JT and YL contributed equally.
Original Article
Transmission of Angiosarcomas From a Common Multiorgan Donor to Four Transplant Recipients
Article first published online: 24 OCT 2012
DOI: 10.1111/j.1600-6143.2012.04301.x
© Copyright 2012 The American Society of Transplantation and the American Society of Transplant Surgeons
Additional Information
How to Cite
Thoning, J., Liu, Y., Bistrup, C., Thomassen, A., Borst, C., Marcussen, N. and Tepel, M. (2013), Transmission of Angiosarcomas From a Common Multiorgan Donor to Four Transplant Recipients. American Journal of Transplantation, 13: 167–173. doi: 10.1111/j.1600-6143.2012.04301.x
- †
JT and YL contributed equally.
Publication History
- Issue published online: 26 DEC 2012
- Article first published online: 24 OCT 2012
- Manuscript Revised: 30 AUG 2012
- Manuscript Accepted: 30 AUG 2012
- Manuscript Received: 26 JUN 2012
Funded by
- European Union. Grant Number: 62-1.2-10
- Danish Council for Independent Research. Grant Number: 10-084667
- Abstract
- Article
- References
- Cited By
Keywords:
- Angiosarcoma;
- donor tumor transmission;
- transplantation;
- urokinase-plasminogen-activator-receptor
Abstract
We describe the donor tumor transmission of metastatic angiosarcomas to four transplant recipients through transplantation of deceased-donor organs, i.e. kidneys, lung and liver, from an apparently unaffected common female multiorgan donor. Fluorescent in situ hybridization of angiosarcoma cells confirmed that the tumor was of female donor's origin in male kidney recipients. Recent literature associated increased urokinase-plasminogen-activator-receptor (uPAR) and plasma soluble urokinase-plasminogen-activator-receptor (suPAR) levels with metastatic malignancies. Now we found that, compared to baseline levels, both deceased-donor kidney recipients showed increased uPAR transcripts in mononuclear cells as well as increased plasma suPAR levels after the diagnosis of metastatic angiosarcomas, i.e. 4 months after donor tumor transmission. These results show an association of uPAR/suPAR in donor tumor transmission of metastatic angiosarcomas in humans.
- suPAR,
soluble urokinase-plasminogen-activator-receptor
- uPAR,
urokinase-plasminogen-activator-receptor.
Introduction
Donor tumor transmission is a rare event. Data from the Organ Procurement and Transplantation Network/United Network for Organ Sharing showed 18 donor-related tumors in 108 062 deceased-donor organ transplants, or one donor-related tumor for every 6,003 transplanted deceased-donor organs [1]. Angiosarcoma is a very rare but aggressive metastatic cancer type, distributed from endothelial cells. According to the literature, less than 20 cases have been described in patients after kidney transplantation. However, in these immunosuppressed patients, angiosarcomas were not located in transplanted organs, but tumors were observed within or adjacent to the arteriovenous fistula site in transplanted patients and tumors developed within several years after transplantation [2]. To the best of our knowledge, no case of simultaneous transmission of metastatic angiosarcomas ascribed to organ transplantations from a common donor has been reported.
The urokinase-plasminogen-activator-receptor (uPAR) is expressed in several cell types, including peripheral blood cells and some cancer cells. uPAR and its ligand, the serine protease urokinase-plasminogen-activator, have been attributed to tissue invasion in malignant diseases. This urokinase-plasminogen-activator/uPAR-system promotes degradation of extracellular matrix and elicits several cellular responses that include cellular adhesion, migration and proliferation [3]. After cleavage from the cell surface, soluble urokinase-plasminogen-activator-receptor (suPAR) can be observed in the plasma. Increased levels of plasma suPAR have been associated with poor prognosis in malignant cancer [4]. Yet, it is unknown whether uPAR/suPAR is also changed in patients with angiosarcomas. In humans, evidence is sparse, that uPAR and suPAR are markers related to metastatic cancer. In this study, in humans we had the rare opportunity to compare uPAR and suPAR levels before and after onset of a tumor. Unlike other settings in humans, in this study the onset of the tumor was known exactly. To evaluate the impact of the urokinase-plasminogen-activator-system on transmission of metastatic angiosarcomas from a apparently unaffected common female common multiorgan donor to four transplant recipients we investigated uPAR and suPAR levels before and after onset of metastatic angiosarcomas.
