SEARCH

SEARCH BY CITATION

Keywords:

  • Graft arteriosclerosis;
  • proliferation;
  • vascular remodeling;
  • vascular smooth muscle cells

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Vascular remodeling is a common feature of many vasculopathies, including graft arteriosclerosis (GA). We investigated whether endothelial and smooth muscle cell-derived neuropilin-like protein (ESDN) is a marker of vascular remodeling in GA. Immunostaining of human coronary arteries demonstrated high levels of ESDN in GA, but not in normal arteries. In a model of GA, where a segment of human coronary is transplanted into a severe combined immunodeficient mouse, followed by allogeneic human peripheral blood mononuclear cell (PBMC) reconstitution, ESDN was minimally expressed in transplanted human arteries in the absence of reconstitution. By 2 weeks following PBMC reconstitution, at a time corresponding to maximal vascular cell proliferation, high levels of ESDN were detected in the transplanted arteries. Similarly, injury-induced vascular remodeling in apoE−/− mice was associated with early and transient ESDN upregulation, in parallel with cell proliferation. In vascular smooth muscle cell (VSMC) cultures, ESDN expression was significantly higher in proliferating, as compared to growth-arrested cells. ESDN overexpression in VSMC led to a decline in growth curves, while ESDN knock down had the opposite effect. We conclude that ESDN is a marker of vascular remodeling and regulator of VSMC proliferation. ESDN may serve as a therapeutic or diagnostic target for GA.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Graft arteriosclerosis (GA) remains the major cause of chronic, progressive failure in cardiac allografts. GA is the result of an immune-mediated response that occurs diffusely in donor vessels, and is clinically manifested by progressive lumen loss in allograft arteries with consequent myocardial ischemia. Pathological remodeling, defined as an enduring change in the size and/or composition of adult blood vessels (1), is the hallmark of a broad spectrum of vasculopathies, including GA. Vascular wall hyperplasia, i.e. neointima formation and media thickening, secondary to vascular smooth muscle cell (VSMC) proliferation and extracellular matrix deposition, is a major component of the remodeling process in GA. Although immunosuppression has largely overcome the causative role that acute rejection previously played in cardiac allograft failure, progress toward limiting pathological remodeling in GA has proved to be more challenging. This is explained, at least in part, by the lack of reliable markers for early stages of the disease, which can be targeted for diagnosis and/or therapy of GA. Identification of key molecular markers of vascular remodeling will not only advance our understanding of the basic pathophysiological process, but also may lead to the development of novel therapeutic and diagnostic approaches for GA.

Endothelial and smooth muscle cell-derived neuropilin-like protein (ESDN) is a transmembrane protein containing a CUB (domain found in complement subcomponents C1r/C1s, the sea urchin protein Uegf and bone morphogenetic protein-1) and a coagulation factor V/VIII homology domain, resembling the structure of neuropilins (2, 3), which is upregulated in balloon-injured rat carotid arteries (2). Neuropilins are characterized by the promiscuity of ligands and coreceptors. Through interactions with semaphorins, plexins and vascular endothelial growth factor (VEGF), neuropilins are involved in axonal guidance and VEGF-mediated vascular responses. Little is known about the functional significance of ESDN. In VSMC, ESDN is induced by platelet-derived growth factor-BB (PDGF-BB) and serum, and ESDN overexpression leads to a decrease in cell proliferation in human embryonic kidney (HEK) 293 cells (2). ESDN expression in the neointima of balloon-injured rat carotid arteries (2) led us to evaluate ESDN as a potential marker of vascular remodeling in GA. Here, we demonstrate that ESDN is upregulated in explanted human coronary arteries with GA. The time course of ESDN expression is addressed in murine models of alloimmune and mechanical injury-induced vascular remodeling, demonstrating its early upregulation in association with vascular cell proliferation. In vitro, ESDN is upregulated in proliferating VSMC, and ESDN overexpression in VSMC leads to a decrease in cell proliferation. As such, ESDN is an early marker of vascular remodeling in GA, and may constitute a diagnostic and/or therapeutic target for cell proliferation in vascular remodeling.

Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Cell culture

Cell isolation was performed under protocols approved by Yale Human Investigation Committee. Human VSMC were isolated by aortic explant outgrowth, and grown in VSMC growth medium SM-GM2 supplemented with growth factors (Clonetics, Walkersville, MD) in a humidified atmosphere of 5% CO2-95% air. They were confirmed as VSMC by positive α-actin staining. Cultures were split 1:3 upon confluence, and used within the first 3 passages.

Human coronary artery tissues and peripheral blood mononuclear cells (PBMC)

Human coronary arteries used in the first series of experiments were obtained from explanted hearts at the time of transplantation under a protocol approved by Johns Hopkins Institutional Review Board. Coronary arteries used at Yale for transplantation into severe combined immunodeficient (SCID) mice were procured from explanted hearts of deceased organ donors or cardiac transplant recipients under a protocol approved by Yale Human Investigation Committee, as described (4). Human leukocytes were collected by apheresis from healthy volunteers under protocols approved by Yale Human Investigation Committee. PBMC were isolated using lymphocyte separation medium and were stored in liquid nitrogen. Cells were thawed and washed before adoptive transfer, as described (4).

Animal models

C.B-17 SCID/beige mice (Taconic Farms, Hudson, NY) were engrafted with size-matched adjacent segments (2–3 mm in length) of human coronary arteries devoid of visible atherosclerotic lesions and inoculated with human PBMC or saline (vehicle control) 1 or 3 weeks later as previously described (4,5). Animals were sacrificed after 5 weeks. Left common carotid injury was induced in 6- to 8-week-old female apoE−/− mice (Jackson Laboratory, Bar Harbor, ME) as described (6). A 0.014″ guidewire was introduced through the left external carotid artery and moved proximally into the left common carotid artery. The common carotid was abraded six times over its length. The opposite uninjured right common carotid artery was used as control. To obtain an asymmetrical injury, the wire was slightly angled at the time of introduction, injuring one side of the artery. Experiments were performed according to the regulations of Yale University's Animal Care and Use Committee.

Histology, immunohistochemistry (IHC) and immunofluorescent (IF) studies

Hematoxylin and eosin (H&E), Elastic Van Gieson (EVG), trichrome, IHC and IF staining were performed using standard techniques on 7 μm thick, fixed cryostat sections. They were incubated for 1 h in the presence of rabbit anti-human ESDN (cross-reacting with mouse ESDN, Sage Bioventures, San Diego, CA), rabbit-anti-Ki-67 (Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-human CD31 (BD Pharmingen, San Diego, CA), mouse anti-human α-actin (Sigma, St. Louis, MO) and mouse anti-human CD45 (clone GAP8.3, gift of Dr. J. Bender, Yale University) antibodies or nonbinding controls (rabbit IgG), followed by species-specific cy3 (red) or FITC (green)-labeled secondary antibodies (Jackson Immuno Research, West Grove, PA). Nuclei were detected by DAPI (Molecular probes, Eugene, OR) staining. Specificity of ESDN staining was further demonstrated by pretreatment with 100 molar excess of a blocking peptide [Q(399)DKIFQGNKDYHKDVRNN(416)]. Morphometric and proliferation analyses on arterial sections were performed as described (6), with the maximal ratio of Ki-67 positive nuclei used as index of cell proliferation. For IF quantitation, background-corrected mean fluorescence intensity was determined using Kodak-1D software (New Haven, CT).

Quantitative reverse transcription polymerase chain reaction (RT-PCR)

Total RNA isolated using Qiagen kits (Valencia, CA) was reverse transcribed. Real-time PCR was performed on this cDNA using the QuantiTect Sybr Green PCR kit (Qiagen) following manufacturer's instructions. The results were normalized to GAPDH. The following primers were used: ESDN: 5′-GGCCCTGAGAGTGGAACCCTTACAT-3′ and 5′-TTCATTTGCAACCCCAGACCAC-3′, GAPDH:5′-CCAAGGTCATCCATGACAAC-3′ and 5′-TGTCATACCAGGAAATGAGC-3′. RT-PCR reactions were run in triplicates.

