SEARCH

SEARCH BY CITATION

Keywords:

  • Chronic allograft dysfunction;
  • IF/TA;
  • miRNA

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Despite the advances in immunosuppression, renal allograft attrition over time remains unabated due to chronic allograft dysfunction (CAD) with interstitial fibrosis (IF) and tubular atrophy (TA). We aimed to evaluate microRNA (miRNA) signatures in CAD with IF/TA and appraise correlation with paired urine samples and potential utility in prospective evaluation of graft function. MiRNA signatures were established between CAD with IF/TA versus normal allografts by microarray. Validation of the microarray results and prospective evaluation of urine samples was performed using real-time quantitative-PCR (RT-qPCR). Fifty-six miRNAs were identified in samples with CAD-IF/TA. Five miRNAs were selected for further validation based on array fold change, p-value and in silico predicted mRNA targets. We confirmed the differential expression of these five miRNAs by RT-qPCR using an independent set of samples. Differential expression was detected for miR-142-3p, miR-204, miR-107 and miR-211 (p < 0.001) and miR-32 (p < 0.05). Furthermore, differential expression of miR-142-3p (p < 0.01), miR-204 (p < 0.01) and miR-211 (p < 0.05) was also observed between patient groups in urine samples. A characteristic miRNA signature for IF/TA that correlates with paired urine samples was identified. These results support the potential use of miRNAs as noninvasive markers of IF/TA and for monitoring graft function.


Abbreviations: 
ACR

acute cellular rejection

CAD

chronic allograft dysfunction

Ct

threshold cycle

eGFR

estimated glomerular filtration rate

IF

interstitial fibrosis

IPA

ingenuity pathways analysis

KT

kidney transplantation

KTRs

kidney transplant recipients

MDRD

modification of diet in renal disease

miRNA

microRNAs

MSO

miRNA-specific oligonucleotide

QDA

quadratic discriminant analysis

ROC

receiver operating characteristics

RT-qPCR

real-time quantitative-PCR

TA

tubular atrophy

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Kidney transplantation (KT) is the treatment of choice for end-stage kidney disease (1). Despite the advances in immunosuppression, allograft attrition over time remains unabated due to chronic allograft dysfunction (CAD; Ref. 1). As defined by the Banff criteria, CAD remains a nonspecific pathologic entity encompassing histologic changes of interstitial fibrosis and tubular atrophy (IF/TA), glomerulosclerosis, splitting of glomerular capillary basement membranes and/or vascular intimal hyperplasia (1,2).

A major obstacle in the management of transplant recipients is a lack of accurate and specific tests for immune monitoring as well as predicting long-term graft function. Currently available and accessible methods for evaluating kidney function are either ineffective and inaccurate or highly invasive, such as tissue biopsies (3,4). Measurements of serum creatinine, estimated glomerular filtration rate (eGFR) and proteinuria as well as biopsies remain the current gold standards for the evaluation of renal allografts (5–11). These tests have significant limitations in predicting which patients are destined for immune tolerance or immune-mediated graft loss, and assisting in the management of long-term immunosuppression (5–11). Biomarkers allowing sensitive and accurate monitoring of graft function, early and specific diagnosis of rejection, assessment of long-term outcome allowing for a tailored immunosuppressive therapy in a noninvasive and cost-effective manner are critically needed (12).

MicroRNAs (miRNAs) are a family of noncoding 22-nucleotide RNAs expressed in a tissue-specific manner that can regulate gene expression levels of target mRNAs. MiRNAs can repress mRNA translation or reduce mRNA stability of target genes, although translational activation mechanisms and transcriptional effects have also been reported in the literature (13–17). MiRNAs are now shown to be stably expressed in serum, plasma, urine, saliva and other body fluids. Moreover, the expression patterns of these circulating miRNAs are correlated with human diseases including various types of cancer and represent potentially informative biomarkers. Furthermore, urinary miRNA profiling might offer valuable information in kidney disease (17–19).

In the KT field, to date, there have been two studies evaluating miRNA profiles in kidney allograft with acute cellular rejection (ACR; Refs. 20,21). However, miRNA profiling associated with other factors, such as monitoring graft function and predicting long-term outcomes has not been evaluated yet.

Here, we have identified a miRNA expression signature for IF/TA and have confirmed the differential expression of five of these miRNAs in an independent set of allograft biopsy samples. Moreover, we have confirmed detection, and differential expression of three of these miRNAs, in urine samples of patients diagnosed with IF/TA. To the best of our knowledge, this is the first study to report an miRNA signature associated with CAD with IF/TA. Furthermore, we prospectively evaluated the identified miRNA signature in kidney transplant recipients (KTRs) identifying several patients with consistent IF/TA-like miRNA changes in concordance with histologic findings whereas their serum creatinine and eGFR measurements indicated normal renal function.

Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Kidney tissue samples

KTRs of unique deceased donor kidneys were included in the study. Written informed consent was obtained from all patients. The institutional review board at Virginia Commonwealth University (VCU-IRB Protocol #HM11454) approved the study protocol. Renal allograft tissue was obtained with an 18-gauge needle and placed in RNAlater (Ambion, Austin, TX, USA) immediately after collection. No living donors, HIV positive or retransplantation patients were included. All samples were classified based on histopathology using Banff criteria (2,22). All normal allograft (NA) samples selected were collected at 9 months or later posttransplantation and had continued eGFR values >60 mL/min/1.73 m2. Estimated GFR was calculated using the modification of diet in renal disease formula (23).

RNA isolation

Total RNA was extracted using Trizol (Life Technologies Inc., Gaithersburg, MD, USA) from biopsy tissue or urinary cell fractions following the manufacturer's protocol. Before microarray processing, RNA integrity and quality was evaluated as previously described (24).

Illumina BeadChip®Array—microarray processing

Total RNA from IF/TA (N = 13) and NA (N = 5) was processed following the manufacturer's protocol. The final reaction products were hybridized to Sentrix Universal BeadChip® Arrays (Illumina, San Diego, CA, USA). After hybridization, the arrays were imaged using an Illumina BeadArray® Reader (Illumina) and the intensity files analyzed with the BeadStudio® software suite (Illumina).

Data Analysis

Following the prenormalization assessment described by Cunningham et al. (25), unnormalized intensities without background subtraction were exported from GenomeStudio. Two technical replicates and two hybridization replicates were included in the experimental design to evaluate the reproducibility of the assay. For all hybridization replicates, MA plots were constructed (not shown) and Spearman's rank correlations calculated (0.936 and 0.921 for the technical replicates and 0.996 and 0.911 for the hybridization replicates). Unsupervised hierarchical clustering using Ward's method was applied to the miRNA data where 1-Pearson's correlation was the distance measure; all replicate hybridization clustered together (not shown). A detection p ≤ 0.01 was used to identify detected miRNAs. The miRNA data set was then filtered to include only those miRNAs detected in at least 50% of the samples and having an miRNA standard deviation of expression intensities in the 90th percentile or higher. The miRNA data was then normalized using the quantile normalization method and then the data set was restricted to the independent sample groups. To identify miRNAs exhibiting significant differential expression between these groups, miRNA level analysis of variance models were fit considering miRNA expression as the response and tissue type as the fixed effect of interest. A group means parameterization of tissue type was included as the fixed effect term to facilitate extraction of linear contrasts of interest. To adjust for multiple comparisons, the q-value method was used; miRNAs with a false discovery rate (FDR) ≤5% were considered significant. The limma package was used to fit the mixed effects models using restricted maximum likelihood procedure; an empirical Bayes method was applied to moderate miRNA standard errors by borrowing information across the entire set of miRNAs.

Validation of miRNA microarray results

Real-time (RT) quantitative-PCR (qPCR) reactions were used for quantifying the expression of miR-142-3p (assay ID: 000464), miR-32 (assay ID: 0021090), miR-204 (assay ID: 000508), miR-107 (assay ID: 000443) and miR-211 (assay ID: 000514) using predesigned TaqMan® miRNA expression assays (Applied Biosystems, Foster City, CA, USA) following the manufacturer's protocol. The endogenous control RNU48 (assay ID: 001094) was used for normalization. Threshold cycle (Ct) values were used to calculate relative expression using the ΔΔCt method where relative expression = 2–ΔΔCt, where ΔΔCt = (ΔCt of IF/TA) – (ΔCt of NA).

MiRNA/mRNA correlation analyses

Correlation analyses were carried out between the miRNA array expression data and an independently generated mRNA gene expression signature previously published (24). Pearson's correlation coefficients and p-values were calculated for every miRNA/mRNA pair between the differentially expressed IF/TA miRNAs (n = 15) and probesets (n = 2223). A permutation analysis was performed to assess the statistical significance of the observed differentially expressed miRNA/mRNA correlations and determine the null distribution. For each correlation, 1000 permutations were carried out between each miRNA and a randomly selected sample of 2223 probesets to determine the null distribution. Empirical p-values were derived by comparing the observed correlation coefficients to the null distribution obtained from the permuted Pearson values.

Interaction networks and functional analysis

Gene ontology and gene interaction analyses were analyzed through the use of ToppGene (http://toppgene.cchmc.org/; Ref. 26) and Ingenuity Pathways Analysis (IPA, Ingenuity® Systems, Redwood City, CA, USA). Gene lists containing Entrez Gene IDs were used as input. Biological functions and pathways with p < 0.05 were considered significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Patients and samples

A total of 81 KTRs (167 samples: 45 allograft kidney biopsies and 122 urine samples) were included in this study. As part of the study design, KTRs were categorized in three groups (Figure 1). Demographic and clinical characteristics of the patients and donors are shown in Table 1.

image

Figure 1. Study design. Training set: For creating a signature of differentially expressed miRNAs, allograft tissue samples with histologic diagnosis of CAD with IF/TA were evaluated using microarrays. Normal allograft (NA) samples (defined as samples obtained from kidney transplant recipients with at least 9 months posttransplantation, normal histology and continued eGFR > 60 mL/min/1.73 m2 were used as control group. Validation set: The selected miRNAs for validation (using in silico target prediction and consecutive filtering of the results using our preestablished CAD with IF/TA gene expression signature) were validated in an independent set of patients (CAD with IF/TA and NA) using unique and paired biopsy and urine samples and using a second method (RT-qPCR). Prospective validation set: The miRNAs identified as having correlation between tissue and urine expression were validated in an independent set of urine samples (collected at 3, 9, and 12 months posttransplantation) from 36 kidney transplant recipients.

