SEARCH

SEARCH BY CITATION

Keywords:

  • Hemokinin-1;
  • mice;
  • neurokinin-1 receptor (NK-1R);
  • pheromone;
  • reward-seeking;
  • sexual behavior;
  • substance P;
  • tachykinin;
  • urine sniffing

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgements

Studies in mice with targeted deletions of tachykinin genes suggest that tachykinins and their receptors influence emotional behaviors such as aggression, depression and anxiety. Here, we investigated whether TAC1- and TAC4-encoded peptides (substance P and hemokinin-1, respectively) and the neurokinin-1 receptor (NK-1R) are involved in the modulation of sexual behaviors. Male mice deficient for the NK-1R (TACR1 −/−) exhibited decreased exploration of female urine in contrast to C57BL/6 control mice and mice deficient for NK-1R ligands such as TAC1 −/−, TAC4 −/− and the newly generated TAC1 −/− /TAC4 −/− mice. In comparison to C57BL/6 mice, mounting frequency and duration were decreased in male TACR1 −/− mice, while mounting latency was increased. Decreased preference for sexual pheromones was also seen in female TACR1 −/− mice. Furthermore, administration of the NK-1R-antagonist L-703,606 decreased investigation of female urine by male C57BL/6 mice, suggesting an involvement of NK-1R in urine sniffing behavior. Our results provide evidence for the NK-1R in facilitating sexual approach behavior, as male TACR1 −/− mice exhibited blunted approach behavior toward females following the initial interaction compared with C57BL/6 mice. NK-1R signaling may therefore play an important role in pheromone-induced sexual behavior.

Tachykinins are a family of neuropeptides that share the C-terminal motif FXGLM-NH2. In mouse, TAC1 encodes substance P (SP) and neurokinin A (NKA) through alternative splicing. TAC2 produces neurokinin B (NKB), and TAC4 encodes hemokinin-1 (HK-1). Tachykinins mediate their actions through three G-protein-coupled receptors, neurokinin-1 receptor (NK-1R, TACR1), NK-2R (TACR2) and NK-3R (TACR3). SP and HK-1 are the preferred, endogenous ligands for NK-1R. NKA preferentially binds to NK-2R and NKB to NK-3R. However, each ligand can interact with all receptors with varying affinity (Patacchini & Maggi 2001).

Analysis of TAC1−/− (Cao et al. 1998; Zimmer et al. 1998) and TACR1−/− mice (Bozic et al. 1996; De Felipe et al. 1998; Santarelli et al. 2001) suggested that SP and NK-1R play a role in the modulation of emotional behaviors. TAC1−/− and TACR1−/− mice displayed diminished anxiety- and depression-related behaviors, suggesting a blunted response to stressful stimuli (Bilkei-Gorzo et al. 2002; Rupniak et al. 2000; Santarelli et al. 2001). Decreased anxiety was also shown by the decreased number of vocalizations emitted by TACR1−/− pups when separated from their mothers (Rupniak et al. 2000; Santarelli et al. 2001). TACR1−/− mice further showed reduced aggression measured by a diminished response to territorial challenge (De Felipe et al. 1998). TACR1−/− mice exhibited hyperactivity (Yan et al. 2009) and a disrupted response to rewarding stimuli such as morphine and alcohol (Ripley et al. 2002; Thorsell et al. 2010). Furthermore, TAC1−/− and TACR1−/− mice exhibited altered pain responses (Cao et al. 1998; De Felipe et al. 1998; Woolf et al. 1998; Zimmer et al. 1998). These studies suggest that SP and NK-1R are important mediators involved in the response to stressful situations such as anxiety, territorial challenge and pain.

We have recently generated TAC4−/− mice and reported that the lack of HK-1 led to an increase of pro-B cells in the bone marrow (Berger et al. 2010). In contrast to TAC1, TAC4 is not highly expressed in the nervous system, but instead is found widely expressed in a variety of immune cells (Berger et al. 2007; Nelson & Bost 2004; Nelson et al. 2004; Zhang et al. 2000; Zhang & Paige 2003). However, we have shown high levels of TAC4 expression in the olfactory epithelium (Tran et al. 2011).

SP and NK-1Rs are expressed in various brain regions involved in social and sexual behaviors, including the olfactory bulb, striatum, amygdala and hypothalamic nuclei (Allen Brain Atlas, www.brain-map.org). Owing to the involvement of tachykinins in the regulation of emotional behaviors such as the reduced aggression of TACR1−/− mice in male–male interaction studies (De Felipe et al. 1998), we decided to investigate male–female interaction and social/sexual behavior in tachykinin null-mutant mice, including TACR1−/−, TAC1−/−, TAC4−/− and the newly generated TAC1−/−/TAC4−/−‘double-knockout mice’, which are deficient for TAC1- and TAC4-encoded peptides. Mice deficient for TACR1, but not TAC1 and/or TAC4, exhibited decreased interest in sexual pheromones. Furthermore, male TACR1−/− mice displayed diminished approach, courtship and sexual behaviors, suggesting a role for NK-1R signaling in these complex behaviors.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgements

Animals

The generation of TAC4−/−mice (HK-1 knockout) has recently been described (Berger et al. 2010). To obtain mice with a targeted deletion of the TAC4 gene on a C57BL/6 background, TAC4+/− mice were mated with C57BL/6 mice for eight generations (N8). Heterozygous N8 animals were then intercrossed to obtain homozygous TAC4−/− mice and homozygous TAC4−/− breeding pairs were established. TAC1−/− breeding pairs (SP/NKA knockout mice, N10) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA; Cao et al. 1998). To create mice that are deficient for TAC1 and TAC4, we crossed TAC1−/− and TAC4−/− mice. Heterozygous mice were then intercrossed to generate animals in which both copies of the TAC1 as well as the TAC4 genes were deleted (TAC1−/−/TAC4−/− double-knockout mice, N9). Owing to the high demand of mutant mice and the low number of double-knockout animals in litters of heterozygous breeding pairs (1/16), homozygous TAC1−/−/TAC4−/− breeding pairs were established. TACR1−/− breeding pairs (NK-1R knockout mice, N9) were obtained from Dr N. Gerard, Boston, MA, USA (Bozic et al. 1996), rederived in our facility by backcrossing to C57BL/6 (NK-1R knockout mice, N10), and homozygous TACR1−/− breeding pairs were established.

