiments. Second, the transplanted region also differs between reports. Ikehara et al. (4) successfully transplanted rat islets into mouse liver through the portal vein with CD4 blockade. On the other hand, Beilke et al. (28) transplanted allogenic mouse islets into the kidney capsule of the recipient mouse with LFA-1 or CD40L blockade. The third possibility is that the strength of immunosuppression by mAb treatment substantially affected the results. Beilke et al. (28) injected 200 μg of anti-LFA-1 mAb or 250 μg of anti-CD40L mAb for 4 days into the islet of transplant recipients, but we administered 75 μg of anti-LFA-1 mAb for 5 days or 250 μg of anti-CD40L mAb for 3 days via injection into the cardiac transplant recipients. In fact, we observed that a higher amount of anti-CD40L mAb (500 μg/recipient for 3 days) induced tolerance even in NKT KO recipients (our unpublished observation); therefore, the amount of mAb that should be injected has a considerable effect.

Assuming that NKT cells are not required for transplant tolerance in cases in which a strong protocol of immunosuppression is used, it is conceivable that low to medium levels of inflammation exist in NKT cell-mediated transplant tolerant recipients. This idea is consistent with a previous observation that a certain amount of inflammation is present in the transplanted cardiac allograft even when using CD40L-deficient mice (29). We also detected CXCL16 expression in cardiac allograft tolerant recipients with anti-CD40L mAb treatment (6); CXCL16 is an inflammatory chemokine that is expressed in activated antigen-presenting cells or the endothelium (30,31). Therefore, NKT cells that migrate into CXCL16-expressing tolerant allografts appear to be chronically stimulated. Such chronically stimulated NKT cells are likely to change their cytokine pattern to a Th2-biased one with a IL-10high phenotype (12). Further, it has been demonstrated that lymphocytes in the cardiac allograft can migrate into the spleen (32), where the IL-10high NKT cells may interact with DCs. As for the mechanism of chronic stimulation of NKT cells, we considered the possibility that expression of endogeneous glycolipid ligand for NKT cells is upregulated in the allografts or spleens of tolerant recipients. Thus, we stained them with IB4, which has been shown to be useful in detecting iGb3—one type of endogeneous ligand (7). However, since no specific staining was detected (not shown), it appears unlikely that the expression of iGb3-like glycolipid is upregulated in the tolerant recipients or that it chronically stimulate the NKT cells. On the other hand, certain cytokines such as IL-12 and IL-18 have been shown to be able to stimulate NKT cells (33,34). Therefore, it is conceivable that these inflammatory cytokines, not specific glycolipids, activate NKT cells in the transplant tolerant recipients. Furthermore, it is also possible that the blockade of CD40L itself influences cytokine production by NKT cells. A previous study indicated that blockade of CD40-CD40L signals by anti-CD40L mAb (MR1) upon NKT cell activation inhibits their Th1 cytokine (IFN-γ) production, but retains Th2 cytokine (IL-4) production (35). Therefore, the administration of anti-CD40L mAb in the transplant recipients may have contributed to a Th2 shift (including IL-10 production) in the NKT cells. Further studies are needed to clarify the mechanism by which NKT cells change their cytokine profile to IL-10high in the tolerant recipients.

In this study, we used Jα18 KO mice in which only Vα14 NKT cells were lacking (13), allowing us to show the essential role of Vα14 NKT cells in transplant tolerance. However, CD1d-deficient mice, in which both Vα14 and non-Vα14 CD1d-restricted NKT cells are lacking, have also been used in various studies to verify NKT cell functions. For example, it was demonstrated for the first time that CD1d-deficient mice are unable to develop ACAID unless they are reconstituted with NK1.1+ T cells and CD1d-expressing antigen-presenting cells (9). Furthermore, in a tumor recurrence model, an immunosuppressive function of non-Vα14 CD1d-restricted NKT cells was demonstrated (36). On the other hand, the precise role of non-Vα14 CD1d-restricted NKT cells in transplant tolerance has yet to be identified. It would therefore be of interest to investigate whether there is a differential role between Vα14 and non-Vα14 CD1d-restricted NKT cells in transplant tolerance.