Download figure to PowerPoint

Table 1.  Demographic and clinical characteristics of patients and donors by group
 Training setValidation setProspective validation set
NAIF/TANAIF/TA
  1. DDK = deceased donor kidney; C = Caucasian; AA = African American; O = other; CIT = cold ischemia time; WIT = warm ischemia time; PPP = pump perfusion preservation; DGF = delayed graft function; eGFR1= estimated glomerular filtration rate.

  2. 1(GFR [mL/min/1.73 m2]= 175 ×[Scr]1.154×[age in yrs]−0.203×[0.742 if female]×[1.21 if African American], where Scr is serum creatinine concentration [mg/dL]).

N51381936
Donor type (DDK)51381936
Time to collection (months)12.4 ± 3.982.5 ± 78.012.8 ± 3.392.6 ± 66.43 months, 3.9 ± 1.3
    9 months, 9.5 ± 1.1
    12 months, 12.1 ± 1.2
Recipient age (years)43.6 ± 12.639.8 ± 11.344.8 ± 16.341.4 ± 11.950.5 ± 12.2
Recipient gender (M/F)1/47/62/611/817/19
Recipient race (C/AA/O)0/4/11/12/05/2/12/17/05/29/2
Recipient HCV (pos)01013
Recipient CMV (pos)3861128
CMV disease (pos)00000
Donor age (years)42.6 ± 7.333.2 ± 1537 ± 1337.8 ± 13.842.4 ± 15.6
Donor gender (M/F)2/37/62/68/1119/17
Donor race (C/AA/O)0/5/07/5/15/2/112/5/221/14/1
Donor HCV (pos)02022
Donor HBV cAb (pos)11124
Donor HBV sAb (pos)11111
Donor CMV (pos)293919
Donor HIV (pos)00000
CIT (min)1039.2 ± 434.41097.5 ± 486.21092.1 ± 240.6976.1 ± 556.91186.3 ± 416.3
WIT (min)28.6 ± 6.729.5 ± 4.329.1 ± 6.432.8 ± 10.529.1 ± 6.3
PPP (min)362.4 ± 418.2793.4 ± 785.1473.5 ± 363.5179.6 ± 462.2550.6 ± 494.7
DGF incidence242412
Acute rejection incidence14163
HLA MM total4 ± 1.43.25 ± 2.54.3 ± 1.23.5 ± 1.64.3 ± 1.3
PRA at Tx (T-cell)67.6 ± 38.673.5 ± 0.755.5 ± 38.050.5 ± 31.848.0 ± 35.2
eGFR 1 month (mL/min/1.73 m2)>60N/A>60N/A53.7 ± 22.0
eGFR 3 months (mL/min/1.73 m2)>60N/A>60N/A56.7 ± 21.1
eGFR 6 months (mL/min/1.73 m2)>60N/A>60N/A56.0 ± 21.8
eGFR 9 months (mL/min/1.73 m2)>60N/A>60N/A56.3 ± 25.8
eGFR 12 months (mL/min/1.73 m2)>60N/A>60N/A54.8 ± 23.2

Identification of miRNA signature

Biopsy samples were classified as either NA (N = 5) or IF/TA (N = 13) based on histopathological reports using the most current Banff criteria (2,22). MiRNAs with FDR ≤ 5% were considered significant. Fifty-six miRNAs were identified as significantly differentially expressed between the two groups (Table 2). Based on in silico mRNA target prediction and comparison of these targets to an independently-generated mRNA IF/TA signature (24), we reduced this list to 15 miRNAs of interest (Table 2, miRNAs in bold). Supervised hierarchical clustering and principal component analysis of the miRNA array data for the reduced miRNA set shows a distinct separation between NA and IF/TA samples (Figure 2).

Table 2.  Differentially expressed miRNAs identified from each pairwise comparison
MicroRNATarget mature sequences on Illumina BeadChip® arrayp-ValueFDR
  1. p-Values and q-Values are listed for each comparison.

  2. *Denotes mature miRNA.