Proliferation analysis

Cells were plated at equal density in 24-well culture plates and incubated at 37°C and 5% CO2. Fresh growth medium was replaced every other day. Proliferation was quantified using trypan blue (Sigma) staining and is presented as live cell number per well. The results are expressed as the mean ± standard deviation (SD) from four wells.

DNA constructs and retroviral transduction

HA-tagged human ESDN (CLCP1) (3) was recombined into the retroviral vector pLZRS-CMV, a kind gift of Dr. M. Kluger (Yale University), to generate the ESDN-HA-pLZRS-CMV vector. This and the control enhanced green fluorescent protein (GFP)-pLZRS construct (kind gift of Dr. M. Kluger) were transfected (Lipofectamine 2000, Invitrogen, San Diego, CA) into amphotropic ProPak—A packaging cell line (ATCC, Manassas, VA). Puromycin-resistant cells served as the source of retrovirus. VSMC were transduced by five drug-free serial infections, as described (7). ∼50% of the cells expressed the transduced proteins.

RNA interference

Three 25-bp duplex short interfering RNA (siRNA) that specifically target different regions of human ESDN mRNA (Acc NM_080927) were designed and synthesized by Invitrogen Life Technologies (Carlsbad, CA). The small interfering RNA (siRNA) sequence GGAAUUGUUGGUACACUUCAUCAAA was found to exert the greatest downregulation of ESDN expression without affecting stress responses as evaluated by quantitative RT-PCR. Cells were transfected with either ESDN siRNA or a universal negative control siRNA (Invitrogen, Cat. No. 12935200) using the FuGEN 6 Transfection Reagent (Roche Diagnostics, Indianapolis, IN) according to the manufacturer's instructions.

Statistical analysis

Data are presented as mean value ± SD. Groups were compared using Student's 2-tailed t-test (for two groups) or analysis of variance (ANOVA) with Tukey's post hoc analysis (for >2 groups). Significance was set at the 0.05 level.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

ESDN in explanted human coronary arteries with GA

ESDN expression, as a potential marker of vascular remodeling in GA, was assessed in human coronary arteries. The arteries were obtained from patients with nonischemic cardiomyopathy (representing ‘normal’ arteries) and those with advanced GA receiving a second heart transplantation. As expected, normal coronaries often had a small neointima, frequently associated with aging in humans. Coronary arteries from patients with advanced GA demonstrated the typical remodeling pattern, characterized by the presence of a thick, concentric, neointima (Figure 1A). While little ESDN could be detected by immunofluorescent staining in normal human coronary arteries, significantly higher levels of ESDN were detectable in arteries with GA (Figure 1B and C). ESDN expression predominantly localized to the neointima.

imageimage

Figure 1. Representative examples of trichrome (A), and ESDN immunofluorescent staining (B) in normal human coronary arteries and arteries with GA. Red = ESDN staining; Green = elastica auto-fluorescence; Blue = DAPI nuclear staining; Inset = control antibody; Scale bar = 100 μm. (C) Quantitative analysis of the ESDN fluorescence mean intensity, n = 5 in each group, *= p < 0.01.

ESDN in animal models of vascular remodeling

Explanted coronary arteries at the time of retransplantation can only provide a single view of advanced GA. Therefore, to address the temporal pattern of ESDN expression, we used a chimeric mouse/human model of GA (4, 5,8). In this model, a segment of human coronary artery is transplanted end-to-end into the abdominal aorta of a SCID/beige mouse, and reconstitution with human allogeneic PBMC leads to significant vascular remodeling, characterized by the formation of a prominent neointima over a period of 4 weeks (neointima to media area ratio 0.3 ± 0.1, 1.0 ± 0.1 and 2.0 ± 0.3 at 0, 2 and 4 weeks after PBMC reconstitution; p < 0.01 zero week vs. 4 weeks and <0.05 2 weeks vs. 4 weeks, n = 4) (8) (supplemental Figure 1). Cell proliferation, assessed by Ki-67 staining, is minimal in nontransplanted arteries, or arteries transplanted without PBMC reconstitution, and significantly increases by 2 weeks after PBMC reconstitution (proliferation index 2.1 ± 1.0, 8.0 ± 1.3 and 4.8 ± 1.0, respectively, in no PBMC, 2 weeks PBMC and 4 weeks PBMC; p < 0.01 for control vs. 2 weeks, n = 5) (4,8).

