SEARCH

SEARCH BY CITATION

Keywords:

  • Immune system;
  • nuclear factor-kappa B (NF-κB);
  • RIP2;
  • signaling;
  • Th1/Th2;
  • transgenic/knockout mice;
  • transplantation

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Two previous reports that receptor-interacting protein (RIP)-2 knockout (RIP2–/–) mice had defective nuclear factor-kappa B (NF-κB) signaling and T helper (Th)1 immune responses had led us to believe that this putative serine-threonine kinase might be a possible target for transplant immunosuppression. Thus, we tested whether RIP2–/– mice were able to reject vascularized allografts. Surprisingly, we found that T cells from RIP2–/– mice proliferated and produced interferon (IFN)-γ after allostimulation in vitro. Moreover, naïve RIP2–/– CD4+ T cells differentiated normally into Th1 or Th2 cells under appropriate cytokine microenvironments. Consistent with these findings, no difference in allograft survival was observed between wild-type and RIP2–/– recipient mice, and rejection had similar pathology and cytokine profiles in both types of recipients. RIP2 deficiency was associated with defective NOD signaling, but this did not affect T-cell receptor (TCR)-dependent activation of the canonical NF-κB signaling or expression of NF-κB genes in rejecting allografts. Our data demonstrate that RIP2-deficient mice have intact canonical NF-κB signaling and can mount Th1-mediated alloresponses and reject vascularized allografts as efficiently as wild-type mice, thus arguing against RIP2 as a primary target for immunosuppression.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Activation of nuclear factor-kappa B (NF-κB) transcription factors is required for allograft rejection as shown in several experimental models using mice deficient for components of this pathway (1–3). Therefore, targeting the NF-κB pathway has been identified as having therapeutic potential to modulate and prevent graft rejection. Recently, two reports in Nature had claimed that mice deficient for the receptor-interacting protein 2 (RIP2), a putative serine/threonine kinase, had a severe defect in canonical NF-κB signaling leading to impaired T helper (Th)1 responses (4,5). In addition, a decreased alloresponse to nonvascularized neonatal heart tissue had been reported in these mice, although the mechanistic features of such a finding had not been studied (6). Based on this evidence, RIP2 appeared to be an attractive target for immunosuppression. Such a conclusion was further supported by the observation that RIP2 is inhibited by the pyridinyl imidazole inhibitors of p38 mitogen-activated protein kinase (MAPK) (7), providing pharmacological clues for immunosuppressive drug development.

We decided to assess directly the role of RIP2 in T-cell activation and differentiation using a vascularized transplant model. Based on the evidence presented above, we hypothesized that RIP2 would be required for vascularized allograft rejection. Here, we report that, contrary to what was expected, RIP2-deficient mice are fully capable of rejecting vascularized allografts and demonstrate that RIP2 is not required for T-cell receptor (TCR)-dependent, canonical NF-κB activation and Th1 cell differentiation both in vitro and in vivo.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Mice

RIP2−/− C57BL/6 mice have been previously described (4) and were obtained from Dr. R. Flavell (Yale University, New Haven, CT). C3H mice were purchased from Charles River (Wilmington, MA). Both knockout and wild-type (WT) mice were derived from the same breeding colony and maintained in the animal facility at the University of Western Ontario with approval from the Animal Use Subcommittee in accordance with the Canadian Council on Animal Care Guidelines.

Assessment of RIP2 DNA, RNA and protein

RIP2−/− mice were identified by sequence-confirmed, polymerase chain reaction (PCR)-based screening of genomic tail DNA using the Taq Titanium PCR kit (Clontech, Palo Alto, CA). Reverse transcriptase PCR was carried out using the Advantage RT PCR kit (Clontech) as per the manufacturer's instructions. RNA was isolated using the RNeasy Mini Kit (Qiagen, Mississauga ON). All primers were designed and purchased from Integrated DNA Technologies (Coralville, IA) (Table 1). Whole-cell lysates for Western blotting were prepared using 1% Triton X-100 lysis buffer. Detection of RIP2 protein was performed with a rabbit polyclonal antibody against the N terminus of RIP2 (eBioscience, San Diego, CA).