HS_29TGTGCTTGGCTGAGGAGAA2.81E−133.22E−10
HS_22.1CCAAGGAAGGCAGCAGGC8.33E−083.18E−05
HS_243.1GTGAAGGCCCGGCGGAGA5.69E−071.63E−04
hsa-miR-663AGGCGGGGCGCCGCGGGACCGC1.92E−064.39E−04
hsa-miR-891aTGCAACGAACCTGAGCCACTGA5.02E−069.56E−04
hsa-miR-30c-1*CTGGGAGAGGGTTGTTTACTCC5.85E−069.56E−04
HS_263.1TCCTCCTCCTCCCCCGTC1.78E−052.55E−03
hsa-miR-483-3pTCACTCCTCTCCTCCCGTCTT2.32E−052.95E−03
hsa-miR-1275GTGGGGGAGAGGCTGTC2.86E−053.27E−03
hsa-miR-142-3pTGTAGTGTTTCCTACTTTATGGA3.68E−053.77E−03
hsa-miR-194*CCAGTGGGGCTGCTGTTATCTG4.29E−053.77E−03
hsa-miR-603CACACACTGCAATTACTTTTGC4.67E−053.77E−03
hsa-miR-663bGGTGGCCCGGCCGTGCCTGAGG5.05E−053.77E−03
solexa-8048-104ATGAATGGATGAACGA5.06E−053.77E−03
hsa-miR-494TGAAACATACACGGGAAACCTC5.26E−053.77E−03
HS_197CCCGCTCTCCCGAAGCTGTTCG6.28E−054.23E−03
hsa-miR-107AGCAGCATTGTACAGGGCTATCA1.17E−047.42E−03
HS_10ACTGGAGATATGGAAGAGCTG2.23E−041.29E−02
hsa-miR-32TATTGCACATTACTAAGTTGCA2.26E−041.29E−02
hsa-miR-139-3pGGAGACGCGGCCCTGTTGGAGT2.53E−041.38E−02
hsa-miR-608AGGGGTGGTGTTGGGACAGCTCCGT3.34E−041.74E−02
hsa-miR-129*AAGCCCTTACCCCAAAAAGTAT3.93E−041.96E−02
hsa-miR-34aTGGCAGTGTCTTAGCTGGTTGT4.62E−042.16E−02
hsa-miR-30c-2*CTGGGAGAAGGCTGTTTACTCT4.72E−042.16E−02
hsa-miR-572GTCCGCTCGGCGGTGGCCCA5.18E−042.28E−02
hsa-miR-526b:9.1CTCTTGAGGGAAGCACTTTCTGTT5.63E−042.35E−02
hsa-miR-216bAAATCTCTGCAGGCAAATGTGA5.86E−042.35E−02
hsa-miR-576-3pAAGATGTGGAAAAATTGGAATC5.95E−042.35E−02
hsa-miR-1227CGTGCCACCCTTTTCCCCAG6.15E−042.35E−02
hsa-miR-148aTCAGTGCACTACAGAACTTTGT6.86E−042.53E−02
hsa-miR-223TGTCAGTTTGTCAAATACCCCA8.02E−042.82E−02
hsa-miR-211TTCCCTTTGTCATCCTTCGCCT8.14E−042.82E−02
HS_157TGCCTGCCCTCTTCCTCCAG1.02E−033.29E−02
hsa-miR-15aTAGCAGCACATAATGGTTTGTG1.03E−033.29E−02
hsa-miR-7-2*CAACAAATCCCAGTCTACCTAA1.05E−033.29E−02
HS_94TGGGGAGCGGGAATGGATA1.07E−033.29E−02
hsa-miR-215ATGACCTATGAATTGACAGAC1.12E−033.29E−02
hsa-miR-448TTGCATATGTAGGATGTCCCAT1.14E−033.29E−02
hsa-miR-548jAAAAGTAATTGCGGTCTTTGGT1.15E−033.29E−02
hsa-miR-204TTCCCTTTGTCATCCTATGCCT1.20E−033.29E−02
hsa-miR-362-3pAACACACCTATTCAAGGATTCA1.21E−033.29E−02
hsa-miR-1257AGTGAATGATGGGTTCTGACC1.32E−033.51E−02
hsa-miR-192*CTGCCAATTCCATAGGTCACAG1.36E−033.55E−02
hsa-miR-21*CAACACCAGTCGATGGGCTGT1.40E−033.56E−02
hsa-miR-16-1*CCAGTATTAACTGTGCTGCTGA1.51E−033.69E−02
hsa-miR-154*AATCATACACGGTTGACCTATT1.51E−033.69E−02
hsa-miR-1270CTGGAGATATGGAAGAGCTGTGT1.57E−033.75E−02
hsa-miR-1249ACGCCCTTCCCCCCCTTCTTCA1.63E−033.77E−02
hsa-let-7b*CTATACAACCTACTGCCTTCCC1.65E−033.77E−02
hsa-miR-767-5pTGCACCATGGTTGTCTGAGCATG1.72E−033.86E−02
solexa-4793-177TGATGATGATGATGATGATG2.04E−034.49E−02
solexa-3793-229CAGGGCTGGCAGTGACATGGGT2.11E−034.56E−02
hsa-miR-744TGCGGGGCTAGGGCTAACAGCA2.24E−034.74E−02
HS_64TCCCTCTCCCTCCTTGCTCC2.28E−034.74E−02
hsa-let-7d*CTATACGACCTGCTGCCTTTCT2.34E−034.74E−02
hsa-miR-20b*ACTGTAGTATGGGCACTTCCAG2.36E−034.74E−02
image

Figure 2. (A) Graphical representation using supervised hierarchical clustering of the reduced set for the differentially expressed miRNAs using Ward's method. Higher intensity values are colored in red; lower values in blue. (B) Principal component analysis for the miRNA BeadChip® Array data for the 15 miRNAs of interest. NA samples are colored in green; IF/TA samples in red.