ESDN expression was assessed by immunofluorescent staining. Again, ESDN was minimally expressed in nontransplanted normal arteries (Figure 2A). Similarly, following arterial transplantation, in the absence of PBMC reconstitution there was no detectable vascular remodeling and ESDN expression in the arterial graft remained minimal, unchanged from nontransplanted arteries (Figure 2B). Following PBMC reconstitution, and concomitant with the increase in cell proliferation and the resultant changes in structure, ESDN expression significantly increased in the arterial grafts (Figure 2C and D). Staining with a control immunoglobulin demonstrated the specificity of staining (Figure 2C inset). Pretreatment with an ESDN peptide abolished the positive ESDN staining, further demonstrating the staining specificity (not shown). As such, the temporal pattern of ESDN expression paralleled the proliferation index assessed by Ki-67 staining.

imageimage

Figure 2. ESDN Immunofluorescent staining demonstrating upregulation following PBMC reconstitution in SCID/beige mice bearing human coronary artery grafts. (A) nontransplanted artery, (B) transplanted artery in the absence of PBMC reconstitution (control), (C) transplanted artery 2 weeks following PBMC reconstitution (inset: control antibody) and (D) transplanted artery 4 weeks following PBMC reconstitution. Animals were analyzed 5 weeks following transplantation. Red = ESDN staining; Green = elastica auto-fluorescence; Blue = DAPI nuclear staining; Scale bar = 100 μm. The figure is representative of three independent experiments. (E) Quantitative analysis of the ESDN fluorescence mean intensity, n = 3 in each group, *= p < 0.05 versus nontransplanted or control.

ESDN expression in the chimeric human/mouse model of GA is localized to the neointima and media (Figure 2C and D). VSMC, EC and leukocytes are present in the vessel wall, and play an important role in the pathogenesis of GA. To identify cells associated with ESDN expression, ESDN was coimmunostained with smooth muscle α-actin (for VSMC, Figure 3A–C), CD31 (for EC, Figure 3D–F) or CD45 (for human leukocytes, Figure 3G–I) in transplanted human coronary arteries 2 weeks following PBMC reconstitution. ESDN partially colocalized with α-actin positive VSMC and EC. However, there was no colocalization with human leucocytes.

image

Figure 3. ESDN (A, C, D, F, G and I, in green), smooth muscle α-actin (B and C, in red), CD31 (E and F, in red) and CD45 (H and I, in red) immunostaining in transplanted human coronary arteries 2 weeks after PBMC reconstitution, demonstrating partial ESDN colocalization with α-actin-positive VSMC and to a lesser degree, with CD31-positive EC. Arrowheads point to the areas of colocalization. Blue = DAPI nuclear staining; Scale bar = 25 μm.

Download figure to PowerPoint

To determine whether ESDN upregulation is specific to alloimmune-mediated remodeling, ESDN expression was evaluated after carotid injury in apoE−/− mice. In this model of mechanical injury-induced remodeling, wire injury leads to significant vascular remodeling characterized by the formation of a prominent neointima over a 4-week period (supplemental Figure 2) (6). Similar to normal human arteries, very low levels of ESDN could be detected by immunofluorescent staining in the noninjured right carotid artery. Carotid wire injury led to transient upregulation of ESDN, which was maximal at 1 and 3 weeks after injury and declined toward baseline by 4 weeks (Figure 4). As such, and similar to our observation in GA, ESDN expression paralleled cell proliferation which is maximal at 1–3 weeks after injury (proliferation index <1, 18.6 ± 0.3, 21.4 ± 2.4 and 5.3 ± 0.3, respectively, in the noninjured control artery, and at 1, 3 and 4 weeks after injury; p < 0.01 for 1 week and 3 weeks vs. control, n = 3) (6).

imageimage

Figure 4. ESDN Immunofluorescent staining demonstrating transient upregulation following carotid artery injury in apoE−/− mice. (A) noninjured (control), (B) 1 week, (C) 3 weeks (inset = control antibody) and (D) 4 weeks following injury. Scale bar = 100 μm; Red = ESDN staining, Green = elastica auto-fluorescence, Blue = DAPI nuclear staining; Scale bar = 100 μm. The figure is representative of three independent experiments. (E) Quantitative analysis of the ESDN fluorescence mean intensity, n = 3 in each group, *= p < 0.05 versus control.