As all mutant strains were backcrossed to C57BL/6 (N8-N10), C57BL/6 mice were used as control mice for all mutant strains in all experiments. C57BL/6 breeding pairs were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). C57BL/6 mice were bred in the same facility as the mutant stains, to ensure that all mice had the same ‘life histories' before testing. Sexually mature, gonadally intact C57BL/6 mice were used as stimulus mice and urine donors. Group-housed, nonestrous females were used as stimulus mice in social/sexual interaction studies.

All mice were housed in groups (maximum number of five animals per cage). Owing to the large number of animals needed, some C57BL/6 and TACR1−/− mice that were used in olfactory tests were then used in ultrasonic vocalization (USV) recordings (with a break of 1–2 weeks between the tests). Mice used in any of the other tests were not reused. Drug-treated animals were killed after the experiment.

Mice were housed under pathogen-free conditions at a constant temperature (22 ± 2°C) on a 12-h light–dark cycle (light cycle: 6 am–6 pm). All experiments were performed during the light phase. Food and water were available ad libitum. Animal experiments were approved by the University Health Network Animal Care Committee and performed in compliance with current institutional guidelines. The scientists recording the data were unaware of drug treatment or genetic background of the test animal.

Genotyping and RT-PCR analysis

The REDExtract-N-Amp™ Tissue polymerase chain reaction (PCR) kit (Sigma-Aldrich Inc., St. Louis, MO, USA) was used for PCR genotyping of all mutant mouse strains used (see Table 1 for primers).

Table 1.  Primers for genotyping and RT-PCR analysis
PrimerDesignation5′–3′ Sequence
TAC4 forTyping PCR TAC4 WT/mutCCTGGGGTAAACTAGAATGGT
NEO2 inv-revTyping PCR TAC4 mutCATCGCCTTCTATCGCCTTCT
TAC4 revTyping PCR TAC4 WTGTACCAGAGCTAAGGGCTGTTC
ES4Typing PCR TAC1 WT/mutACCAGAATTTAAAGCTCTTTTGCC
ES5Typing PCR TAC1 WT/mutGCTCATCAGTATGTGACATAGAAA
bosts5Typing PCR TACR1 WTCCAACACCTCCACCAACACTTCTG
nk1 flippedTyping PCR TACR1 WT/mutGCCACAGCTGTCATGGAGTAGAT
SPR1Typing PCR TACR1 mutTCCAGACTGCCTTGGGAAAA
m β-actin for INTRT-PCR β-actinGCCATCCTGCGTCTGGACCTGGCTGGCCGG
m β-actin revRT-PCR β-actinATCTGCTGGAAGGTGGACAG
mPPT-C forRT-PCR TAC4CGGGCCATCAGTGTGCACTA
mPPT-C revRT-PCR TAC4CGCTTCCCCATCAGACCATA
PPT-A 5′2RT-PCR TAC1CTTTGAGCATCTTCTGCAGAGAATCGCCCG
PPT-A revRT-PCR TAC1GGAAACATGCTGCTAGGATACAAA

RNA was isolated from tissues using Trizol reagent according to the manufacturer's instructions (Gibco BRL, NY, USA). cDNA synthesis and RT-PCR analysis were performed as previously described (Berger et al. 2007; see Table 1 for primers).

Female urine sniffing test

The female urine sniffing test (FUST) was performed as previously described (Bilkei-Gorzo et al. 2002; Malkesman et al. 2010). Briefly, urine samples from a large number of mature female mice (C57BL/6, 8 weeks or older) from various cages were collected and pooled to obtain a large sample volume, thereby decreasing variability in sniffing time due to different donors (Yang & Crawley 2009). Sexually naÏve male C57BL/6 and mutant animals (10–16 weeks old) were placed individually into a brightly lit open field (fresh cage). After a short habituation period (5–10 min), the animal was presented with a social odor (female urine, 10 µl) and a nonsocial odor (water, 10 µl) on cotton pads in opposite corners of the cage. The time spent sniffing each cotton pad was recorded with a stopwatch within a 2-min time period. The data were analyzed by repeated-measures two-way analysis of variance (anova), followed by Bonferroni's post tests.

Olfactory habituation/dishabituation test

The olfactory habituation/dishabituation test was used to assess whether an animal can distinguish between odors. The test consisted of sequential presentations of six different odors in triplicate (3 × 6 = 18 consecutive trials). We have used a commonly used sequence of water, two nonsocial odors [10 µl almond extract (AE), 1:100; and 10 µl banana extract (BE), 1:100], two social male odors (10 µl urine from two unrelated male C57BL/6 mice) and one social female odor (10 µl urine, harvested from various female C57BL/6 mice and pooled). The test was performed as previously described (Yang & Crawley 2009). Briefly, sexually naÏve male C57BL/6 and mutant animals (10–16 weeks old) were placed individually into a brightly lit open field (fresh cage) and allowed to habituate for 30 min. Each odor was presented to the animal on a fresh cotton pad in three consecutive trials of 2 min each. The time spent sniffing the cotton pad was recorded with a stopwatch within a 2-min time period. The time line depicted in Fig. 2 shows the series of triplicate presentations of the six different odors. The time needed to exchange the cotton pad (15 to 30 second break between trials) is not shown in the figure.

Habituation is defined as a decrease in sniffing time due to the repeated presentation of the same odor. Dishabituation is defined as a spike in sniffing time when a novel odor is introduced. The data were plotted and analyzed for each strain individually using repeated-measures one-way anova followed by Bonferroni's post tests.

Ultrasonic vocalizations

C57BL/6 stimulus females (10–16 weeks old, sexually naÏve, nonestrous) were paired with C57BL/6 or TACR1−/− males (>12 weeks old, sexually naÏve) and USVs were recorded. Therefore, the female was removed from the home cage and placed in a clean cage containing fresh bedding (the mating cage), which was then placed into the mating chamber in the testing room, adjacent to the housing room. After the female was left to habituate for 5 min, the male was introduced and pairing was allowed for 5 min. Audio recordings of USVs were obtained for the entire duration of the pairing. At the end of the trial, the mice were removed and returned to their home cages.

USVs were recorded with a D1000X ultrasound recorder (Pettersson Elektronik AB, Uppsala, Sweden) at a sampling frequency of 250 kHz. The microphone was suspended 13 cm above the floor of the mating chamber (40 × 25 × 30 cm). Spectrographs (20–125 kHz) were generated by discrete Fourier transformation (256 bins) and analyzed with Avisoft SASLab Pro Software v4.39 (Avisoft Bioacoustics, Berlin, Germany). USV calls were counted within a 4-min time period. Owing to the high degree of variability of USV calls even after data transformation, the two data sets were analyzed using a nonparametric test (Mann–Whitney test).