Download figure to PowerPoint

Validation of miRNA BeadChip®array results

Five miRNAs from the identified signature were selected for further confirmation based on a combination of detected array fold change, statistical significance and in silico mRNA target prediction. Differential expression of these five miRNAs was confirmed by RT-qPCR in the same RNAs used for the generation of the initial signature and using an independent set of samples from 27 additional deceased donor KTRs (NA = 8 and IF/TA = 19). A significant change in expression was detected for miR-142-3p, miR-204, miR-107, miR-211 (p < 0.001) and miR-32 (p = 0.023; Figure 3A). Unsupervised hierarchical clustering (Figure 3B) and principal component analysis (Figure 3C) of RT-qPCR ΔCt values shows a clear separation between NA and IF/TA samples. Receiver operating characteristics were calculated using ΔCt values for each miRNA (Table 3). To derive a multi-miRNA classifier predicting IF/TA versus NA, quadratic discriminant analysis was performed using the RT-qPCR ΔCt values for all five miRNAs simultaneously. All NA and IF/TA biopsies were correctly classified (0% misclassification)

image

Figure 3. (A) Taqman® MicroRNA Assays RT-qPCR results using tissue samples with histology confirmed IF/TA for 5 of the miRNAs identified in the Illumina Array study. The fold change was calculated using the ΔΔCt method. RNU48 was used as the normalizing endogenous control. (B) Unsupervised hierarchical clustering of all RT-qPCR ΔCt values using Ward's method. Higher ΔCt values are colored red; lower values are blue. (C) Principal component analysis using the RT-qPCR ΔCt data. NA samples are colored in green; IF/TA samples in red.

Download figure to PowerPoint

Table 3.  Measurement properties of the predictive models for the individual and combined (QDA) miRNAs confirmed by RT-qPCR using the ΔCt data obtained in tissue samples
 SpecificitySensitivityPPVNPVACCTPTNFPFPAUC
  1. IF/TA was defined as positive. PPV = positive predictive value; NPV = negative predictive value; ACC = accuracy; TP = true positive; TN = true negative; FP = false positive; FN = false negative; AUC = area under the curve; QDA = quadratic discriminant analysis.

miR-142-3p1.000.891.000.800.93178020.974
miR-320.880.890.940.780.89177120.822
miR-2041.000.951.000.890.96188010.967
miR-1070.881.000.951.000.96197100.954
miR-2111.001.001.001.001.00198001.000
QDA1.001.001.001.001.00198001.000

Detection of miRNAs in urine samples

The expression of these five miRNAs was evaluated in paired urine samples from patients with IF/TA confirmed histology (N = 7) compared to NA (N = 7) samples. Differential expression of miR-142-3p (p = 0.005), miR-204 (p = 0.007) and miR-211 (p = 0.017) was observed between IF/TA and NA urine samples (Figure 4A). Fold changes of 1.5 and 2.6 were calculated for miR-32 and miR-107; however, they did not meet statistical significance. Pearson's correlation coefficient between average ΔCt values in tissue and urine samples was 0.891 (p < 0.001; Figure 4B) for all miRNAs tested and 0.914 (p = 0.011, not shown) when considering only miRNAs with statistically significant differential expression in both tissue and urine samples. Unsupervised hierarchical clustering of ΔCt values shows urine IF/TA samples clustering with IF/TA biopsies (Figure 4C). One urine NA sample clustered within the IF/TA cluster. However, its ΔCt pattern was not the same as that of other IF/TA samples within the cluster; this may be indicative of early kidney dysfunction and development of IF/TA.

image

Figure 4. (A) Taqman® MicroRNA Assays RT-qPCR results using urine samples collected from patients with confirmed IF/TA. The fold change was calculated using the ΔΔCt method. RNU48 was used as the endogenous control. (B) Scatterplot comparing average ΔCt values obtained for NA and IFTA tissue and urine samples for the five miRNAs of interest. (C) Unsupervised hierarchical clustering of all RT-qPCR ΔCt values for miR-142-3p, miR-204 and miR-211 using Ward's method for all tissue and urine samples; urine samples have been designated with the letter U. Higher ΔCt values are colored red; lower values are blue.

Download figure to PowerPoint

Subsequently, prospective evaluation of miRNA expression in urine samples from a second independent group of KTRs (N = 36) undergoing protocol-biopsy was performed. Because only miR-142-3p, miR-204 and miR-211 showed statistically significant differential expression in tissue and urine samples, we focused our examination on these three miRNAs. Samples were collected at 3, 9 and 12 months posttransplantation. MiRNA expression was examined by RT-qPCR and ΔCt values were calculated as previously described. Hierarchical clustering of the obtained ΔCt values revealed two clusters of samples; cluster 1 was composed of samples with ΔCt values similar to those of NA tissue and urine samples, whereas cluster 2 was composed of samples with ΔCt values similar to those of IF/TA tissue and urine samples (Figure 5A).

image

Figure 5. (A) Hierarchical clustering of RT-qPCR ΔCt values for miR-142-3p, miR-204 and miR-211 using Ward's method for all urine samples evaluated prospectively. NA and IF/TA tissue (T) and urine (U) samples used in the signature confirmation have been colored in green (NA) and red (IF/TA) for reference; higher ΔCt values are colored red; lower values are blue. (B) Comparison of ΔCt values for miR-142-3p, miR-204, miR-211 and eGFR values for samples in clusters 1 and 2 from (A).