Table 1.  Primers for DNA and RNA amplification
Primer Sequence (5'–3')
RIP2 wild-type (genomic)ForwardTTGGAGCTTCCTCTAGTGCTGTTC
ReverseCCCAAAAATTCAGGCTCATGC
RIP2−/− (genomic)ForwardCTGTGCTCGACGTTGTCACTG
ReverseGATCCCCTCAGAAGAACTCGT
RIP2 (RT PCR)ForwardCCGCATCCTGCATGAAATTGCTCT
ReverseTGGCTCACAATGGCTTCCCTCTTA
IL-2 (real-time PCR)ForwardCCTGAGCAGGATGGAGAATTACA
ReverseTCCAGAACATGCCGCAGAG
IL-12p35 (real-time PCR)ForwardACCTGCTGAAGACCACAGATGACA
ReverseTAGCCAGGCAACTCTCGTTCTTGT
IFN-γ (real-time PCR)ForwardTGGGTTGACCTCAAACTTGGC
ReverseGGCCATCAGCAACAACATAAGCGT
IL-4 (real-time PCR)ForwardAGCCATATCCACGGATGCGACAAA
ReverseAATATGCGAAGCACCTTGGAAGCC
IL-10 (real-time PCR)ForwardGGTTGCCAAGCCTTATCGGA
ReverseACCTGCTCCACTGCCTTGCT
IL-17A (real-time PCR)ForwardCTCAAAGCTCAGCGTGTCCAAACA
ReverseTATCAGGGTCTTCATTGCGGTGGA
RIP2 (real-time PCR)ForwardATGCCACCTGAGAACTATGAGCCA
ReverseGCAAAGGATTGGTGACCTCTTC

Stimulation of RIP2–/– T lymphocytes

Mouse CD4+ T lymphocytes were isolated by magnetic cell sorting from single-cell suspension splenocytes (Miltenyi Biotec, Auburn, CA). For T-cell proliferation assays, cells were stimulated with either plate-bound anti-CD3 antibody (2C11, 10 μg/mL) and anti-CD28 antibody (2 μg/mL, eBioscience) or phorbol 12-myristate 13-acetate (PMA) (50 ng/mL) and ionomycin (750 ng/mL) for up to 96 h, under the same conditions as reported by Kobayashi et al(4). Proliferation was assessed by 3H-thymidine incorporation after a 24-h pulsing, and cytokine production was measured by enzyme-linked immunosorbent assay (ELISA) (BD Biosciences, San Jose, CA). To induce Th cell differentiation, T cells were stimulated with plate-bound anti-CD3 antibody (2C11, 10 μg/mL) in the presence of either interleukin (IL)-12 (3.5 ng/mL) and anti-IL-4 (2 μg/mL) antibody (Th1-polarizing conditions) or IL-4 (1000 U/mL) plus anti-interferon (IFN)-γ (2.5 μg/mL) and anti-IL-12 (0.5 μg/mL) antibodies (Th2-polarizing conditions). After 4 days, cells were washed and restimulated with plate-bound anti-CD3 for 24 h. Production of IFN-γ and IL-4 was determined by ELISA (BD Biosciences).

Mixed leukocyte reactions (MLR)

Isolated WT or RIP2−/− responder C57BL/6 splenocytes (1 × 105 cells/well) were added to mitomycin C-treated C3H (allogeneic) or C57BL/6 (syngeneic) stimulator splenocytes (1 × 105/well) for 54 h before pulsing with 1 μCi of 3H-thymidine and harvested 18 h later. Each culture was performed in triplicate. Stimulation indexes were calculated as the ratio of the counts per minute (cpm) of the allogeneic MLR divided by the cpm from the syngeneic MLR.