Carotid wire injury often leads to an asymmetrical proliferative and remodeling response. This asymmetry of response was exploited to address the spatial relationship between ESDN expression and cell proliferation in vivo. One week following an asymmetrical carotid injury, ESDN expression, detected by immunofluorescent staining, was similarly asymmetrical and grossly localized to the area of Ki-67 positive, proliferating cells (Figure 5).

image

Figure 5. ESDN (A) and Ki-67 (B) immunofluorescent staining of adjacent sections of the carotid artery 1 week following wire injury demonstrating ESDN co-localization with Ki-67 positive proliferating nuclei (arrows). The figure is representative of three independent experiments. Scale bar = 20 μm.

Download figure to PowerPoint

Cell proliferation and ESDN expression in vascular smooth muscle cells

Vascular injury, whether alloimmune or mechanical, leads to VSMC phenotypic modulation and transformation to a proliferating phenotype. We addressed the interaction between ESDN expression and cell proliferation in VSMC in vitro. The effect of cell proliferation on ESDN expression was addressed by quantitative RT-PCR in highly proliferative nonconfluent and growth-arrested confluent VSMC cultures (9). ESDN mRNA level (normalized to GAPDH) was ∼3 times higher in rapidly dividing nonconfluent VSMC, as compared to confluent growth-arrested cells (Figure 6A). To address the effect of ESDN on VSMC proliferation, ESDN levels were modulated by retroviral overexpression and RNA interference in VSMC. In the first series of experiments, ESDN and the control, GFP-overexpressing cells were plated at equal sub-confluent densities and cell growth was analyzed over a period of 6 days. After an initial period of recovery, the two growth curves diverged. The number of ESDN-overexpressing VSMC was significantly less than the number of GFP-expressing control VSMC at 4 and 6 days (p < 0.01, Figure 6B), indicating that ESDN has an inhibitory effect on VSMC proliferation. Next, ESDN levels in VSMC were knocked down by RNA interference. Quantitative RT-PCR revealed a ∼50% reduction in ESDN mRNA level in cells transfected with ESDN-specific siRNA, as compared to cells treated with control siRNA (data not shown). Transfection led to an initial decline in cell numbers in both samples. Analysis of the growth curve demonstrated a significant increase in cell numbers at 2, 4 and 6 days after siRNA transfection in ESDN knock out, as compared to control cells (p < 0.05, Figure 6C), further supporting the inhibitory effect of ESDN on cell proliferation.

imageimageimage

Figure 6. (A) GAPDH-normalized ESDN mRNA levels quantified by RT-PCR in confluent and sub-confluent VSMC. VSMC were plated at different densities in triplicates, and were studied when the highest density culture reached confluence. *= p < 0.05. (B) Effect of ESDN overexpression on VSMC growth. GFP (continuous line) or ESDN (dashed line) overexpressing VSMC were plated at equal density in four replicates and cell numbers were determined over a period of 6 days. *= p < 0.01. (C) Effect of ESDN knock down on VSMC growth. VSMC were transfected with ESDN (dashed line) or control (continuous line) siRNA in four replicates, and cell numbers were determined over 6 days. *= p < 0.05. The figure is representative of at least three independent experiments.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

In the present study we made a number of novel observations. First, ESDN is upregulated in human coronary arteries of explanted cardiac allografts with GA. Second, in animal models of alloimmune and injury-mediated vascular remodeling ESDN is upregulated in parallel with vascular cell proliferation. Third, proliferating VSMC express higher levels of ESDN. Finally, ESDN overexpression in VSMC leads to a decline in the cell growth and survival.