Download figure to PowerPoint

Samples from 19 patients segregated into cluster 2. Spearman's rank correlation showed significant correlations between the ΔCt for all three miRNAs (p < 0.001) but not between miRNA expression and eGFR at the time of collection. When comparing cluster 1 to cluster 2, ΔCt values for miR-142-3p, miR-204 and miR-211 were statistically significantly different (p < 0.001); however, eGFR at the time of collection was not significant (p = 0.951, Figure 5B) between groups. Furthermore, paired urine samples from allograft biopsies showing histologic evidence of IF/TA progression (IF (ci≥ 1) and TA (ct≥ 1) involving more than 25% of the cortical area) were localized within cluster 2. Finally, for a selected set of patients’ longitudinal analysis of the urine samples showed separation of the KTRs also in concordance with the previously described cluster 1 and cluster 2 (Figure S1).

Identification of miRNA target mRNAs

Our group recently published a gene expression comparative analysis between IF/TA and NA biopsies with the purpose of identifying molecular pathways involved in IF/TA development as well as possible early biomarkers of IF/TA progression (24). Using the publicly available miRecords database (http://mirecords.biolead.org/index.php) a list of possible mRNA targets for each of the miRNAs identified was generated (27). The predicted target tool component of miRecords integrates the prediction algorithms of several published miRNA target prediction tools: DIANA-microT, MicroInspector, miRanda, MirTarget2, miTarget, NBmiRTar, PicTar, PITA, RNA22, RNAhybrid and TargetScan (27). Only mRNA targets identified through a consensus of three individual databases were considered when generating the list of potential mRNA targets for each of the miRNAs. When comparing predicted consensus target genes to the experimentally identified IF/TA genes (1729 genes identified from 2223 probesets), 1148 genes were found to overlap between the two lists (not shown) strongly suggesting that the differentially expressed miRNAs identified here may have a regulatory role in the expression of the IF/TA genes identified in our previous study.

Correlation of miRNA expression changes with gene expression changes

Ten patient samples (five NA and five IF/TA) used in the generation of the miRNA signature were also used in the generation of mRNA signature (24). Therefore, we conducted correlation analyses between the two sets of array expression data to identify promising miRNA/mRNA pairs that could also be used as biomarkers of IFTA and possibly enhance the predictive/diagnostic potential of the miRNA signature.

Pearson's correlation coefficients and p-values were calculated for every miRNA/mRNA pair as described in the Methods. All calculated Pearson's coefficients with significant empirical p-values were >0.658; 244 predicted mRNA target genes with significant miRNA/mRNA correlations were identified. Pearson's correlation coefficients distributions for the five miRNAs confirmed by RT-qPCR are displayed in Figure 6. A summary of the correlation results can be found in Table 4. Pearson's coefficients and respective empirical p-value distributions for all significant miRNA/mRNA pairs can be found in the Supporting Information.

image

Figure 6. Distribution of the miRNA/mRNA Pearson correlation values for the five miRNAs confirmed by RT-qPCR. Only Pearson's coefficients with associated significant empirical p values were graphed. The black lines represent five representative repetitions of the null distribution obtained when expression for each of the five miRNAs was compared to randomly selected mRNA expression data.

Download figure to PowerPoint

Table 4.  Summary of correlation values obtained for the 15 miRNAs of interest
MicroRNANumber of significant p-valuesNumber of significant empirical p-valuesNumber of predicted targetsNumber of nonpredicted targets
  1. Predicted targets refer to mRNA targets predicted by a consensus of at least three database algorithms queried by miRecords (http://mirecords.biolead.org/index.php). The numbers in the table indicate probesets with significant miRNA/mRNA correlations. Bold highlights the miRNAs confirmed by RT-qPCR.

  2. *Denotes mature miRNA.

hsa-miR-194*173167330634
hsa-miR-142-3p179763240592
hsa-miR-32173158353530
hsa-miR-148a137356656509
hsa-miR-216b1017551 4544
hsa-miR-204106254721525
hsa-miR-107 78252046474
hsa-miR-223147543837401
hsa-miR-15a140739871327
hsa-miR-34a103832526298
hsa-miR-30c-2* 54526516249
hsa-miR-211 512250 7243
hsa-miR-30c-1* 21914217125
hsa-let-7b* 492 52 3 49
hsa-miR-7-2* 263 13 2 11