Social interaction test

Social and sexual interaction of sexually naÏve mice was tested in a brightly lit open field. A mature male mouse (TACR1−/− or C57BL/6, 10–16 weeks of age) was put into the testing cage and allowed to habituate for 30–60 min before a female mouse (C57BL/6, 8–12 weeks old, nonestrous) was introduced. Their social interaction was recorded for 15 min and behaviors such as sniffing and mounting were counted and their duration was recorded. To determine mounting latency, the time of social interaction was increased to 45 min. All male test subjects displayed mounting behavior within the 45-min time frame. Owing to the high degree of variability, the responses of the two strains were compared using nonparametric Mann–Whitney tests.

Preference of female mice for male soiled bedding

Female C57BL/6 and TACR1−/− mice (10–16 weeks old) were tested for their preference of male vs. female soiled bedding (obtained from cages housing mature C57BL/6 mice). Briefly, a female mouse was habituated in a fresh cage for 60 min before two dishes containing female soiled bedding were added to the cage (control test, test 1). Sniffing of the two dishes was recorded for 5 min. Then, the dishes were removed and replaced by two new dishes: one containing female soiled bedding of the same source as in test 1 and the other containing male soiled bedding (preference test, test 2). Time spent sniffing the dishes was recorded within a 5-min time period. All mice tested in this study received the same soiled bedding to decrease variability due to soiled bedding from different sources.

We further adjusted the FUST, so that it resembled the paradigm described above. Each male mouse was first confronted with a water sample (10 µl of water on a cotton pad) in two locations of the cage and sniffing was recorded for 2 min (control test, test 1). Then, the samples were removed and replaced with a new water sample on one side of the cage and a female urine sample on the opposite side (preference test, test 2) and sniffing was recorded for 2 min. As in the FUST, we used pooled female urine to decrease variability in sniffing time due to different urine donors (obtained from C57BL/6, 8–12 weeks).

The data were analyzed by repeated-measures two-way anova, followed by Bonferroni's post tests.

Effects of L-703,606 on urine sniffing

The NK-1R-antagonist L-703,606 was chosen due to its central activity (Thorsell et al. 2010). L-703,606 was dissolved in 45% 2-hydroxypropyl-β-cyclodextrin to a stock concentration of 10 mg/ml (Sigma-Aldrich Inc., St. Louis, MO, USA). L-703,606 was administered intraperitoneally into mature male mice (12–16 weeks of age) at a concentration of 1, 10 and 30 mg/kg. The high dose of 30 mg/kg was added after a higher dose of the antagonist was requested in the review process. To compare the second experiment (30 mg/kg L-703,606, n = 12) to the original one [n = 10 for phosphate-buffered saline (PBS), 1 and 10 mg/kg L-703,606], corresponding treatments of 2–4 mice for PBS, 1 and 10 mg/kg L-703,606 were included in the second experiment (final n = 12–14).

For both experiments, 60–120 min after injection, L-703,606 pretreated and C57BL/6 control mice injected with vehicle were tested in the FUST as described above. There was no difference in the baseline between the two experiments. The data were analyzed using two-way anova, followed by Bonferroni's post tests.

Effects of d -amphetamine on urine sniffing

d-Amphetamine was dissolved in saline to a stock concentration of 1 mg/ml (Sigma-Aldrich Inc., St. Louis, MO, USA) and administered intraperitoneally into mature male mice (12–16 weeks of age) at a concentration of 0.1 and 0.5 mg/kg. Twenty minutes after injection, treated mice and control mice injected with saline were tested in the FUST as described above. The data were analyzed by two-way anova, followed by Bonferroni's post tests.

Statistical analysis

Graphs were created using Prism Graph Pad 3.0 software (San Diego, CA, USA). Owing to the high degree of variability of USV calls and mounting events (Figs 3 and 4), these data sets were analyzed using nonparametric tests (Mann–Whitney). Urine sniffing data agreed with a bell-shaped Gaussian distribution and therefore parametric tests were used. One-way or two-way anova (repeated measures, where applicable) was followed by Bonferroni's multiple comparison post tests, where all or selected groups were compared with each other. F, t and df are indicated where applicable. Statistical significance level was set at P < 0.05 (*P < 0.05, **P < 0.01, ***P < 0.001).

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgements

TAC1 −/− /TAC4 −/−‘double-knockout mice’ are healthy and fertile

Owing to the similar affinity of SP and HK-1 to NK receptors, we generated mice that lack both peptides. TAC1−/−/ TAC4−/− mutant mice were obtained with the expected frequency of about 1/16. They had no gross physical abnormalities, were similar in size and weight to their littermates and appeared healthy. All mice were fertile and cared for their offspring.

TAC1−/−/TAC4−/− mutants were confirmed by PCR genotyping (Fig. 1a). RT-PCR confirmed the lack of TAC1 and TAC4 mRNA in ‘double-knockout mice’. Both TAC1 and TAC4 mRNA were expressed at high levels in the olfactory epithelium of wild-type mice (Fig. 1b). However, neither TAC1 nor TAC4 mRNA were detected in the olfactory epithelium of TAC1−/−/TAC4−/− mice (Fig. 1b).

image

Figure 1. Generation of TAC1 −/− /TAC4 −/− mice. (a) Two wild-type (lanes 1 and 2), one heterozygote (lane 3) and two TAC1−/−/TAC4−/− mice (lanes 4 and 5) were typed by PCR analysis for the presence of the wild-type and/or mutant band of TAC1 and TAC4. (b) RT-PCR analysis for TAC1 and TAC4 mRNA expression in the olfactory epithelium of two wild-type (lanes 1 and 2) and two TAC1−/−/TAC4−/− mice (lanes 3 and 4). β-actin was used to confirm the presence of equal amounts of cDNA.