Vascular remodeling is a common feature of a broad spectrum of vasculopathies, including GA. The two components of remodeling, i.e. changes in the vessel diameter and hyperplasia, play complementary roles in the pathogenesis of lumen loss. Identification of specific markers of the remodeling process is an important step toward the development of novel therapeutic and diagnostic approaches for GA, and will help advance our understanding of pathophysiology. While there is little information on GA, a few such markers have been identified for injury-induced remodeling. As such, neointima formation is associated with upregulation of integrins [α1β1 (10), α5β1 (11) and αvβ3 (8)], matrix proteins [fibulin-5 and elastin (12)] and other molecules [PPARγ (13)]. We and others have used this information to develop imaging and therapeutic modalities for restenosis and GA (6,8,14,15). Our search for novel markers of GA with relevance to human disease led to identification of ESDN as a novel marker of vascular remodeling in GA.

ESDN, a rather ubiquitously expressed 93 to 127 KDa transmembrane molecule, was cloned from human coronary artery EC (2) and a highly metastatic lung cancer cell line (3). In vivo, ESDN can be detected in the rat carotid neointima and nerve bundles. Little is known about the function of ESDN. VSMC express high levels of ESDN mRNA. ESDN mRNA can be induced by serum and PDGF in VSMC (2). Overexpression of ESDN in 293 HEK cells has led to reduction (albeit small) of the proliferation rate (2). ESDN domain structure resembles the structure of neuropilins, suggesting a similar set of functions. Neuropilins are a class of transmembrane proteins, involved in axonal guidance and angiogenesis. Neuropilin-1 was first identified as a receptor for semaphorin 3A; an axon-repellant factor involved in the collapse of neuronal growth cones (16,17). Identification of other ligands, such as VEGF165, and the results of gene-targeting experiments indicate that neuropilins play an important role in vascular and tumor biology. Neuropilin-1 acts as a coreceptor for VEGF, enhancing the binding of VEGF165 to VEGF receptor-2 (VEGFR-2) and VEGF165-mediated chemotaxis (18).

To validate ESDN as a marker of GA, we first demonstrated the minimal expression of ESDN in normal human coronary arteries and its upregulation in pathological specimens of human GA. Given the difficulty studying vascular remodeling in human pathological samples, animal models of alloimmune and mechanical injury-induced vascular remodeling were used for in depth analysis of the temporal and spatial expression of ESDN during the remodeling process. In both animal models, ESDN was minimally expressed in normal arteries, and significantly upregulated following alloimmune or mechanical injury. Coimmunostaining with specific cellular markers demonstrated ESDN association with VSMC and EC, but not infiltrating leukocytes. ESDN's high level of expression in the neointima strongly supports its association with VSMC of the α-actin-low, proliferative phenotype, which are the predominant cells in the neointima (19).

Our findings indicate that ESDN upregulation can be linked to a common pathway shared by both immune and injury-mediated remodeling. The temporal pattern of ESDN expression paralleled cell proliferation in both animal models. Furthermore, we demonstrated that ESDN expression and cell proliferation detected by Ki67 staining grossly localize to the same areas of the vessel wall. Not surprisingly, the colocalization is not absolute. While ESDN is a transmembrane protein, Ki-67 is expressed in the nucleus of the cells that have entered the cell cycle. Together, our data indicate that there is a close temporal and spatial association between ESDN expression and vascular cell proliferation during vascular remodeling. It remains to de determined if ESDN regulates cell proliferation in vivo (or vice versa), or if both are modulated by common regulatory signals.

The association between cell proliferation and ESDN expression was further studied in vitro in VSMC. Cell density is a strong determinant of the response to growth factor stimulation in vitro (20). As such, VEGF-induced VEGFR-2 tyrosine phosphorylation is inhibited in confluent endothelial cultures (21). Confluence-induced growth inhibition and the subsequent cell cycle arrest in G0/G1 (22) can also affect the expression and activity of a number of factors that play an important role in vascular remodeling. For example, steady-state levels of eNOS mRNA are markedly increased in proliferating versus confluent cells (23), and cells in sub-confluent cultures secrete enhanced levels of prostaglandin E2 (24). We observed higher steady-state ESDN mRNA levels in proliferating, sub-confluent VSMC, as compared to resting confluent cultures. In conjunction with the observation that PDGF and serum induce cell proliferation and ESDN expression in VSMC (2), our data further support a link between ESDN and cell proliferation in VSMC. ESDN upregulation may be a downstream effect in the signaling events that lead to cell proliferation. Alternatively, ESDN may be directly or indirectly induced by cell proliferation. Other factors, beyond cell proliferation, may regulate ESDN expression in vivo. Potential candidates include growth factors and the state of VSMC differentiation. We are currently in the process of exploring these possibilities in the laboratory.