Methods
(18)F-fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT)
(18)F-FDG PET/CT was performed according to standard techniques as described by Thomassen et al. [5] using a 64-slice, hybrid PET/CT scanner (Discovery VCT or RX VCT scanner, General Electric Medical Systems, Waukesha, WI, USA). The patients had been positioned supine in the PET/CT scanner, with their arms raised, and had fasted for at least 6 h before (18)F-FDG injection. An intravenous injection of 4 MBq (18)F-FDG per kg body weight had been administered in the cubital vein, and 3-dimensional emission scans had been acquired at 2.5 min per field of view approximately 60 min after (18)F-FDG injection. PET images had been reconstructed using standard vendor-provided reconstruction algorithms. Noncontrast-enhanced CT images had been performed as low dose helical scans from the base of the skull to the mid thigh at a 3.3-mm slice thickness. The CT, PET and coregistered PET/CT images were reviewed on an ADW 4.4 Workstation (General Electric, Piscataway, NJ, USA).
Histology, immunohistochemistry and fluorescent in situ hybridization
Tissues were stained with hematoxylin and eosin stain using standard techniques. Immunohistochemistry was performed in formalin-fixed paraffin-embedded tissue. Four-micrometer thick sections were cut, deparaffinized, and subjected to heat induced epitope recovery step before incubation with antibodies. For this purpose, sections were immersed in sodium citrate buffer at pH 6.0 and heated in a high-pressure cooker. After cooking, the slides were rinsed in running water, washed with Tris-buffered saline, pH 7.4 and incubated with the primary antibodies including von-Willebrand factor antibodies or uPAR antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). Fluorescent in situ hybridization was performed using standard techniques using two types of direct fluorescent-labeled DNA probes against Y chromosome and X chromosome. Green and Orange signals were visualized by a Leica microscope. Probes labeled X chromosome with red color, Y chromosome with green.
Isolation of RNA and cDNA synthesis
Human mononuclear cells were obtained from heparinized blood and total RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA was used to synthesize first-strand cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). PCR was performed using reverse transcription mixture consisting of 500 ng total RNA template, anchored-oligo (dT)18 primer and transcriptor reverse transcriptase and incubated according to the following procedure: denaturation at 65°C for 10 min, followed by 50°C for 60 min, and heating at 85°C for 5 min. Furthermore, mononuclear cells from healthy subjects were treated with vehicle, with tumor extract, i.e. the supernatant obtained after tumor tissue homogenization and centrifugation at 4000 g for 5 min, with tumor extract plus 10 mmol/L N-acetyl-L-cysteine (NAC) or with 200 ng/mL phorbol-myristate-acetate (PMA), respectively, for 4 h and cDNA was obtained as described.
Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR)
uPAR transcripts were measured in mononuclear cells from patients and from tumor tissue using qRT-PCR as described by our group [6]. Furthermore, the uPAR transcripts were compared in mononuclear cells from a healthy subject which had been incubated with Opti-MEM I medium plus L-glutamine and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Control) or with tumor extracts in medium for 24 h at 37°C.
We used the following primers:
- uPAR,
- forward, TGTAAGACCAACGGGGATTGC; reverse, AGCCAGTCCGATAGCTCAGG;
- β-actin,
- forward, GGACTTCGAGCAAGAGATGG; reverse, AGCACTGTGTTGGCGTACAG;
Quantitative real-time PCR was performed using Fast Start DNA Master SYBR Green I (Roche Diagnostics) and the PCR amplification conditions were as follows: 40 cycles of denaturation at 95°C for 10 s, annealing at 63°C for 10 s and extension at 72°C for 15 s. After quantification, melting curves were generated with a heating rate of 0.1°C/s from 65°C to 95°C. Data were recorded on a LightCycler 2.0 Instrument with LightCycler Software Version 4.0 (Roche Diagnostics). Normalized ratios of gene expressions were calculated as relative expressions of uPAR gene normalized to the β-actin gene. PCR products were size fractionated and visualized in GelRed-stained 1.2% agarose gels. The expected product sizes were 166 bp for uPAR, and 234 bp for β-actin, respectively.
Plasma suPAR concentrations
Plasma suPAR concentrations were measured using the suPARnostic enzyme immunoassay kit according to the recommendations of the manufacturer (Virogates, Birkerod, Denmark). Plasma suPAR concentrations were determined from blank-corrected absorbance values after construction of a suPAR standard curve with recombinant suPAR standards. The detection limit of the assay was 0.1 ng/mL. Repeated measurements in patients after kidney transplantation showed a coefficient of variation of 4%.