Download figure to PowerPoint

Male TACR1−/− mice show a decrease in olfactory investigation of female urine

To test whether tachykinin mutant mice respond to social odors of the opposite sex in a similar manner as C57BL/6 mice, we performed the FUST, which was reported to determine pheromone preference in rodents (Malkesman et al. 2010). Repeated-measures two-way anova indicated that odor accounted for 46.7% of the total variance (F1,200 = 510.4, P < 0.0001), strain for 2.89% (F4,200 = 5.01, P = 0.0007) and interaction for 4.94% (F4,200 = 13.5, P < 0.0001). Bonferroni's post tests showed that male mice of all five genotypes investigated the urine-stained cotton pad for a significantly longer time period than the water pad (C57BL/6: t = 11.65, P < 0.001; TACR1−/−: t = 3.97, P < 0.001; TAC4−/−: t = 9.78, P < 0.001; TAC1−/−: t = 8.60, P < 0.001; TAC1−/−/TAC4−/−: t = 10.19, P < 0.001). Furthermore, TACR1−/− mice showed significantly decreased sniffing of the urine stained cotton pad compared with C57BL/6 mice (t = 7.45, P < 0.001) as well as to all other mutant strains (TACR1−/− vs. TAC4−/−: t = 5.37, P < 0.001; TACR1−/− vs. TAC1−/−: t = 4.45, P < 0.001; TACR1−/− vs. TAC1−/−/TAC4−/−: t = 5.88, P < 0.001). There was no significant difference between the genotypes in sniffing water (P > 0.05 for all strains; Fig. 2a).

image

Figure 2. Assessment of sniffing behavior and olfaction. (a) FUST: time spent investigating female urine and water within a 2-min time period. TACR1−/− mice show significantly decreased urine sniffing compared to all other strains. Each symbol represents one animal and the number in brackets indicates the number of mice tested. (b and c) Habituation/dishabituation test: mature male mice [n = 10/strain, WT in (b) and TACR1−/− in (c)] were presented with a series of different odors on cotton-pads. The test included three sequential presentations of each of the nonsocial odors: water, AE (1:100 dilution) and BE (1:100 dilution) followed by three sequential presentations of different social odors (urine obtained from two individual male mice from different cages) as well as female urine. Sniffing was recorded for 2 min/odor and graphed over time. Numbers 1–18 represent the 18 consecutive odor presentations (six odors in triplicate).

Download figure to PowerPoint

TAC1−/−, TAC4−/−, TAC1−/− /TAC4−/− and TACR1−/− mice can differentiate odors

To assess whether the decreased olfactory investigation of female urine by male TACR1−/− mice is due to an olfactory deficit, we performed the olfactory habituation/dishabituation test, designed to test whether an animal can differentiate between odors (Yang & Crawley 2009). Repeated-measures one-way anova indicated significant differences in the habituation/dishabituation of C57BL/6 mice (Fig. 2b; F17,153 = 33.03, R2 = 0.7859, P < 0.0001) as well as TACR1−/− mice (Fig. 2c; F17,153 = 8.66, R2 = 0.4902, P < 0.0001). Bonferroni's post tests showed that both strains showed significant habituation, defined by a decrease in sniffing after repeated presentation of the same odor. Habituation was statistically measured by comparing the extent of sniffing of the first exposure to that of the second and/or third exposure of the same odor. Each strain displayed significant habituation (C57BL/6: water: t = 5.89, P < 0.001; AE: t = 6.17, P < 0.001; BE: t = 7.2, P < 0.001; male urine 1: t = 6.02, P < 0.001; male urine 2: t = 4.01, P < 0.01; female urine: 7.33, P < 0.001; TACR1−/−: water: t = 6.79, P < 0.001; AE: t = 4.48, P < 0.001; BE: t = 4.4, P < 0.001; male urine 1: t = 4.84, P < 0.001; male urine 2: t = 4.11, P < 0.01; female urine: 3.65, P < 0.01). Dishabituation, defined as an increase in sniffing after a new odor was introduced, was statistically measured by comparing the sniffing response of the previous odor to the first exposure of the novel odor. Each mouse strain showed significant dishabituation (C57BL/6: AE: t = 10.06, P < 0.001; BE: t = 9.6, P < 0.001; male urine 1: t = 5.8, P < 0.001; male urine 2: t = 4.57, P < 0.001; female urine: 13.23, P < 0.001; TACR1−/−: AE: t = 5.29, P < 0.001; BE: t = 7.94, P < 0.001; male urine 1: t = 4.74, P < 0.001; male urine 2: t = 4.39, P < 0.001; female urine: 5.18, P < 0.001). On the basis of the repeated successful habituation/dishabituation, we conclude that all strains used in this study were able to differentiate between odors (Fig. 2b and c).

Similar to the FUST, the habituation/dishabituation test shows a decrease in the extent of olfactory investigation of female urine in male TACR1−/− mice (Fig. 2b and c), suggesting a specific disinterest in female urine. Despite this difference, the dishabituation/habituation in response to female urine was significant and similar to that of previous odors (see t and P values above), suggesting that TACR1−/− mice recognize female urine as a new odor.

Male TACR1−/− mice emit fewer USVs during courtship

As male TACR1−/− mice showed decreased exploration of female urine, we next tested their courtship behavior. During courtship, male mice emit USVs induced by exposure to female pheromones. Compared to C57BL/6 control mice, male TACR1−/− mice showed a tendency toward fewer USV calls, but nonparametric Mann–Whitney tests showed that the difference was not statistically significant (C57BL/6: median: 332.0; interquartile range: 667.5; TACR1−/−: median: 12.0; interquartile range: 362.5; U = 154, n1 = 21, n2 = 20, P = 0.1472; Fig. 3).

image

Figure 3. USVs of male wild-type and TACR1 −/− mice. A sexually naÏve female was introduced to a male and USV calls were recorded for 4 min (C57BL/6: n = 21, TACR1−/−: n = 20). The graph represents the sum of all calls emitted during the time recorded.