Heart transplants

Abdominal heterotopic heart transplants were performed as described previously (8). Postoperatively, graft viability was assessed by abdominal palpation of transplant heartbeat. Graft rejection was determined by lack of palpable heartbeat and confirmed by histopathology.

Histopathology

Hematoxylin and eosin-stained paraffin sections of transplanted hearts were examined by a pathologist blinded to recipient mouse genotype and graded for rejection. Criteria for graft rejection included the presence of vasculitis, thrombosis, fibrin deposition, hemorrhage and lymphocyte infiltration; each scored as: 0, no change; 1, minimum change; 2, mild change; 3, moderate change or 4, marked change.

RNA quantification by real-time PCR

Expression of cytokine mRNA transcripts was quantified using the M× 4000 multiplex quantitative PCR system using Brilliant SYBR Green QPCR Core Reagent kit (Stratagene, La Jolla, CA). Total RNA was isolated using Trizol reagent (Invitrogen Life Technologies, Burlington, ON) according to the manufacturer's instructions. cDNA was synthesized using the Omniscript reverse transcriptase kit and oligo dT 12–18 primers (Qiagen, Montgomery County, MD). Gene-specific primers (Table 1) were purchased from Integrated DNA Technologies. Amplified products were sequenced to confirm specificity to the transcript of interest. The relative expression levels of the cytokine mRNAs were determined by comparing the threshold detection values (Ct) of the genes of interest in the allograft versus isograft and were normalized to the hypoxanthine phosphoribosyl transferase gene using the ΔΔCt method (9).

NF-κB activation assay

RIP2+/+ and RIP2−/− mouse splenocytes were stimulated with anti-CD3 antibody (2C11, 10 μg/mL) and PMA (20 ng/mL) for 0, 5, 30 and 60 min. Whole-cell lysates were prepared using 1% Triton X-100 lysis buffer as previously described (10). Western blots were performed using polyclonal antibodies against phospho-I-kappa-B(IKB)-α protein (Ser32) and IKB-α (Cell Signaling Technology, Danvers, MA). Relative expressions of NF-κB subunits and NF-κB-dependent inflammatory cytokine mRNAs in the rejecting allografts were determined using the toll-like receptor-signaling pathway (RT2 Profiler PCR Array; SuperArray Bioscience Corporation, Frederick, MD). Previously described isolated RNA from rejecting allografts was transcribed to cDNA and applied to the RT2 Profiler PCR Array as per the manufacturer's instructions.

Statistics

The significance of statistical differences in proliferation and cytokine production was determined using the Student's t-test. Allograft survival curves were compared using the Kaplan–Meier method. Comparison of pathology scores was completed using the Mann–Whitney comparison tests for nonparametric data. All statistics were tabulated using Prism statistical software (Graphpad, San Diego, CA). Differences were considered statistically significant if p < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

T cells from RIP2–/– mice can differentiate into Th1 cells

Germline RIP2 deficiency was confirmed by PCR amplification of genomic DNA for the RIP2 allele or inserted neomycin cassette in WT (RIP2+/+), heterozygous (RIP2+/−) and homozygous (RIP2−/−) mice (Figure 1A). Additionally, the expression of RIP2 mRNA and protein were examined under resting conditions and after stimulation with PMA and ionomycin (Figures 1B and C). In WT splenocytes, both RIP2 mRNA and protein were detected by reverse transcriptase PCR and Western blotting, respectively, at the baseline and were upregulated after 4 and 8 h of stimulation. Conversely, no expression of RIP2 mRNA or protein was detected at the baseline or after stimulation in RIP2−/− splenocytes.