Interaction networks and functional analysis

Gene ontology and gene interaction analyses were carried out through the use of ToppGene (26) and IPA to identify biological functions and pathways over-represented by predicted consensus mRNA target genes with significant miRNA/mRNA correlations. Top biological functions identified from upregulated genes in this list included regulation of lymphocyte proliferation, B-cell and T-cell activation/differentiation, natural killer (NK)-cell differentiation and positive regulation of apoptosis. Top biological functions identified from genes downregulated included lipid oxidation/modification and protein dephosphorylation (Tables S1–S5). Primarily upregulated pathways identified included CD28 signaling in T-helper cells, B-cell development and allograft rejection signaling. Pathways such as butanoate metabolism, valine–leucine–isoleucine degradation and citrate cycle were composed primarily of downregulated genes (Figure S2 and Tables S1–S5).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

The identification of biomarkers for monitoring of renal function in KTRs and early detection of progression to CAD with IF/TA is crucial to improve long-term outcomes (28–30). Currently, determination of late renal allograft failure due to IF/TA relies mainly on histologic evaluation of biopsies taken when physiological parameters indicate possible dysfunction. However, development of IF/TA begins before the appearance of any clinical manifestation resulting in a diagnosis that often occurs after significant damage to the allograft has taken place (30–34). Here, we report the first CAD with IF/TA-related miRNA signature, and show that noninvasive detection of this miRNA signature is also possible in urine samples of IF/TA diagnosed patients.

Two recent reports have studied miRNA changes occurring in kidney grafts with ACR (20,21). Of the miRNAs identified in our study, six had been previously reported by Anglicheau et al. (20). Five of these (let-7, miR-30c, miR-204, miR-223 and miR-142-3p) showed similar directional expression changes in our signature compared to the earlier report, suggesting a similarity in the underlying processes involved in the two pathologies. Two additional miRNAs, miR-663 and miR-483, reported by Sui et al. (21) as differentially expressed in ACR were also identified in our signature. Our study only included deceased donor kidneys. However, the Anglicheau et al. study included both living and deceased donor transplant kidneys, whereas the Sui et al. study used normal kidneys (not normal allografts) to generate the miRNA signatures. It has been shown that posttransplant gene expression profiles of living and deceased donor kidneys are significantly different (35,36) making a true comparison between these miRNA signatures difficult. Although miRNA signatures have been generated for ACR, to date there has been no report of a miRNA signature for CAD with IF/TA.

Studies of KTRs have shown that subclinical acute rejection is associated with an increased risk of graft fibrosis (37–39). Subclinical inflammation occurring in association with IF/TA, even when it is below the threshold for the Banff criteria for acute rejection, has also been previously reported (40). These findings support the overlapping between miRNAs in ACR and CAD with IF/TA. Presence of inflammatory cells in the renal allograft interstitium is the biologic hallmark of alloimmune responses that leads to tubulointerstitial injury and subsequent IF and chronic allograft failure. Of the miRNAs confirmed by RT-qPCR, miR-142-3p (also identified as significant in ACR by Anglicheau et al. [20]) has been shown to be implicated in the functional regulation of regulatory T cells and macrophages (41). It has also been shown that Foxp3 mediates transcriptional repression of miR-142-3p; downregulation of miR-142-3p then confers regulatory T cells with suppressor functions by increasing levels of adenylyl cyclase-9 and subsequently levels of cyclic AMP (cAMP; Ref. 21). Increased levels of Foxp3 have been implicated as a marker of acute rejection (42–44) as well as correlated with the presence of interstitial inflammation, tubulitis, interstitial fibrosis, and TA (45). The increased levels of miR-142-3p observed in samples with IF/TA may indicate a decreased ability of regulatory T cells to suppressed immune related processes occurring within the kidney. The involvement of miR-142-3p in the previously described gene expression regulation also supports the common ground between ACR and CAD with IF/TA. It is expected that the final panel of biomarkers that can be used for graft monitoring will result from the combination of a set of markers instead of unique markers. Progression to CAD with IF/TA is characterized by activation of different components of the immune response and response of the graft to the injury. Consequently, it is anticipated that the resulting biomarker panel will include miRNAs involved in all the different pathways related to the disease progression.

In addition, miR-142-3p and miR-223, another miRNA identified in our signature, have been shown to be expressed in peripheral blood mononuclear cells (46,47). Expression of miR-142-3p was shown to be present in normal human T cells and granulocytes but weak in monocytes and B cells whereas miR-223 expression was confined to only myeloid lineages (47). Elevated levels of these two miRNAs in IF/TA samples may suggest involvement and/or presence of T and B cells.

MiRNA-32 has been primarily shown to be dysregulated in different types of cancer (48–53). Interestingly, in prostate tumors, elevated levels of chromosome 9 open reading frame 5 (C9orf5), the host transcript for miR-32, were reported suggesting that dysregulation of miR-32 was secondary to changes in gene expression associated with the host gene (48). This may be possible for some of the miRNAs identified in our signature since several of them are located within intronic sequences of host genes (not shown).

Several roles have been proposed for miR-204. In HeLa cells inhibition of miR-204, along with seven others, resulted in increased levels of apoptosis; the authors concluded that these miRNAs were part of a miRNA network that played a role in controlling apoptosis (54). We have observed decreased expression of miR-204 in IF/TA samples and consistent with the proposed role in apoptosis, our gene expression IF/TA signature identified elevated expression of several genes involved in induction of apoptosis (24).