Intracellular reactive oxygen species (ROS)
Intracellular ROS generation was assessed in mononuclear cells using 5-(6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2DCFDA), a cell-permeable indicator for ROS as described by our group [7]. Mononuclear cells from healthy subjects were treated with vehicle, with tumor extract, with tumor extract plus 10 mmol/L NAC or with 200 ng/mL PMA, respectively, for 20 min. Cells were then incubated with 2 μmol/L of CM-H2DCFDA (Invitrogen, Eugene, OR, USA) for 30 min at 37°C in the dark. For cells washing and loading, the following physiological saline solution was used: 134 mmol/L of NaCl, 6 mmol/L of KCl, 2 mmol/L of CaCl2, 1 mmol/L of MgCl2, 10 mmol/L of glucose and 10 mmol/L of HEPES (pH 7.4 with NaOH). ROS generation was determined by measuring the fluorescence intensity (excitation at 490 nm and emission at 520 nm) with an Enspire 2300 Multilabel Reader (Perkin Elmer, MA, USA).
Approval
The study was approved by the local ethics committee (Den Videnskabsetiske Komite for Region Syddanmark, Projekt-ID: 8-20100098) and patients gave informed consent.
Statistics
Data are reported as median and interquartile range. Data were compared using nonparametric tests, i.e. Mann–Whitney tests. A two-sided p less than 0.05 was chosen to indicate statistical significance.
Results
In August 2011, two patients with end-stage renal disease received deceased-donor kidney transplants from a common multiorgan donor. The organ donor was a 52-year-old woman with a history of mild essential hypertension. The patient was admitted with acute stroke, the patient was unconscious and CT demonstrated intracerebral hemorrhage. Despite neurosurgical intervention and intensive care therapy the hemorrhage progressed and the neurologic symptoms worsened. The patient was declared brain-dead within 5 days after onset of symptoms. Donor-eligibility screening and testing was performed by the local organ-procurement organization, including a review of patient's medical history, contacting of family members and premortem blood and urine samples. These investigations did not reveal any signs or symptoms of cancer precluding solid-organ donation. Because the donor did not have a past history of cancer and several cerebral CT scans did not give any hints, there was no reasonable concern that the nontraumatic cerebral hemorrhage might be the result of an unrecognized metastatic tumor. Serologic tests for human immunodeficiency virus, hepatitis B and hepatitis C were negative. Blood type was A rhesus factor positive. Human leukocyte antigens (HLA) were A1, A3, B8, B62(15), Cw3, DRB1*03, DRB1*04, DQB1*02 and DQB1*03:02. The patients’ lung, liver, heart and kidneys were removed for transplantations. Perioperative inspection of organs did not reveal any signs of cancer.
One kidney recipient was a 44-year-old male, the cause of end-stage renal disease was interstitial nephritis, body weight was 75 kg, body mass index was 25.4 kg/m2, systolic and diastolic blood pressure were 168 mmHg and 102 mmHg, respectively. The patient had been on hemodialysis treatment for 21 months. Blood type was A rhesus factor positive. HLA were A24(9), B27, B62(15), Cw2, Cw3, DRB1*04, DRB1*13, DQB1*03:02 and DQB1*06. The other kidney recipient was a 39-year-old male, the cause of end-stage renal disease was Alport syndrome, body weight was 80 kg, body mass index was 26.1 kg/m2, systolic and diastolic blood pressure were 130 mmHg and 75 mmHg, respectively. HLA were A1, A2, B39(16), B57(17), DRB1*03, DRB1*12, DQB1*02 and DQB1*03. In both recipients the blood type was A rhesus factor positive. Crossmatches using complement-dependent cytotoxicity tests were negative for both recipients. Kidney recipients received basiliximab 20 mg at day 0 and day 4 after transplantation, and daily immunosuppressive therapy including tacrolimus at a dose of 0.25 mg/kg of body weight, and mycophenolic acid at a dose of 540 mg twice daily. Both kidney recipients were routinely discharged from the hospital 10 days after transplantation in stable conditions, without any complaints. One month after transplantation kidney recipients showed an estimated glomerular filtration rate of 46 mL/min/1.73 m2 and 56 mL/min/1.73 square meter, respectively. Neither of the recipients experienced rejection episodes.