In summary, we indicated a cascade of events in transplant tolerance induced by costimulation blockade. The NKT cells of the tolerant recipients demonstrated a cytokine pattern of low IFN-γ and high IL-10. IL-10-producing regulatory DCs, which exhibited a more immature phenotype, were induced in the WT tolerant recipients but not the NKT KO recipients. Subsequently, IL-10 producing CD4 T cells were also induced in the tolerant recipients in an NKT cell-dependent fashion. The detection of IL-10-dependent immune regulatory interplay among NKT cells, DCs, and CD4 T cells may prove beneficial for further studies on immune regulation.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. References
  • 1
    Taniguchi M, Harada M, Kojo S, Nakayama T, Wakao H. The regulatory role of Vα14 NKT cells in innate and acquired immune response. Annu Rev Immunol 2003; 21: 483513.
  • 2
    Kronenberg M. Toward an understanding of NKT cell biology: Progress and paradoxes. Annu Rev Immunol 2005; 23: 877900.
  • 3
    Seino K, Fukao K, Muramoto K et al. Requirement for natural killer T (NKT) cells in the induction of allograft tolerance. Proc Natl Acad Sci USA 2001; 98: 25772581.
  • 4
    Ikehara Y, Yasunami Y, Kodama S et al. CD4+ Vα14 natural killer T cells are essential for acceptance of rat islet xenografts in mice. J Clin Invest 2000; 105; 17611767.
  • 5
    Sonoda KH, Taniguchi M, Stein-Streilein J. Long-term survival of corneal allografts is dependent on intact CD1d-reactive NKT cells. J Immunol 2002; 168: 20282034.
  • 6
    Jiang X, Shimaoka T, Kojo S et al. Cutting edge: Critical role of CXCL16/CXCR6 in NKT cell trafficking in allograft tolerance. J Immunol 2005; 175: 20512055.
  • 7
    Zhou D, Mattner J, Cantu C III et al. Lysosomal glycosphingolipid recognition by NKT cells. Science 2004; 306: 17861789.
  • 8
    Mattner J, Debord KL, Ismail N et al. Exogenous and endogenous glycolipid antigens activate NKT cells during microbial infections. Nature 2005; 434: 525529.
  • 9
    Sonoda KH, Exley M, Snapper S, Balk SP, Stein-Streilein J. CD1-reactive natural killer T cells are required for development of systemic tolerance through an immune-privileged site. J Exp Med 1999; 190: 12151226.
  • 10
    Kaneko Y, Harada M, Kawano T et al. Augmentation of Vα14 NKT cell-mediated cytotoxicity by interleukin 4 in an autocrine mechanism resulting in the development of concanavalin A-induced hepatitis. J Exp Med 2000; 191: 105114.
  • 11
    Hammond KJ, Poulton LD, Palmisano LJ, Silveira PA, Godfrey DI, Baxter AG. α/β-T cell receptor (TCR)+CD4CD8 (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J Exp Med 1998; 187: 10471056.
  • 12
    Kojo S, Seino K, Harada M et al. Induction of regulatory properties in dendritic cells by Vα14 NKT cells. J Immunol 2005; 175: 36483655.
  • 13
    Cui J, Shin T, Kawano T et al. Requirement for Vα14 NKT cells in IL-12-mediated rejection of tumors. Science 1997; 278: 16231626.
  • 14
    Kuhn R, Rajewsky K, Muller W. Generation and analysis of interleukin-4 deficient mice. Science 1991; 254: 707710.
  • 15
    Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 1993; 75: 263274.
  • 16
    Dalton DK, Pitts-Meek S, Keshav S, Figari IS, Bradley A, Stewart TA. Multiple defects of immune cell function in mice with disrupted interferon-γ genes. Science 1993; 259: 17391742.
  • 17
    Corry RJ, Winn HJ, Russell PS. Primarily vascularized allografts of hearts in mice. The role of H-2D, H-2K, and non-H-2 antigens in rejection. Transplantation 1973; 16: 343350.
  • 18
    Wakkach A, Fournier N, Brun V, Breittmayer JP, Cottrez F, Groux H. Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo. Immunity 2003; 18: 605617.