Finally, there is evidence that different members of the miR-15/107 group regulate cell cycle–related mRNA targets; overexpression of these miRNAs results in G0/G1 arrest in cell lines (55,56). In pancreatic cancer cell lines, transfection of cells with miR-107 leads to decreased expression of cyclin dependent kinase-6 and overall decreased cell growth (57). Both miR-107 and miR-15 were differentially expressed in IF/TA samples. In this context, the observed downregulation of miR-107 would suggest increased expression of cell cycle progression and cell proliferation genes. Consistent with the proposed roles of each of these miRNAs, we have identified differential expression of several genes involved in lymphocyte activation/differentiation, induction and regulation of apoptosis and cell proliferation in our IF/TA gene mRNA signature (24).

More importantly, using this signature, we were able to identify changes in miRNA expression in urine samples of patients with apparently normal renal function (cluster 2, Figure 4A). Kidney physiology is dynamic, constantly adjusting to body needs. Transplant renal physiology is even more complex as the organ must not only adjust to physiological demands but also to the new host; moreover, there is also damage to the kidney associated with recovering, transport and transplantation surgery itself. The presence of persistent IF/TA-like miRNA expression changes detected in multiple consecutive samples of the same patient may be indicative of early IF/TA-related molecular changes and progression. Further follow up, both clinical and molecular, of these patients is needed to confirm these findings.

It has become evident that miRNA-regulated gene expression plays an important role in renal function and physiology (58–61) and that its dysregulation may contribute to renal diseases. It has been suggested that the miR-30 family of miRNAs contribute to the maintenance of homoeostasis and function of podocytes, and that loss of regulation by these miRNAs contributes to the formation of the observed phenotypes (58–61). Two members of this family (miR-30-c1 and miR-30-c2) were found to be differentially expressed in IF/TA samples compared to normal allografts.

MiRNA repression and activation of translational and transcriptional mechanisms have been reported in the literature (13–17). Consistent with these observations, we have identified a number of both positive and negative miRNA/mRNA correlations. Bioinformatic analyses such as the one performed here have identified many miRNA/mRNA pairs. Unfortunately, only a very small proportion of such associations have been confirmed experimentally (19). Despite advances in the sensitivity of target prediction algorithms, the overlap of predicted targets between different platforms remains relatively small. In addition, these in silico predictions are not cell type or context-specific. To overcome this limitation, our study used a previously established gene expression signature with the established critical pathways to limit the list of statistical significant interaction. Further studies are currently ongoing to validate the possible miRNA/mRNA pairs identified.

The most immediate clinical benefit of miRNAs is their use as biomarkers for diagnosis, prognosis or response to therapy. In kidney transplantation, the use of urine as a noninvasive “surrogate” biosample source is an attractive alternative because it can be easily collected at multiple time points. There is ongoing research to expand our validated signature and evaluate the discovered markers as predictors of disease progression. The association between a miRNA panel and clinical characteristics might conduct to the establishment of a “risk score panel” for monitoring graft function allowing possible early therapeutic interventions.

In summary, we have identified a miRNA expression signature for IF/TA and have confirmed the differential expression of five of these miRNAs in an independent set of tissue biopsy samples. Moreover, we have confirmed detection and differential expression of three of these miRNAs in urine samples of patients diagnosed with IF/TA. To the best of our knowledge, this is the first study to report a miRNA signature associated with CAD with IF/TA. Furthermore, we prospectively evaluated the identified miRNA signature in KTRs identifying several patients with consistent IF/TA-like miRNA changes, whereas their serum creatinine and eGFR measurements indicated normal renal function. Further studies are currently ongoing, incorporating gene expression data to the miRNA expression data to improve the predictive and discriminatory accuracy of the identified miRNA signature.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

The research results included in this report were supported by a National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) grant, R01DK080074 and the National Institute of Mental Health (MH-20030).

Disclosure

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

The authors of this manuscript have no conflicts of interest to disclose as described by the American Journal of Transplantation.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Table S1: List of significant miRNA&sol;mRNA pairs identified.

Table S2: Biological processes identified by ToppGene.

Table S3: Biological pathways identified by ToppGene.

Table S4: Biological processes identified by IPA.

Table S5: Biological pathways identified by IPA.

Figure S1: RT-qPCR longitudinal data for a selected set of samples (included in Figure 4) show the separation of urine samples in concordance with the initially described clusters.

Figure S2: Top 25 canonical pathways identified by IPA as over-represented by the 245 predicted consensus mRNA target genes with significant miRNA/mRNA correlations.

FilenameFormatSizeDescription
AJT_3666_sm_TableS1.doc7207KSupporting info item
AJT_3666_sm_TableS2.doc103KSupporting info item
AJT_3666_sm_TableS3.doc29KSupporting info item
AJT_3666_sm_TableS4.doc86KSupporting info item
AJT_3666_sm_TableS5.doc57KSupporting info item
AJT_3666_sm_Figures.doc63KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.