Four months after kidney transplantation, we were informed that the recipients of the lung and the liver had been diagnosed with angiosarcomas and died shortly thereafter. No tumor was reported from the recipient of the heart. Both kidney recipients underwent (18)F-FDG PET and CT scans. PET/CT scans demonstrated a tumor in both transplanted kidneys (Figure 1). Moreover lung metastases were suspected. Explantations of kidney allografts were performed 130 days and 134 days after transplantation, respectively. Histological examinations showed that sarcoma and likely angiosarcoma tumor cells were present in the kidney tissue showing strong proliferative signs including polymorphic nuclei, mitosis and necrosis (Figure 2A). Tumor cells showed positive immunohistochemisty for von-Willebrand factor (Figure 2B), indicating endothelial cell origin, and for vimentin, but they were negative for CD56, CKAE1/3, desmin, CEA, CD45, CD34, CD31, D2-40 and uPAR. Fluorescent in situ hybridization of angiosarcomas from both male transplant recipients showed X chromosomes (Figure 2C) but no Y chromosomes (Figure 2D) in the tumor cells, confirming that the tumor was of female donor's origin. Immunosuppressive therapies were discontinued, and hemodialysis treatments had to be reestablished. In both kidney recipients, metastases in the lungs were removed 143 days and 154 days after kidney transplantation, respectively. Histological examinations again confirmed angiosarcomas. Despite additional interventions using radiation therapy one kidney recipient died 181 days after kidney transplantation because of rapid generalized metastatic progresses. The other kidney recipient underwent additional chemotherapy.
Figure 1. (18)F-fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) scans of kidney recipient 1 (A, B) and kidney recipient 2 (C, D). Both scans demonstrated FDG avid tumors in transplanted kidneys from deceased-donor kidney transplants from a common multiorgan donor. The kidney transplants (Tx) were located in the left (L) and right (R) iliac fossa, respectively. Maximum intensity projection (MIP) of PET images alone (A, C) and fused, transaxial slices of PET/CT images from the lumbopelvic region (B, D) are shown. H indicates heart; B indicates bladder.

Figure 2. Histological examinations from nephrektomized kidney graft showing angiosarcoma tumor cells in the kidney graft tissue (A, hematoxylin and eosin stain, magnification 50X). Tumor shows strong proliferative signs including polymorphic nuclei, mitosis and necrosis. Angiosarcoma cells showed von-Willebrand factor expression indicating its endothelial origin (B, immunohistochemistry). Fluorescent in situ hybridization showed X chromosome (red) (C) but no Y chromosome (green) (D) in angiosarcoma tumor cells, confirming that this tumor in male recipients was of female donor's origin.

Immediately after transplantation both kidney recipients had been enrolled in our prospective study “Molecular Monitoring After Kidney Transplantation,” comprising clinical and laboratory investigations, which are scheduled within the first 4 weeks after kidney transplantation. In that study, several molecular markers in blood cells and plasma are determined after kidney transplantation. The study was approved by the local ethics committee and patients gave informed consent. Using these samples uPAR transcripts in mononuclear cells and suPAR concentrations in plasma were measured at 5 time points within the first 4 weeks (i.e. on days 1, 8, 15, 22 and 29) after kidney transplantation and at 2 time points after the diagnosis of angiosarcomas in the transplanted kidneys, e.g. 4 months after transplantation.
uPAR transcripts were measured using qRT-PCR. We observed increased uPAR transcripts in mononuclear cells after the diagnosis of angiosarcomas in kidney recipients compared to baseline values (Figure 3A). The median (interquartile range) uPAR transcripts were 0.005 arbitrary units (0.002 arbitrary units to 0.008 arbitrary units) within the first 4 weeks after kidney transplantation, and uPAR transcripts were about 13-fold increased to 0.068 arbitrary units (0.058 arbitrary units to 0.180 arbitrary units) after the diagnosis of angiosarcomas (p < 0.01 by Mann–Whitney test). Importantly, uPAR transcripts in these two kidney recipients within the first 4 weeks after transplantation were similar to uPAR transcripts obtained in 12 other patients who had also received deceased-donor kidney transplants, with a median (interquartile range) of 0.012 arbitrary units (0.004 arbitrary units to 0.036 arbitrary units). During follow up we again determined uPAR transcripts in one kidney recipient who underwent explantation of kidney allograft and additional chemotherapy. Three hundred thirty-one days after initial transplantation and 197 days after explantation of the kidney allograft uPAR transcripts were 0.019 arbitrary units.