image

Figure 1. RIP2–/– mice lack RIP2 expression. (A) DNA genotyping by PCR of genomic tail DNA from wild-type (RIP2+/+), heterozygous (RIP2+/−) and homozygous knockout (RIP2−/−) mice. PCR was run as per conditions stated in the Material and Methods section. (B) Lack of expression of RIP2 mRNA in RIP2−/− splenocytes as measured by reverse transcription (RT) PCR. Splenocytes from RIP2+/+ and RIP2−/− mice were stimulated with PMA and ionomycin (50 ng/mL and 750 ng/mL, respectively) and RNA was isolated at 0, 4 and 8 h poststimulation. RIP2 mRNA was amplified in a one-step RT-PCR reaction. β-actin amplification was used as a control. (C) Lack of expression of RIP2 protein in RIP2−/− splenocytes by Western blotting. After stimulation with PMA/ionomycin as above, whole cell lysates were prepared and RIP2 protein was detected by immunoblotting with an antibody against the N-terminus of RIP2. Sequential β-actin blotting was used as a protein-loading control.

Download figure to PowerPoint

We then tested the immune function of RIP2-deficient mice. As reported (11), RIP2−/− splenocytes failed to mount an IL-6 response to muramyl dipeptide (MDP) a NOD2 ligand, but responded to lipopolysaccharide (LPS) (Figure 2A). The response of RIP2-deficient splenocytes to LPS was observed as less than the one in WT mice, a consistent finding due to the regular contamination of LPS preparations with nucleotide-oligomerization domain protein 2 (NOD) ligands that contribute to the higher response in WT mice (Figure 2A). As expected, stimulation of splenocytes with MDP and LPS further increase the IL-6 response in WT mice but not in RIP2-deficient mice (Figure 2A).

image

Figure 2. Responses of RIP2–/– mice to LPS, MDP and TCR ligation. (A) Reduced NOD-dependent responses in RIP2−/− mice. Production of IL-6 by RIP2+/+ and RIP2−/− splenocytes after stimulation with MDP (10 μg/mL), LPS (10 ng/mL) or both for 24 h. IL-6 in the culture supernatants was measured by ELISA. Proliferation (B) and production of IL-2 (C) and IFN-γ (D) of RIP2+/+ (squares, black bars) and RIP2−/− (triangles, white bars) splenocytes after T-cell stimulation for the indicated times, with plate-bound anti-CD3 antibody (10 μg/mL) and anti-CD28 antibody (2 μg/mL). Proliferation was measured by incorporation of 3H-thymidine after 24 h of pulsing, and cytokines were measured by ELISA. (E, F) Polarization of naïve wild-type T cells versus RIP2−/− T cells into Th1 or Th2 cells. For Th1 differentiation, cells were stimulated with plate-bound anti-CD3 antibody in the presence of IL-12 and anti-IL-4 antibody for 4 days and subsequently restimulated with anti-CD3 antibody for 24 h. For Th2 differentiation, cells were stimulated with plate-bound anti-CD3 antibody in the presence of IL-4 and anti-IFN-γ and anti-IL-12 antibodies for 4 days and subsequently restimulated with anti-CD3 antibody for 24 h. To measure Th1 polarization (E), we measured IFN-γ levels in the culture supernatants after restimulation of Th1 or Th2 polarized cells with anti-CD3. To measure Th2 polarization (F), we measured IL-4 levels in the culture supernatants after restimulation of Th1 or Th2 polarized cells with anti-CD3. Statistical comparison between RIP2+/+ and RIP2−/− results was determined by the Student's t-test. Results are not significant unless indicated (**p < 0.01, ***p < 0.001, Ns = not significant), and are representative of at least three independent experiments.

Download figure to PowerPoint

Next, we studied the effect of RIP2 deficiency on T-cell responsiveness. Contrary to what was expected (4,5), we found that RIP2-deficient splenocytes were able to proliferate as efficiently as WT splenocytes in response to TCR ligation with plate-bound anti-CD3 and anti-CD28 antibodies with the same temporal profile (Figure 2B). Furthermore, RIP2−/− splenocytes produced similar amounts of IL-2 (Figure 2C) and the Th1 cytokine IFN-γ (Figure 2D) as compared to WT cells in response to TCR stimulation. Proliferation and IL-2 responses titrated similarly for WT and RIP2-deficient splenocytes (Figure S1).