Download figure to PowerPoint

Male TACR1−/− mice exhibit sexual deficits

The decreased interest in female urine led us to investigate the social and sexual interactions of these mice with females. Nonparametric Mann–Whitney tests showed that although TACR1−/− males showed no decrease in body sniffing of females (C57BL/6: median: 183.0; interquartile range: 47.5; TACR1−/−: median: 191.0; interquartile range: 51.0; U = 47.5, n1 = 9, n2 = 12, P = 0.9093; Fig. 4a), the overall mounting frequency (C57BL/6: median: 18.0; interquartile range: 17.5; TACR1−/−: median: 1.5; interquartile range: 7.0; U = 3.5, n1 = 9, n2 = 12, P = 0.0004; Fig. 4b) and mounting time (C57BL/6: median: 24.0; interquartile range: 24.5; TACR1−/−: median: 2.0; interquartile range: 8.5.0; U = 6.5, n1 = 9, n2 = 12, P = 0.0008; Fig. 4c) were significantly decreased in TACR1−/− males compared with C57BL/6 controls. Furthermore, mounting latency was significantly increased in TACR1−/− males (C57BL/6: median: 120.0; interquartile range: 145.0; TACR1−/−: median: 630.0; interquartile range: 1115.0; U = 3.0, n1 = 10, n2 = 8, P = 0.0003; Fig. 4d). These results suggest a sexual interaction deficit rather than a social interaction deficit in TACR1−/− males.

image

Figure 4. Comparison of male wild-type and TACR1 −/− mice in social interaction tests. The following social interactions were monitored, counted and recorded within a 15-min time frame: (a) body sniffing time, (b) mounting frequency and (c) mounting duration. (d) Latency to mount was recorded within a 45-min time frame. P-values and levels of significance are indicated where applicable. The number in brackets indicates the number of mice used per strain.

Download figure to PowerPoint

Female TACR1−/− mice show decreased preference for male soiled bedding

To investigate whether the diminished interest in the opposite sex of TACR1−/− mice is specific to males or extends to females, we compared the behavior of female C57BL/6 and TACR1−/− mice by establishing the preference of females for male vs. female soiled bedding. Generally, females prefer male over female soiled bedding, presumably due to the presence of male sexual pheromones (Agustin-Pavon et al. 2008). Repeated-measures two-way anova indicated that odor accounts for 62.68% of the total variance (F3,72 = 100.5, P < 0.0001), strain for 3.95% (F1,72 = 16.24, P = 0.0005) and interaction for 12.56% (F3,72 = 20.15, P≤ 0.0001). Bonferroni's post tests confirmed that both strains preferred male soiled bedding over female soiled bedding in test 2, whereas there were no differences in test 1 (C57BL/6, test 1: P > 0.05; test 2: t = 12.49, P < 0.001; TACR1−/−, test 1: P > 0.05; test 2: t = 4.94, P < 0.001). However, although female TACR1−/− mice preferred male over female soiled bedding, the time spent investigating male soiled bedding was significantly lower than that of female C57BL/6 mice (test 2: t = 7.87, P < 0.001; Fig. 5a).

image

Figure 5. Preference for sexual pheromones. (a) Female mice were tested for their preference of male over female soiled bedding. In test 1 (control test), both dishes contained female soiled bedding. In test 2 (preference test), one dish contained female soiled bedding and the second dish contained male soiled bedding. P-values and levels of significance are indicated. The numbers in brackets indicate the number of mice tested. (b) Male mice were tested for their preference of female urine over water. In test 1 (control test), both cotton pads contained water. In test 2 (preference test), one pad contained water and the second pad contained female urine. P-values and levels of significance are indicated where applicable. The numbers in brackets indicate the number of mice tested.

Download figure to PowerPoint

To compare female and male behavior side by side, we adjusted the FUST so that it resembled the preference test used above. Repeated-measures two-way anova indicated that odor accounts for 59.29% of the total variance (F3,72 = 208.0, P < 0.0001), strain for 7.48% (F1,72 = 73.18, P < 0.0001) and interaction for 23.95% (F3,72 = 84.04, P < 0.0001). Bonferroni's post tests confirmed that both strains showed a preference for female urine in test 2, whereas there were no differences in test 1 (C57BL/6, test 1: P > 0.05; test 2: t = 17.15, P < 0.001; TACR1−/−, test 1: P > 0.05; test 2: t = 3.95, P < 0.01). However, despite the preference of male TACR1−/− mice for female urine, their interest in female urine was significantly decreased compared with C57BL/6 controls (test 2: t = 7.87, P < 0.001; Fig. 5b). Therefore, TACR1−/− males and females exhibited a significantly decreased preference for odors omitted by the opposite sex (Fig. 5a and b).

d-Amphetamine decreases female urine sniffing

We next investigated whether d-amphetamine treatment affects the olfactory investigation of female urine. Two-way anova followed by Bonferroni's post tests showed that intraperitoneal administration of 0.1 or 0.5 mg/kg d-amphetamine dose-dependently and significantly decreased the extent of female urine sniffing in C57BL/6, but not TACR1−/− mice (Fig. 6a; treatment accounted for 14.77% of the effect, F2,66 = 7.94, P = 0.0008, strain for 12.8%, F1,66 = 13.76, P = 0.0004, and interaction for 7.53%, F2,66 = 4.05, P = 0.022; Bonferronis's post tests for C57BL/6, PBS vs. 0.1 mg/kg d-amphetamine: t = 2.648, P < 0.05; C57BL/6, PBS vs. 0.5 mg/kg d-amphetamine: t = 4.284, P < 0.001; Bonferronis's post tests for TACR1−/− mice P > 0.05).

image

Figure 6. Treatment of male wild-type and TACR1 −/− mice with d -amphetamine and the NK-1R-antagonist L-703,606. (a) The extent of olfactory investigation of female urine by male mice injected with PBS or d-amphetamine was assessed. P-values and levels of significance are indicated where applicable. The numbers in brackets indicate the number of mice tested. (b) The extent of olfactory investigation of female urine of untreated male mice injected with vehicle or L-703,606 was assessed. P-values and levels of significance are indicated where applicable. The numbers in brackets indicate the number of mice tested.

Download figure to PowerPoint

NK-1R-antagonist decreases the olfactory investigation of female urine

As male TACR1−/− mice showed decreased olfactory investigation of female urine compared with male C57BL/6 mice, we tested whether treatment of male C57BL/6 mice with the NK-1R-antagonist L-703,606 mimics the TACR1−/− phenotype observed in the FUST. Two-way anova followed by Bonferroni's post tests showed that male C57BL/6 mice injected with L-703,606 showed a significant decrease in female urine sniffing, while the antagonist did not alter the extent of female urine sniffing by male TACR1−/− mice (treatment accounted for 4.3% of the behavior, F3,90 = 3.77, P = 0.0134, strain for 55.48%, F1,90 = 145.7, P < 0.0001, and interaction for 5.89%, F3,90 = 5.16, P = 0.0025; Bonferroni's post tests: C57BL/6, vehicle vs. 1 mg/kg L703,606: P > 0.05; C57BL/6, vehicle vs. 10 mg/kg L703,606: t = 3.752, P < 0.01; C57BL/6, vehicle vs. 30 mg/kg L703,606: t = 6.414, P < 0.001); the treatment did not significantly change urine sniffing in TACR1−/− mice (P > 0.05; Fig. 6b). Administration of the antagonist did not reduce urine sniffing behavior to the level of that in untreated male TACR1−/− mice, as olfactory investigation of female urine was significantly lower in TACR1−/− mice compared with C57BL/6 mice treated with 30 mg/kg L703,606 (t = 5.60, P < 0.001; Fig. 6b).