Figure 3. Scatter diagram showing urokinase-plasminogen-activator-receptor (uPAR) transcripts in mononuclear cells (A) and soluble urokinase-plasminogen-activator-receptor (suPAR) concentrations in plasma (B) from two patients with end-stage renal disease who had received deceased-donor kidney transplants from a common multiorgan donor. Lines indicate median values. Values were compared using Mann–Whitney test. For each patient samples were obtained at 5 time points within the first 4 weeks after kidney transplantation and at 2 time points after the diagnosis of angiosarcomas in the transplanted kidneys, e.g. 4 months after transplantation. We observed increased uPAR and increased suPAR after the diagnosis of angiosarcomas in kidney recipients. Box and whisker plots showing that incubation of mononuclear cells from healthy subjects with tumor extracts in vitro increased uPAR transcripts (Figure 3C; n = 8; p < 0.01 between groups indicated) as well as reactive oxygen species (ROS; Figure 3D) in these cells. Presence of the antioxidant N-acetyl-L-cysteine (NAC; 10 mmol/L) ameliorated the effect of the tumor extract. Phorbol-myristate-acetate (PMA; 200 ng/mL) served as positive control for cell stimulation.

Plasma suPAR concentrations were measured using an enzyme immunoassay kit. As shown in Figure 3(B) plasma suPAR concentrations were significantly higher after diagnosis of angiosarcomas in kidney recipients compared to baseline values. The median (interquartile range) plasma suPAR concentrations were 3.5 ng/mL (3.0–3.7 ng/mL) within the first 4 weeks after transplantation, and plasma suPAR concentrations were about 1.7-fold increased to 5.9 ng/mL (4.6–14.3 ng/mL) after the diagnosis of angiosarcomas (p < 0.01 by Mann–Whitney test). Plasma suPAR concentrations in these two kidney recipients within the first 4 weeks after kidney transplantation were similar to plasma suPAR concentrations obtained in 12 other patients who had also received deceased-donor kidney transplants, with a median (interquartile range) of 4.4 ng/mL (3.3–5.2 ng/mL). Furthermore, we observed a significant correlation between uPAR transcripts in mononuclear cells and plasma suPAR levels in kidney recipients with donor-derived angiosarcomas (Spearman r = 0.68; p < 0.01). uPAR transcripts were also investigated in angiosarcoma tumor tissue. However, uPAR transcripts were below the detection limit in tumor tissue. In contrast, incubation of mononuclear cells from healthy subjects with tumor extracts in vitro increased uPAR transcripts in these cells to 1.53-fold (n = 8; p < 0.01 by Mann–Whitney test), indicating that angiosarcoma activated these cells (Figure 3C). Incubation of mononuclear cells from healthy subjects with tumor extracts in vitro also increased ROS in these cells to 1.45-fold (n = 8; p < 0.01 by Mann–Whitney test; Figure 3D). Both, the effects of the tumor extract on elevation of uPAR transcripts and ROS were ameliorated in the presence of the antioxidant, N-acetyl-L-cysteine. Moreover, when using PMA as positive control for cell stimulation, both increased uPAR transcripts and ROS could be observed.
Discussion
To the best of our knowledge, this is the first report of donor tumor transmission of malignant angiosarcomas from an apparently unaffected common multiorgan female donor to four transplant recipients. Fluorescent in situ hybridization of angiosarcoma cells confirmed that the tumor was of female donor's origin in male kidney recipients. Donor-derived tumor transmission is rare [8]. However, the literature related to donor-related malignancy transmission is limited to case reports, registry series and retrospective studies. Recently, generic risk categories were created and categories are populated with specific tumors based on available data [9]. Probably because of their rarity, angiosarcomas were not mentioned.