Consistent with the previous report on ESDN inhibition of cell proliferation in 293 HEK cells (2), ESDN overexpression in VSMC led to a slowing of growth rate. This was confirmed by ESDN knock down which led to an opposite effect. The findings of this and previous studies support a model, in which ESDN is upregulated by growth-inducing signals in parallel with increased cell proliferation. ESDN upregulation in turn leads to a decrease in growth rate by reducing the response to growth factors in a negative feedback loop. As such, ESDN expression may mimic contact inhibition by reducing growth rate. One such factor may be PDGF, which is the most potent VSMC mitogen released in response to injury by platelets, EC and VSMC (25). PDGF may also play a role in PTCA-induced VSMC differentiation (26) and GA (27). Other potential factors include members of the VEGF family, such as VEGF165, which is the classical mitogen for EC (28). Interestingly, neuropilin-1 modulates VEGF165 signaling through interactions with VEGF receptors (18). ESDN's structural similarity with neuropilins raises the likelihood of a similar (albeit inhibitory) effect on VEGF signaling. We are currently in the process of addressing these possibilities.

In this article, we report on a novel common marker of alloimmune- and injury-mediated vascular remodeling, validated in both animal models and human disease. ESDN upregulation is linked to cell proliferation in vitro and in vivo, and may serve as a diagnostic target for the proliferative process in vascular remodeling. The inhibitory effect of ESDN on growth curves raises the possibility that ESDN may also serve as a therapeutic target, not only in vascular remodeling, but also in other diseases associated with excessive cell proliferation.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