To confirm these unexpected results, we directly assessed the capacity of RIP2-deficient T cells to differentiate into Th1 cells and produce IFN-γ. Purified CD4+ T cells were stimulated with anti-CD3 antibodies under either Th1-polarizing or Th2-polarizing conditions for 4 days and then examined for both IFN-γ and IL-4 production. As shown in Figure 2E, both WT and RIP2−/− CD4+ T cells produced significant amounts of IFN-γ under Th1-polarizing conditions, but not under Th2-polarizing conditions. Similarly, both WT and RIP2−/− produced more IL-4 in Th2-polarizing conditions compared to Th1-polarizing conditions (Figure 2F). Based on these results and contrary to what was expected from two previous reports (4,5), we concluded that RIP2-deficient CD4+ T cells are capable of efficient proliferation and differentiation into a Th1-, IFN-γ-producing phenotype.

RIP2-deficient mice have a preserved alloresponse

Next, we tested whether RIP2-deficient T cells preserved alloreactivity. Although a previous report had suggested decreased alloresponses in RIP2 knockout mice (6), such a claim was based on nonvascularized, neonatal tissue transplants and had not explored the cytokine profile associated to these responses. Using a fully MHC haplotype-incompatible transplant model (C57BL/6 or H-2b vs. C3H or H-2k), we assessed the in vitro and in vivo alloreactivity of RIP2-deficient T cells. We found that RIP2−/− splenocytes were able to proliferate as effectively as WT splenocytes in response to a titrated allostimulation with C3H splenocytes in MLR (Figures 3A and S2). Furthermore, IFN-γ was produced in similar amounts by WT and RIP2−/− T cells in MLR (Figure 3B). Thus, RIP2-deficient T cells can mount a full in vitro alloresponse and produce the prototypical Th1 cytokine IFN-γ in response to allostimulation.

image

Figure 3. Alloreactivity in RIP2–/– mice. (A) Mixed leukocyte reaction (MLR) of RIP2+/+ or RIP2−/− splenocytes (H-2b) responding to mitomycin C-treated stimulator splenocytes (H-2k). Responder proliferation was measured by 3H-thymidine uptake at 72 h, and stimulation index calculated as indicated in the Material and Methods section. Statistical comparison was performed by the Student's t-test (p = 0.48). (B) IFN-γ in the supernatant from the above MLRs at 60 h as measured by ELISA. Statistical comparison was performed by the Student's t-test (p = 0.34). Data are representative of three experiments, and presented as mean ± standard error of mean (SEM) of triplicate readings. (C) RIP2-competent, C3H (H-2k) hearts were transplanted into the abdominal cavity of RIP2+/+ (n = 8) or RIP2−/− (n = 8) C57BL/6 (H-2b) recipients. Allograft survival was assessed by abdominal palpation for heartbeat, and graft failure was confirmed by histopathology. Results are shown as the Kaplan–Meier survival curves and median allograft survival was compared by the log-rank test (p = 0.64). (D) Reverse transplant combinations from (A) with C57BL/6 RIP2+/+ or RIP2−/− hearts transplanted into RIP2-competent C3H recipients. Results are shown as the Kaplan–Meier survival curves and median allograft survival was compared by the log-rank test (p = 1.0).