  • 19
    Sonoda KH, Faunce DE, Taniguchi M, Exley M, Balk S, Stein-Streilein J. NK T cell-derived IL-10 is essential for the differentiation of antigen-specific T regulatory cells in systemic tolerance. J Immunol 2001; 166: 4250.
  • 20
    Naumov YN, Bahjat KS, Gausling R et al. Activation of CD1d-restricted T cells protects NOD mice from developing diabetes by regulating dendritic cell subsets. Proc Natl Acad Sci USA 2001; 98: 1383813843.
  • 21
    Pretolani M, Goldman M. IL-10: A potential therapy for allergic inflammation? Immunol Today 1997; 18: 277280.
  • 22
    Groux H, O'Garra A, Bigler M et al. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 1997; 389: 737742.
  • 23
    Enk AH, Angeloni VL, Udey MC, Katz SI. Inhibition of Langerhans cell antigen-presenting function by IL-10. A role for IL-10 in induction of tolerance. J Immunol 1993; 151: 23902398.
  • 24
    Raisanen-Sokolowski A, Mottram PL, Glysing-Jensen T, Satoskar A, Russell ME. Heart transplants in interferon-γ, interleukin 4, and interleukin 10 knockout mice. Recipient environment alters graft rejection. J Clin Invest 1997; 100: 24492456.
  • 25
    Raisanen-Sokolowski A, Glysing-Jensen T, Russell ME. Leukocyte-suppressing influences of interleukin (IL)-10 in cardiac allografts: insights from IL-10 knockout mice. Am J Pathol 1998; 153: 14911500.
  • 26
    Jonuleit H, Schmitt E, Steinbrink K, Enk AH. Dendritic cells as a tool to induce anergic and regulatory T cells. Trends Immunol 2001; 22: 394400.
  • 27
    Min WP, Zhou D, Ichim TE et al. Inhibitory feedback loop between tolerogenic dendritic cells and regulatory T cells in transplant tolerance. J Immunol 2003; 170: 13041312.
  • 28
    Beilke JN, Kuhl NR, Van Kaer L, Gill RG. NK cells promote islet allograft tolerance via a perforin-dependent mechanism. Nat Med 2005; 11: 10591065.
  • 29
    Shimizu K, Schonbeck U, Mach F, Libby P, Mitchell RN. Host CD40 ligand deficiency induces long-term allograft survival and donor-specific tolerance in mouse cardiac transplantation but does not prevent graft arteriosclerosis. J Immunol 2000; 165: 35063518.
  • 30
    Matloubian M, David A, Engel S, Ryan JE, Cyster JG. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat Immunol 2000; 1: 298304.
  • 31
    Wilbanks A, Zondlo SC, Murphy K et al. Expression cloning of the STRL33/BONZO/TYMSTRligand reveals elements of CC, CXC, and CX3C chemokines. J Immunol 2001; 166: 51455154.
  • 32
    Larsen CP, Morris PJ, Austyn JM. Migration of dendritic leukocytes from cardiac allografts into host spleens. A novel pathway for initiation of rejection. J Exp Med 1990; 171: 307314.
  • 33
    Brigl M, Bry L, Kent SC, Gumperz JE, Brenner MB. Mechanism of CD1d-restricted natural killer T cell activation during microbial infection. Nat Immunol 2003; 4: 12301237.
  • 34
    Leite-De-Moraes MC, Hameg A, Pacilio M et al. IL-18 enhances IL-4 production by ligand-activated NKT lymphocytes: A pro-Th2 effect of IL-18 exerted through NKT cells. J Immunol 2001; 166: 945951.
  • 35
    Hayakawa Y, Takeda K, Yagita H, Van Kaer L, Saiki I, Okumura K. Differential regulation of Th1 and Th2 functions of NKT cells by CD28 and CD40 costimulatory pathways. J Immunol 2001; 166: 60126018.
  • 36
    Terabe M, Swann J, Ambrosino E et al. A nonclassical non-Vα14Jα18 CD1d-restricted (type II) NKT cell is sufficient for down-regulation of tumor immunosurveillance. J Exp Med 2005; 202: 16271633.