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgements

In this study, we report that the NK-1R plays a role in the modulation of sexual behavior. Male NK-1R-deficient mice (TACR1−/−), but not mice deficient for tachykinin peptides, exhibited a significant decrease in olfactory investigation of female urine compared with C57BL/6 control mice. As TACR1−/− mice differentiated between odors, and because olfaction plays an essential role in rodent behavior, the decreased sniffing of female urine may indicate social and/or sexual behavioral deficits. For most animals, successful recognition of chemosensory odor cues is critical for social communication as well as for social and sexual behavior. Urine and sexual attractants such as pheromones are important inducers of these behaviors (Wang et al. 2008).

During courtship, male mice emit complex song-like USVs, which are interpreted as a means of social communication. They are frequently observed during sexual behavior and are thought to attract the female to the male. USVs can be induced by urine and pheromones (Wang et al. 2008). As the decreased exploration of female urine exhibited by male TACR1−/− mice may be interpreted as decreased interest in female urine and/or pheromones, we investigated whether the quantity of USVs during male–female interaction was altered. Although not statistically significant, TACR1−/− males emitted fewer USV calls than C57BL/6 males. Consistent with the decreased investigation of female urine, TACR1−/− males further displayed less vigorous mating behavior, as determined by decreased mounting frequency and duration and increased mounting latency compared with C57BL/6 males. The blunted approach behavior of TACR1−/− males toward females following the initial interaction suggests a role for NK-1R in facilitating sexual approach behavior and in pheromone-induced sexual behavior.

The idea that dopamine is involved in the processing of information derived from rewarding stimuli is commonly accepted (Martinez-Hernandez et al. 2012). However, the precise role of dopamine in the reward system is widely debated (Berridge & Robinson 1998, 2003; Nicola 2010). As urine pheromones can represent a rewarding cue for mice, the decreased sniffing of female urine could be interpreted as a deficiency to engage in reward-seeking behavior. In fact, the FUST has recently been described as a test to assess changes in reward-seeking behavior (Malkesman et al. 2010). TACR1−/− mice are known to display deficiencies in reward-seeking behavior. For example, TACR1−/− mice failed to acquire a response to self-administered morphine, suggesting a role for NK-1R in mediating the rewarding properties of opiates (Ripley et al. 2002). TACR1−/− mice were further reported to consume lower amounts of alcohol compared with controls (George et al. 2008; Thorsell et al. 2010). The failure to develop a preference for an environment paired with morphine or alcohol suggests that the rewarding effects of these substances are impaired in TACR1−/− mice. The results presented here could therefore be interpreted as the failure to develop a preference for an environment paired with sexual pheromones. As sexual behaviors are driven by pheromone cues, this impairment could consequently be responsible for the blunted sexual behavior of male NK-1R-deficient mice.

Impairment to engage in reward-seeking behavior points to abnormalities of brain networks that mediate reward signals. Neurotransmitters such as dopamine and the endogenous opioids endorphin, enkephalin and dynorphin mediate reward and reward-induced behaviors through opioid receptors. Pheromone-induced reward is mediated by opioidergic neurotransmitters as opioidergic inhibitors suppressed the processing of pheromone signals leading to inhibition of sexual behavior (Agustin-Pavon et al. 2008). The µ-opioid receptor (MOR) is the primary target mediating the rewarding effects of morphine and alcohol, which have been reported to be disrupted in TACR1−/− mice (Baek et al. 2010; Ripley et al. 2002; Thorsell et al. 2010). The NK-1R has been shown to regulate MOR signaling in vitro, providing a link between NK-1R and reward signals (Yu et al. 2009).

Behavioral studies have shown greater locomotor activity in TACR1−/− mice compared with controls and while d-amphetamine increased locomotor activity of wild-type mice, it reduced that of TACR1−/− mice. Furthermore, while basal dopamine efflux in the dorsal striatum was similar in wild-type and TACR1−/− mice, administration of d-amphetamine resulted in an increase in dopamine efflux in wild-type but not TACR1−/− mice (Yan et al. 2010). This biochemical imbalance in combination with behavioral changes such as hyperactivity and the disrupted response to rewarding stimuli resembles the human neurological condition ‘attention deficit hyperactivity disorder’ (ADHD). Symptoms of ADHD are hyperactivity, impulsivity, distractibility and inattention. Genetic studies showed polymorphisms in the human TACR1 gene in ADHD patients, suggesting that individuals with TACR1 mutations may be susceptible to ADHD (Yan et al. 2009). We were concerned that two odors being present at the same time in the FUST may be the reason for the decreased sniffing of female urine exhibited by TACR1−/− mice, simply as a result of ADHD-like behavior. We therefore included female urine in the habituation/dishabituation test, which confronts the animal with only one odor at a time. There was no difference in the outcome of the test. Although TACR1−/− mice displayed significant habituation/dishabituation, which suggests that they can differentiate between odors, they showed significantly decreased sniffing of female urine compared with C57BL/6, confirming that TACR1−/− mice show a specific disinterest in female urine.

Whether the decreased exploration of female urine, the fewer USV calls and the decreased mounting behavior of TACR1−/− males presented here are due to impaired pheromone processing, a deficiency in the rewarding effects of pheromones and thus diminished pheromone reward-seeking behavior or other behavioral abnormalities remains to be investigated. It is important to note that testosterone levels of male TACR1−/− mice did not differ from C57BL/6 mice. Furthermore, TACR1−/− mice are fertile and produce offspring with litter sizes comparable to that of other strains.

On the basis of the biochemical imbalance in TACR1−/− mice involving dopamine and d-amphetamine, we reasoned that d-amphetamine treatment may affect male sexual behavior differently in C57BL/6 controls and TACR1−/− mice. We show that d-amphetamine treatment decreased female urine sniffing in male C57BL/6 but not TACR1−/− mice. Consistent with our data obtained from male C57BL/6 mice, d-amphetamine treatment abolished the preference of female mice for male pheromones, suggesting that dopamine has an inhibitory role on pheromone processing (Lanuza et al. 2008). As TACR1−/− mice lack the increase in striatal dopamine efflux that occurs post-d-amphetamine administration (Yan et al. 2010), which in wild-type mice inhibits pheromone processing (Lanuza et al. 2008), this would offer an explanation as to why d-amphetamine decreased pheromone preference in male C57BL/6 but not TACR1−/− mice. However, because the urine sniffing times are very low in TACR1−/− mice, the absence of a drug effect being the result of a floor effect cannot be excluded.

