SEARCH

SEARCH BY CITATION

Keywords:

  • active-site mutant;
  • DmGEN;
  • novel flap endonuclease;
  • nuclease activity;
  • site-directed mutagenesis

Abstract

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

Drosophila melanogaster XPG-like endonuclease (DmGEN) is a new category of nuclease belonging to the RAD2/XPG family. The DmGEN protein has two nuclease domains (N and I domains) similar to XPG/class I nucleases; however, unlike class I nucleases, in DmGEN these two nuclease domains are positioned close to each other as in FEN-1/class II and EXO-1/class III nucleases. To confirm the properties of DmGEN, we characterized the active-site mutant protein (E143A E145A) and found that DmGEN had flap endonuclease activity. DmGEN possessed weak nick-dependent 5′−3′ exonuclease activity. Unlike XPG, DmGEN could not incise the bubble structure. Interestingly, based on characterization of flap endonuclease activity, DmGEN preferred the blocked-flap structure as a substrate. This feature is distinctly different from FEN-1. Furthermore, DmGEN cleaved the lagging strand of the model replication fork. Immunostaining revealed that DmGEN was present in the nucleus of actively proliferating Drosophila embryos. Thus, our studies revealed that DmGEN belongs to a new class (class IV) of the RAD2/XPG nuclease family. The biochemical properties of DmGEN and its possible role are also discussed.

Abbreviations
BF

blocked flap

DmGEN

Drosophila melanogaster XPG-like endonuclease

dsDNS

double stranded DNA

RF

replication fork

ssDNA

single-stranded DNA

DNA replication, recombination and repair are key processes in maintaining genome integrity. Nucleases are necessary for their nucleolytic activities. They act on a variety of structural frameworks, ranging from site-specific (e.g. AP endonuclease) to structure-specific (e.g. RAD2/XPG nuclease family) and nonspecific (e.g. DNase I) nucleases. In particular, members of the RAD2/XPG nuclease family have unique nuclease activities and play critical roles in genome stability [1–6]. In a preliminary report, we described the presence of a new nuclease, Drosophila melanogaster XPG-like endonuclease (DmGEN) which belongs to the RAD2/XPG nuclease family, shows unique activity and possibly plays a critical role in genome stability [7]. The ORF of the DmGEN gene encoded a predicted protein of 726 amino acid residues with a molecular mass of 82.5 kDa. The gene was located at 64C9 on the left arm of Drosophila polytene chromosome 3 as a single site.

The RAD2/XPG family of nucleases, which have two conserved nuclease domains (the N domain and the I domain), are currently separated into three classes (XPG/class I, FEN-1/class II and EXO-1/class III) based on the types of nuclease activity and sequence homology [8,9]. In Drosophila, mus201 protein (class I), FEN-1 homologue protein (class II), and Tosca protein (class III) have been reported as RAD2 family proteins. The DmGEN protein showed a relatively high degree of sequence homology with RAD2 nucleases, particularly XPG, although the locations of the N and I domains were similar to those of FEN-1 and EXO-1, and the molecular mass of DmGEN was found to be close to that of EXO-1. Therefore, we proposed a new class (class IV) to categorize DmGEN and SEND-1, which we also found in higher plants [8]. Recently, a new member of the class IV nucleases, OsGEN-like, has been reported in rice; RNA-mediated silencing of the OsGEN-like caused male sterility due to a defect in microspore development [9]. Although DmGEN homologues are found widely in mammals and higher plants [7,9], knowledge about their biochemical properties is limited. In this study, we determined the biochemical properties of native and an active-site mutant DmGEN to more deeply understand the nature of this new class of nucleases.

As for the biochemical features, class I consists of XPG homologues, which cleave at the 3′ side of the bubble structure formed during nucleotide excision repair [10,11]. Class II comprises the FEN-1 homologues, which show 5′-flap endonuclease, 5′−3′ exonuclease and gap endonuclease activities, and play important roles in RNA primer removal, base excision repair and apoptotic DNA fragmentation [12–14]. Class III is made up of the EXO-1 homologues, which have 5′−3′ exonuclease activity and are involved in DNA recombination, mismatch repair and DNA replication [15–18]. The function for class IV, however, remains unclear. In relation to the studies, we must correct some mistakes in our previous study. We reported previously that DmGEN has not only 3′−5′- and nick- and gap-dependent 5′-3′ exonuclease activities, but also endonuclease activity at a site 3 or 4 bp from the 5′-end [7]. However, such activities were not found when DmGEN was purified more carefully, although nick-dependent 5′-3′ exonuclease activity was present. Thus, it is important to re-characterize this novel enzyme.