Download figure to PowerPoint

We next examined the ability of RIP2−/− mice to reject a vascularized allograft. Heterotopic abdominal cardiac transplants were performed using C3H donor hearts and WT versus RIP2−/− C57BL/6 recipients. As shown in Figure 3C, there was no statistically significant difference in allograft survival between WT recipients and RIP2-deficient recipients, with rejection occurring at a median of 7.0 days in the former versus 6.5 days in the latter. To rule out a significant contribution of donor WT antigen-presenting cells (APC), WT and RIP2−/− hearts were transplanted into allogeneic recipients. Both WT and RIP2-deficient hearts were rejected in a median of 7 days in C3H recipients without any difference between the two groups (Figure 3D).

The histopathology of the rejecting C3H allografts in RIP2+/+ and RIP2−/− recipients showed no difference in the median rejection scores, with severe vasculitis, hemorrhage and necrosis (Figure S3) and evidence of both cell-mediated and antibody-mediated damage to the allografts (Table S1). In addition, we examined the cytokine profiles within the rejecting allografts by real-time PCR and found no significant difference in the levels of expression of IL-2, IL-12p35, IFN-γ and IL-10 RNAs between cardiac allografts from both WT and RIP2−/− recipients (Figure S4). No expression of IL-4 RNA or IL-17A RNA was detected in the allografts rejected by WT or RIP2-deficient recipients. Therefore, based on the in vitro and the in vivo data, we concluded that RIP2 deficiency does not stop full Th1 differentiation, does not alter alloreactivity and does not prevent vascularized allograft rejection.

RIP2 expression is increased in the rejecting allograft

RIP2 expression is upregulated by immune cell activation (12). To confirm that immune cell activation and interaction with the parenchymal tissue of the allograft was occurring in RIP2-deficient mice, we examined if the immune cell activation in the allografts rejected by RIP2-deficient mice upregulated RIP2 expression in parenchymal (WT) cells. RIP2 RNA expression was detected in the WT isograft as ischemic injury upregulates RIP2 expression (13). More importantly, we found RIP2 RNA expression in the allografts transplanted into RIP2−/− recipients (Figure 4A). This level of expression was determined to be RIP2 expression by the WT donor allograft as RIP2 RNA expression was found in cardiac tissue of both transplanted WT hearts as well as native WT hearts, but not in the native heart of RIP2-deficient recipients (Figure 4B).

image

Figure 4. Increased RIP2 expression in RIP2-competent allografts in response to cellular rejection. (A) Total RNA was isolated from rejected RIP2-competent C3H cardiac allografts in RIP2+/+ and RIP2−/− recipients (n = 8 mice per group). Expression of RIP2 mRNA was quantified by real-time PCR. Results are presented as relative fold amplification over C3H isograft RIP2 mRNA expression (set as a value of 1). The experiment was performed in duplicate and is reported as mean ± standard deviation. RIP2+/+ and RIP2−/− mRNA levels were compared using the Student's t-test (NS = p > 0.05). (B) Expression of RIP2 mRNA in native (N) and transplanted (T) wild-type hearts into RIP2+/+ and RIP2−/− recipients. Total RNA was isolated from the specified tissue and RIP2 mRNA was subsequently amplified by one-step reverse transcription PCR. Wild-type splenocytes stimulated with PMA/ionomycin (50 ng/mL and 750 ng/mL, respectively) are shown as a positive control (PC). NC = no template negative control. Relative RIP2 RNA expression was semi-quantified by plotting the ratio of the density of amplified RIP2 RNA to β-actin RNA, expressed as the relative density value. The result is representative of the results form 8 mice per group.