Surprisingly, neither male TAC1−/−/TAC4−/−‘double-knockout mice’ lacking SP, NKA and HK-1 nor the single-knockout mice exhibited the same behavioral deficit as male TACR1−/− mice. In agreement with our findings, male SP-deficient mice responded to female urine in a C57BL/6-like fashion (Bilkei-Gorzo et al. 2002). All mutant mice used in our study were on the same genetic background (C57BL/6), thereby excluding variations due to vastly different background genetics, which has been shown to affect phenotypic changes (McCutcheon et al. 2008). Our findings are intriguing as SP and HK-1 are the major ligands for NK-1R. As NK-1R-mediated responses are mainly thought of as being SP mediated, our findings raise the possibility of other ligands acting through NK-1R when SP is not available. As TAC1−/−/TAC4−/− mice are deficient for SP, NKA and HK-1, the only tachykinin peptide left for consideration is NKB. Compensatory mechanisms involving NKB and functional redundancy may explain the lack of phenotypic alterations in TAC1−/−/TAC4−/− mice.

To confirm that the impaired olfactory investigation of female urine is due to NK-1R involvement rather than a ‘flanking allele problem’ and to verify that the use of C57BL/6 as controls instead of wild-type litter mates is a valid experimental approach, we performed the FUST on male C57BL/6 mice treated with the NK-1R-antagonist L-703,606. Treatment significantly decreased the female urine sniffing behavior of male C57BL/6 mice, indicating that the observed behavioral differences are not due to maternal effects that may have occurred because the parents of the control and mutant subjects had different genotypes, but rather are due to the absence of NK-1R, specifically. However, NK-1R antagonist treatment could not fully mimic the deficits seen in TACR1−/− mice. Given that neither TAC1−/− nor TAC1−/−/TAC4−/− mice showed a TACR1−/−-like phenotype, this finding is not surprising as NK-1R-antagonists were designed to block SP signaling, which does not seem to be solely responsible for the NK-1R-mediated deficiencies described here. A similar conclusion was made when TAC1−/− and TACR1−/− mice were compared in a migraine model. Whereas TACR1−/− mice were protected from dura-mater vascular permeability, a symptom of migraine headaches, TAC1−/− mice had intact vascular permeability, suggesting the involvement of a ligand other than SP/NKA (Kandere-Grzybowska et al. 2003). Low efficiency of NK-1R-antagonists in rodents has been attributed to low potency as most antagonists have been developed for human use. Owing to the mounting evidence of NK-1R involvement in a range of diseases and disorders, a reassessment of NK-1R-antagonist pharmacology may be warranted.