This work was supported by NIH Program Project HL-70295, American Heart Association grant 0435053N and a Department of Veterans Affairs Merit Award to MMS.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information
  • 1
    Galis ZS, Khatri JJ. Matrix metalloproteinases in vascular remodeling and atherogenesis: The good, the bad, and the ugly. Circ Res 2002; 90: 251262.
  • 2
    Kobuke K, Furukawa Y, Sugai M et al. ESDN, a novel neuropilin-like membrane protein cloned from vascular cells with the longest secretory signal sequence among eukaryotes, is up-regulated after vascular injury. J Biol Chem 2001; 276: 3410534114.
  • 3
    Koshikawa K, Osada H, Kozaki K et al. Significant up-regulation of a novel gene, CLCP1, in a highly metastatic lung cancer subline as well as in lung cancers in vivo. Oncogene 2002; 21: 28222828.
  • 4
    Wang Y, Burns WR, Tang PC et al. Interferon-gamma plays a nonredundant role in mediating T cell-dependent outward vascular remodeling of allogeneic human coronary arteries. FASEB J 2004; 18: 606608.
  • 5
    Lorber MI, Wilson JH, Robert ME et al. Human allogeneic vascular rejection after arterial transplantation and peripheral lymphoid reconstitution in severe combined immunodeficient mice. Transplantation 1999; 67: 897903.
  • 6
    Sadeghi MM, Krassilnikova S, Zhang J et al. Detection of injury-induced vascular remodeling by targeting activated alphavbeta3 integrin in vivo. Circulation 2004; 110: 8490.
  • 7
    Zheng L, Dengler TJ, Kluger MS et al. Cytoprotection of human umbilical vein endothelial cells against apoptosis and CTL-mediated lysis provided by caspase-resistant Bcl-2 without alterations in growth or activation responses. J Immunol 2000; 164: 46654671.
  • 8
    Zhang J, Krassilnikova S, Gharaei AA et al. Alphavbeta3-targeted detection of arteriopathy in transplanted human coronary arteries: An autoradiographic study. FASEB J 2005; 19: 18571859.
  • 9
    Owens GK, Loeb A, Gordon D, Thompson MM. Expression of smooth muscle-specific alpha-isoactin in cultured vascular smooth muscle cells: Relationship between growth and cytodifferentiation. J Cell Biol 1986; 102: 343352.
  • 10
    Gotwals PJ, Chi-Rosso G, Lindner V et al. The alpha1beta1 integrin is expressed during neointima formation in rat arteries and mediates collagen matrix reorganization. J Clin Invest 1996; 97: 24692477.
  • 11
    Pickering JG, Chow LH, Li S et al. alpha5beta1 integrin expression and luminal edge fibronectin matrix assembly by smooth muscle cells after arterial injury. Am J Pathol 2000; 156: 453465.
  • 12
    Spencer JA, Hacker SL, Davis EC et al. Altered vascular remodeling in fibulin-5-deficient mice reveals a role of fibulin-5 in smooth muscle cell proliferation and migration. Proc Natl Acad Sci U S A 2005; 102: 29462951.
  • 13
    Law RE, Goetze S, Xi XP et al. Expression and function of PPARgamma in rat and human vascular smooth muscle cells. Circulation 2000; 101: 13111318.
  • 14
    Bishop GG, McPherson JA, Sanders JM et al. Selective alpha(v)beta(3)-receptor blockade reduces macrophage infiltration and restenosis after balloon angioplasty in the atherosclerotic rabbit. Circulation 2001; 103: 19061911.
  • 15
    Honda Y, Kitano T, Fukuya F et al. A novel alphavbeta3 integrin antagonist suppresses neointima formation for more than 4 weeks after balloon injury in rats. Arterioscler Thromb Vasc Biol 2005; 25: 13761382.
  • 16
    He Z, Tessier-Lavigne M. Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell 1997; 90: 739751.
  • 17
    Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ, Ginty DD. Neuropilin is a semaphorin III receptor. Cell 1997; 90: 753762.
  • 18
    Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 1998; 92: 735745.
  • 19
    Owens GK. Regulation of differentiation of vascular smooth muscle cells. Physiol Rev 1995; 75: 487517.
  • 20
    Fagotto F, Gumbiner BM. Cell contact-dependent signaling. Dev Biol 1996; 180: 445454.
  • 21
    Rahimi N, Kazlauskas A. A role for cadherin-5 in regulation of vascular endothelial growth factor receptor 2 activity in endothelial cells. Mol Biol Cell 1999; 10: 34013407.
  • 22
    Vinals F, Pouyssegur J. Confluence of vascular endothelial cells induces cell cycle exit by inhibiting p42/p44 mitogen-activated protein kinase activity. Mol Cell Biol 1999; 19: 27632772.
  • 23
    Arnal JF, Yamin J, Dockery S, Harrison DG. Regulation of endothelial nitric oxide synthase mRNA, protein, and activity during cell growth. Am J Physiol 1994; 267:C1381C1388.
  • 24
    Jiang H, Weyrich AS, Zimmerman GA, McIntyre TM. Endothelial cell confluence regulates cyclooxygenase-2 and prostaglandin E2 production that modulate motility. J Biol Chem 2004; 279: 5590555913.
  • 25
    Giese NA, Marijianowski MM, McCook O et al. The role of alpha and beta platelet-derived growth factor receptor in the vascular response to injury in nonhuman primates. Arterioscler Thromb Vasc Biol 1999; 19: 900909.
  • 26
    Doevendans PA, Van Eys G. Smooth muscle cells on the move: The battle for actin. Cardiovasc Res 2002; 54: 499502.
  • 27
    Tellides G, Tereb DA, Kirkiles-Smith NC et al. Interferon-gamma elicits arteriosclerosis in the absence of leukocytes. Nature 2000; 403: 207211.
  • 28
    Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med 2003; 9: 669676.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Figure S2: Representative examples of elastic van Giessen staining of normal apoE-/- mouse carotid artery (a), and 1 (b), 3 (c) and 4 (d) weeks after wire injury, demonstrating marked vascular remodeling over a period of 4 weeks. Scale bar: 100?m.

FilenameFormatSizeDescription
Figure+S1+and+S2.doc8111KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.