Download figure to PowerPoint

Canonical NF-κB signaling is intact in RIP2-deficient T cells

Canonical NF-κB signaling is required for alloresponses leading to graft rejection (1–3). The finding that RIP2-deficient mice were able to reject vascularized allografts implied that the canonical NF-κB signaling pathway in RIP2-deficient T cells was intact. To confirm that this was the case, we assessed the activation of this pathway in rejected allografts by RIP2-deficient T cells. A real-time PCR-based microarray analysis was performed using RNA isolated from rejected allografts by WT and RIP2−/− recipients. We found no difference in the relative mRNA coding for the NF-κB components, c-Rel, RelA (p65), NF-κB1 (p105/p50), NF-κB2 (p100/p52) or IKB-α, between WT and RIP2−/− recipients (Figure 5A). Similarly, mRNA transcripts of NF-κB-dependent inflammatory cytokines, such as IFN-γ, IL-1, IL-6 and tumor neerosis factor (TNF)-α, did not vary appreciably between WT and RIP2−/− recipients. Therefore, we concluded that NF-κB signaling was present in the rejected allografts of RIP2−/− recipients.

image

Figure 5. NF-κB signaling is intact in RIP2-deficient T cells. (A) Total RNA was isolated from RIP2-competent C3H cardiac allografts in RIP2+/+ and RIP2−/− recipients. NF-κB subunits and NF-κB-dependent proinflammatory cytokine mRNA levels were determined using a toll-like receptor signaling pathway RT2 Profiler PCR Array. Results are presented as relative fold amplification over C3H isograft RIP2 mRNA expression (set as a value of 1). Gene products examined included: the NF-κB subunits and regulators Rel (c-Rel), RelA (p65), NF-κB1 (p105/p50), NF-κB 2 (p100/p52) and NF-κB1ia (IKB-α), as well as the proinflammatory cytokines IL-1α, IL-1β, IL-2, IL-6, IFN-γ and TNF-α. (B) Expression of phosphorylated and total IKB-α in wild-type and RIP2-deficient T cells following TCR ligation. After stimulation with anti-CD3 antibody (10 μg/mL) and PMA (20 ng/mL) for the indicated times, whole-cell lysates were prepared and immunoblotted for phospho-IKB-α (with antibodies against the phosphorylated serine 32 residue) or for total IKB-α (with antibodies against the N-terminus of IKB-α). Results are representative of two independent experiments.

Download figure to PowerPoint

We next assessed directly the activation of canonical NF-κB signaling in RIP2−/− T cells by looking at the phosphorylation of the IKB-α subunit, a modification required for release and translocation of active NF-κB transcription factors. We detected phosphorylation of IKB-α within 30 min after TCR ligation to the same extent in WT and RIP2-deficient T cells (Figure 5B). Thus, we concluded that canonical NF-κB signaling was intact in RIP2−/− T cells. Thus, RIP2 is not required for canonical NF-κB signaling following TCR ligation in T cells.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Previous work had suggested that NF-κB signaling, Th1-mediated immunity and alloresponsiveness might be impaired in RIP2-deficient T cells (4,5). Here, we have tested directly these claims and, surprisingly, found that RIP2−/− T cells are fully capable of signaling through the canonical NF-κB pathway in response to TCR ligation, both in vitro and in vivo. This translates into RIP2-deficient mice being able to mount a Th1 response to alloantigen and reject vascularized allografts as effectively as WT mice. These results establish for the first time that RIP2 is not required for TCR-dependent, canonical NF-κB-mediated alloresponses. More importantly, our findings raise a cautionary note on targeting RIP2 to develop transplant immunosuppression.

Several mechanisms may explain why RIP2 deficiency does not affect Th1 differentiation and alloresponses. One could be that antigen presentation by donor RIP2-competent cells compensates for RIP2 deficiency in the recipients’ APCs, leading to production of IL-12 and a full Th1 response. If correct, this would imply that direct allorecognition is, by itself, sufficient to trigger a Th1-like alloresponse (14), and that, contrary to what was originally reported (4,5), RIP2 in T cells is not required to respond to IL-12. A second possibility is that RIP2 is upregulated in the donor WT tissue and is subsequently released and taken up by infiltrating RIP2-deficient cells, thus becoming RIP2-competent cells. Although we detected upregulation of RIP2 RNA in the rejecting allograft, there is no evidence to this date that RIP2 protein can be secreted and taken up in active form by other cells.