In our study, donor tumor transmission was associated with elevated uPAR transcripts in mononuclear cells and elevated plasma suPAR concentrations. Compared to baseline values obtained within the first 4 weeks after kidney transplantation, we observed elevated uPAR transcripts and elevated plasma suPAR levels after the diagnosis of angiosarcomas. One animal study showed that PmyT-VE-cadherin null endothelial cells, which form larger vascular tumors in nude mice resembling angiosarcomas showed increased uPAR levels [10]. However, no data are available on uPAR expression in humans with angiosarcomas. Using immunohistochemistry we did not detect uPAR expression in angiosarcoma tumor cells in this study. Hence it is reasonable that stimulated blood cells may be the source of increased suPAR levels in patients with angiosarcomas, because uPAR has been described in several peripheral blood cells including mononuclear cells [11]. We found that incubation of mononuclear cells from healthy subjects with tumor extracts increased intracellular ROS as well as uPAR transcripts. We also showed that the elevation of intracellular ROS by PMA in vitro consecutively increased uPAR transcripts. Other groups reported that ROS regulate uPAR expression in gastric cells [12, 13]. The mechanism by which tumor cells may alter mononuclear cell behavior is still to be determined. Recently, Eltzschig and Carmeliet proposed that factors in tumor cells induce a gene program that recruits and activates peripheral blood cells through release of chemokines and cytokines [14]. In patients with angiosarcomas, yet unknown substances derived from the tumor may activate intracellular ROS in mononuclear cells leading to increased uPAR expression. An increased expression of uPAR on mononuclear cells helps activation of pericellular plasmin which then breaks down extracellular matrix components, activates metalloproteinases and activates growth factors including transforming growth factor ß1 [3]. These events may promote tumor growth and tissue invasion in malignant diseases. Determination of tumors in patients after kidney transplantation may be difficult in daily clinical practice. Therefore, specific biomarkers of tumors after kidney transplantation are warranted. According to this study, the determination of suPAR concentrations in plasma may be helpful to detect donor tumor transmission of malignant angiosarcomas.
In summary, this report presents a rare case of donor tumor transmission of malignant angiosarcomas from an apparently unaffected common multiorgan female donor to four transplant recipients.
Acknowledgment
Supported in part by the European Union (Interreg 4A, grant number 62-1.2-10), and the Danish Council for Independent Research (Det Frie Forskningsråd, 10-084667)
Disclosure
The authors of this manuscript have no conflicts of interest to disclose as described by the American Journal of Transplantation.
References
- 1
- 2, . Angiosarcoma in a chronically immunosuppressed renal transplant recipient: Report of a case and review of the literature. Am J Dermatopathol 2002; 24: 330–335.
- 3, . uPAR: A versatile signaling orchestrator. Nat Rev Mol Cell Biol 2002; 12: 932–943.
- 4, , , , , . Preoperative plasma soluble urokinase plasminogen activator receptor as a prognostic marker in rectal cancer patients. An EORTC-Receptor and Biomarker Group collaboration. Int J Biol Markers 2005; 20: 93–102.
- 5, , , , . Duration of 18F-FDG avidity in lymph nodes after pandemic H1N1v and seasonal influenza vaccination. Eur J Nucl Med Mol Imaging 2011; 38: 894–898.
- 6, , , et al. The proteoglycan syndecan 4 regulates transient receptor potential canonical 6 channels via RhoA/Rho-associated protein kinase signaling. Arterioscler Thromb Vasc Biol 2012; 32: 378–385.
- 7, , , , , . High glucose-induced oxidative stress increases transient receptor potential channel expression in human monocytes. Diabetes 2010; 59: 844–849.
- 8, , , et al. Donor-derived disease transmission events in the United States: Data reviewed by the OPTN/UNOS Disease Transmission Advisory Committee. Am J Transplant 2009; 9: 1929–1935.
- 9, , , et al. Donor-transmitted malignancies in organ transplantation: Assessment of clinical risk. Am J Transplant 2011; 11: 1140–1147.
- 10, , , et al. Downregulation of vascular endothelial-cadherin expression is associated with an increase in vascular tumor growth and hemorrhagic complications. Thromb Haemost 2005; 93: 1041–1046.
- 11, , , et al. High-molecular-weight kininogen fragments stimulate the secretion of cytokines and chemokines through uPAR, Mac-1, and gC1qR in monocytes. Arterioscler Thromb Vasc Biol 2006; 26: 2260–2266.
- 12, , , et al. Helicobacter pylori stimulates urokinase plasminogen activator receptor expression and cell invasiveness through reactive oxygen species and NF-kappaB signaling in human gastric carcinoma cells. Int J Mol Med 2007; 19: 689–697.
- 13, , . Reactive oxygen species regulate urokinase plasminogen activator expression and cell invasion via mitogen-activated protein kinase pathways after treatment with hepatocyte growth factor in stomach cancer cells. J Exp Clin Cancer Res 2009; 28: 73.
- 14

1600-6143/asset/olbannerleft.gif?v=1&s=c46a3f174bfd9c6eb548cc809401524372c32e90)
1600-6143/asset/olbannerright.gif?v=1&s=9fc9790fa8ad5ef85aeaf408bf0d3d969d2fc012)