In conclusion, we show that disruption of the TACR1 gene leads to blunted sexual approach behavior in male mice following the initial encounter of a female. Our data therefore provide evidence for an important role of NK-1R signaling in the regulation of pheromone-induced sexual behavior.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgements
  • Agustin-Pavon, C., Martinez-Ricos, J., Martinez-Garcia, F. & Lanuza, E. (2008) Sex versus sweet: opposite effects of opioid drugs on the reward of sucrose and sexual pheromones. Behav Neurosci 122, 416425.
  • Baek, M.N., Jung, K.H., Halder, D., Choi, M.R., Lee, B.H., Lee, B.C., Jung, M.H., Choi, I.G., Chung, M.K., Oh, D.Y. & Chai, Y.G. (2010) Artificial microRNA-based neurokinin-1 receptor gene silencing reduces alcohol consumption in mice. Neurosci Lett 475, 124128.
  • Berger, A., Benveniste, P., Corfe, S.A., Tran, A.H., Barbara, M., Wakeham, A., Mak, T.W., Iscove, N.N. & Paige, C.J. (2010) Targeted deletion of the tachykinin 4 gene (TAC4−/−) influences the early stages of B lymphocyte development. Blood 116, 37923801.
  • Berger, A., Tran, A.H. & Paige, C.J. (2007) Co-regulated decrease of neurokinin-1 receptor and hemokinin-1 gene expression in monocytes and macrophages after activation with pro-inflammatory cytokines. J Neuroimmunol 187, 8393.
  • Berridge, K.C. & Robinson, T.E. (1998) What is the role of dopamine in reward: hedonic impact, reward learning, or incentive salience? Brain Res Brain Res Rev 28, 309369.
  • Berridge, K.C. & Robinson, T.E. (2003) Parsing reward. Trends Neurosci 26, 507513.
  • Bilkei-Gorzo, A., Racz, I., Michel, K. & Zimmer, A. (2002) Diminished anxiety- and depression-related behaviors in mice with selective deletion of the Tac1 gene. J Neurosci 22, 1004610052.
  • Bozic, C.R., Lu, B., Hopken, U.E., Gerard, C. & Gerard, N.P. (1996) Neurogenic amplification of immune complex inflammation. Science 273, 17221725.
  • Cao, Y.Q., Mantyh, P.W., Carlson, E.J., Gillespie, A.M., Epstein, C.J. & Basbaum, A.I. (1998) Primary afferent tachykinins are required to experience moderate to intense pain [see comment]. Nature 392, 390394.
  • De Felipe, C., Herrero, J.F., O’brien, J.A., Palmer, J.A., Doyle, C.A., Smith, A.J., Laird, J.M., Belmonte, C., Cervero, F. & Hunt, S.P. (1998) Altered nociception, analgesia and aggression in mice lacking the receptor for substance P [see comment]. Nature 392, 394397.
  • George, D.T., Gilman, J., Hersh, J., Thorsell, A., Herion, D., Geyer, C., Peng, X., Kielbasa, W., Rawlings, R., Brandt, J.E., Gehlert, D.R., Tauscher, J.T., Hunt, S.P., Hommer, D. & Heilig, M. (2008) Neurokinin 1 receptor antagonism as a possible therapy for alcoholism. Science 319, 15361539.
  • Kandere-Grzybowska, K., Gheorghe, D., Priller, J., Esposito, P., Huang, M., Gerard, N. & Theoharides, T.C. (2003) Stress-induced dura vascular permeability does not develop in mast cell-deficient and neurokinin-1 receptor knockout mice. Brain Res 980, 213220.
  • Lanuza, E., Novejarque, A., Martinez-Ricos, J., Martinez-Hernandez, J., Agustin-Pavon, C. & Martinez-Garcia, F. (2008) Sexual pheromones and the evolution of the reward system of the brain: the chemosensory function of the amygdala. Brain Res Bull 75, 460466.
  • Malkesman, O., Scattoni, M.L., Paredes, D., Tragon, T., Pearson, B., Shaltiel, G., Chen, G., Crawley, J.N. & Manji, H.K. (2010) The female urine sniffing test: a novel approach for assessing reward-seeking behavior in rodents. Biol Psychiatry 67, 864871.
  • Martinez-Hernandez, J., Lanuza, E. & Martinez-Garcia, F. (2012) Lesions of the dopaminergic innervation of the nucleus accumbens medial shell delay the generation of preference for sucrose, but not of sexual pheromones. Behav Brain Res 226, 538547.
  • McCutcheon, J.E., Fisher, A.S., Guzdar, E., Wood, S.A., Lightman, S.L. & Hunt, S.P. (2008) Genetic background influences the behavioural and molecular consequences of neurokinin-1 receptor knockout. Eur J Neurosci 27, 683690.
  • Nelson, D. & Bost, K. (2004) Non-neuronal mammalian tachykinin expression. Front Biosci 9, 21662176.
  • Nelson, D.A., Marriott, I. & Bost, K.L. (2004) Expression of hemokinin 1 mRNA by murine dendritic cells. J Neuroimmunol 155, 94102.
  • Nicola, S.M. (2010) The flexible approach hypothesis: unification of effort and cue-responding hypotheses for the role of nucleus accumbens dopamine in the activation of reward-seeking behavior. J Neurosci 30, 1658516600.
  • Patacchini, R. & Maggi, C.A. (2001) Peripheral tachykinin receptors as targets for new drugs. Eur J Pharmacol 429, 1321.
  • Ripley, T.L., Gadd, C.A., De Felipe, C., Hunt, S.P. & Stephens, D.N. (2002) Lack of self-administration and behavioural sensitisation to morphine, but not cocaine, in mice lacking NK1 receptors. Neuropharmacology 43, 12581268.
  • Rupniak, N.M., Carlson, E.C., Harrison, T., Oates, B., Seward, E., Owen, S., De Felipe, C., Hunt, S. & Wheeldon, A. (2000) Pharmacological blockade or genetic deletion of substance P (NK(1)) receptors attenuates neonatal vocalisation in guinea-pigs and mice. Neuropharmacology 39, 14131421.
  • Santarelli, L., Gobbi, G., Debs, P.C., Sibille, E.T., Blier, P., Hen, R. & Heath, M.J. (2001) Genetic and pharmacological disruption of neurokinin 1 receptor function decreases anxiety-related behaviors and increases serotonergic function. Proc Natl Acad Sci U S A 98, 19121917.
  • Thorsell, A., Schank, J.R., Singley, E., Hunt, S.P. & Heilig, M. (2010) Neurokinin-1 receptors (NK1R:s), alcohol consumption, and alcohol reward in mice. Psychopharmacology (Berl) 209, 103111.
  • Tran, A.H., Berger, A., Wu, G.E., Kee, B.L. & Paige, C.J. (2011) Early B-cell factor regulates the expression of hemokinin-1 in the olfactory epithelium and differentiating B lymphocytes. J Neuroimmunol 232, 4150.
  • Wang, H., Liang, S., Burgdorf, J., Wess, J. & Yeomans, J. (2008) Ultrasonic vocalizations induced by sex and amphetamine in M2, M4, M5 muscarinic and D2 dopamine receptor knockout mice. PLoS One 3, e1893.
  • Woolf, C.J., Mannion, R.J. & Neumann, S. (1998) Null mutations lacking substance: elucidating pain mechanisms by genetic pharmacology. Neuron 20, 10631066.
  • Yan, T.C., Hunt, S.P. & Stanford, S.C. (2009) Behavioural and neurochemical abnormalities in mice lacking functional tachykinin-1 (NK1) receptors: a model of attention deficit hyperactivity disorder. Neuropharmacology 57, 627635.
  • Yan, T.C., Mcquillin, A., Thapar, A., Asherson, P., Hunt, S.P., Stanford, S.C. & Gurling, H. (2010) NK1 (TACR1) receptor gene ‘knockout’ mouse phenotype predicts genetic association with ADHD. J Psychopharmacol 24, 2738.
  • Yang, M. & Crawley, J.N. (2009) Simple behavioural assessment of mouse olfaction. Curr Protoc Neurosci , Chapter 8 (Unit 8.24), 114.
  • Yu, Y.J., Arttamangkul, S., Evans, C.J., Williams, J.T. & Von Zastrow, M. (2009) Neurokinin 1 receptors regulate morphine-induced endocytosis and desensitization of mu-opioid receptors in CNS neurons. J Neurosci 29, 222233.
  • Zhang, Y., Lu, L., Furlonger, C., Wu, G.E. & Paige, C.J. (2000) Hemokinin is a hematopoietic-specific tachykinin that regulates B lymphopoiesis [see comment]. Nat Immunol 1, 392397.
  • Zhang, Y. & Paige, C.J. (2003) T-cell developmental blockage by tachykinin antagonists and the role of hemokinin 1 in T lymphopoiesis. Blood 102, 21652172.
  • Zimmer, A., Zimmer, A.M., Baffi, J., Usdin, T., Reynolds, K., Konig, M., Palkovits, M. & Mezey, E. (1998) Hypoalgesia in mice with a targeted deletion of the tachykinin 1 gene. Proc Natl Acad Sci U S A 95, 26302635.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgements

We want to thank Oz Malkesman (Center for Neuroscience & Regenerative Medicine, USUHS, Bethesda, USA) and Maria-Luisa Scattoni (Istituto Superiore di Sanità, Rome, Italy) for their helpful suggestions regarding reward systems and social/sexual behavior. There are no conflicts of interests. This study was supported by a Terry Fox Program Project Grant from the National Cancer Institute of Canada (Grant 015005) and by funds from the Canadian Institute of Health Research (Grant 9862) to C.J.P. and by a Canadian Institutes of Health Research grant as well as an Ontario Mental Health Foundation grant to J.Y.