A third explanation is that, in T cells, RIP2 is not an effector molecule of NF-κB activation downstream of the TCR. This is based on our finding that canonical TCR-dependent NF-κB signaling is intact in RIP2-deficient T cells after in vitro and in vivo stimulation. Furthermore, naïve, RIP2-deficient CD4+ T cells can differentiate in vitro and in vivo into effector Th1 cells, an action that is dependent upon NF-κB activation (15,16). This is also consistent with previous observations that deficiency in effector molecules of the NF-κB pathway abrogates both Th1 responses and alloimmunity. For example, deficiency of c-Rel impairs Th1 development (16) and c-Rel deficiency and dominant negative IκB(ΔN) mutants cause indefinite allograft survival (15). Thus, if RIP2 were an effector of the canonical NF-κB pathway, one would have expected to see a deficiency in alloreactivity and a prolonged allograft survival.

Our conclusion that RIP2 is not an effector molecule in the NF-κB signaling cascade does not preclude that RIP2 may still play a regulatory role in the NF-κB pathways. For example, RIP2 has been shown to associate with numerous proteins and adaptor molecules including multiple TRAF family proteins (17), NOD1 (20), NOD2 (18), TRIP6 (19) and Bcl10 (6), primarily through caspase recruitment domain (CARD)–CARD interactions. Through these interactions, RIP2 may act as a regulator through its kinase activity, or more likely act as an adaptor, given that the kinase activity of RIP2 seems to be expendable for its biological activity (17,20). In this way, RIP2 may regulate steps of the NF-κB pathways that are proximal to the TCR.

The results presented here have significant implications to the field of transplantation and the development of immunosuppression. Canonical NF-κB signaling is currently an attractive field for immunosuppression and tolerance induction because defects in this cascade prevent allograft rejection. By showing that RIP2 is not required for activation of the canonical NF-κB pathway in response to TCR activation, our findings lessen the value of RIP2 as a primary target for immunsuppression despite the availability of compounds that may affect its activity (7). Furthermore, although we have corroborated that RIP2 is required for NOD signaling, the contribution of the NOD pathway to transplant rejection doe not seem to be biologically significant as RIP2-deficient mice rejected vascularized allografts. In this sense, the search of a function of RIP2 in T cells should be refocused. Although not an effector of the canonical pathway, we cannot exclude that RIP2 may act as a regulator of the alternative pathway of NF-κB signaling, but this does affect the quality or tempo of allograft rejection.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

We thank Dr. Richard Flavell (Yale University, New Heaven, CT) for providing the RIP2-deficient mice, Dr. Wayne Hancock (University of Pennsylvania, Philadelphia, PA) for comments and sharing data before publication and the members of the Madrenas laboratory for helpful discussions. This work was supported by an Allison Knudsen—Kidney Foundation of Canada award, the Canadian Institutes of Health Research and the Multi-Organ Transplant Program of the London Health Sciences Centre. T. Fairhead was supported by an Amgen-Krescent fellowship, and J. Madrenas holds a Canada Research Chair in Immunobiology.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Table S1: Graft rejection pathology scores of C3H cardiac allografts.

Figure S1: Response of RIP2−&sol;− splenocytes to TCR ligation and TCR&sol;CD28 ligation.

Figure S2: Alloreactivity of RIP2−&sol;− splenocytes mixed leukocyte reaction.

Figure S3. Pathology of rejecting cardiac allografts.

Figure S4: RIP2−&sol;− recipients show Th1 cytokine expression in the rejecting allograft.

Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

00000

FilenameFormatSizeDescription
AJT_2236_sm_TableS1.doc23KSupporting info item
AJT_2236_sm_FigureS1.tif31KSupporting info item
AJT_2236_sm_FigureS2.tif35KSupporting info item
AJT_2236_sm_FigureS3.tif4676KSupporting info item
AJT_2236_sm_FigureS4.tif87KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.