Here, we report that the DmGEN protein is a new flap endonuclease, which is different in nature from FEN-1. Based on our studies we have confirmed that DmGEN belongs to a new class of the RAD2/XPG family. In addition, we have characterized the biochemical properties of DmGEN.

Results

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

Design of substrates

All DNA substrates were designed as shown in Fig. 1, and were assembled using the oligonucleotides described in Table 1.

image

Figure 1.  The three categories of DNA substrates used in this study. Names shown (A, B, C, A-Flap, etc.) correspond to the oligonucleotides summarized in Table 1.

Download figure to PowerPoint

Table 1.   Oligonucleotides used to construct various DNA substrates shown in Fig. 1.
Oligo name Sequences (5′- to 3′)
AGGCTGCAGGTCGAC
BCAGCAACGCAAGCTTG
CGTCGACCTGCAGCCCAAGCTTGCGTTGCTG
A-flapATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC
B-flapCAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA
B-g1CAGCAACGCAAGCTT
B-g2CAGCAACGCAAGCT
B-g4CAGCAACGCAAG
A-b15AGAGATTTTCCACAT
A-b17CTAGAGATTTTCCACAT
A-b19TGCTAGAGATTTTCCACAT
DTGACAAGGATGGCTGGTGGGACTTAGCGTA
ETACGCTAAGTCCCACCAGCCATCCTTGTCA
FCCAGTGATCACATACGCTTTGCTAGGACATT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAG TGCCACGTTGTATGCCCACGTTGACCG
GCGGTCAACGTGGGCATACAACGTGGCACTGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG
X1GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG
X2CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC
X3GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC
X4GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC
X1halfGGACATCTTTGCCCACGTTGACCCG
X1half-g4ATCTTTGCCCACGTTGACCCG
X1half-g8TTGCCCACGTTGACCCG
X4halfGCGATAGTCTCTAGACAGCATGTCC

Comparison of the nuclease domain of the RAD2/XPG family

The RAD2/XPG family of proteins have two conserved nuclease domains (N and I domains), and these are essential for nuclease activity and substrate specificity. DmGEN also has these conserved nuclease domains. The N and I domains of DmGEN were similar to those of XPG/class I (Fig. 2A,B). The N domain of DmGEN showed 35.1, 25.0 and 10.9% homology (% identity) with the N domains of HsXPG, HsFEN-1 and HsEXO-1, respectively. The I domain of DmGEN showed 44.2, 38.5 and 38.5% homology (% identity) with the I domains of HsXPG, HsFEN-1 and HsEXO-1, respectively. The spacer region between the N and I domains is not required for nuclease activity, but contributes to substrate specificity [19]. The spacer region of DmGEN is very short, similar to that of FEN-1/class II and EXO-1/class III, but not XPG/class I (Fig. 2A). Therefore, DmGEN cannot be categorized into class I, II, or III. Like other members of the RAD2/XPG family, DmGEN also contains several acidic residues coordinating two Mg2+ at the active center for catalysis; one of these, which is an aspartic acid residue in other members of the RAD2/XPG family, is a glutamic acid residue in DmGEN (Fig. 2B, asterisk 1). In addition to the nuclease domains, the X-ray crystal structures of the archaeal FEN-1 homologues have assisted in the identification of critical structural elements (helical clamp, H3TH motif and several loop regions) for substrate binding [14]. Recently, Qui et al. [20] identified 18 positively charged amino acids that are important in the FEN−1–DNA interaction. DmGEN contains a number of positively charged residues; however, most of the positively charged amino acid residues forming the DNA-biding domain of HsFEN-1 are not conserved in DmGEN (Fig. 2C, Table 2).

image

Figure 2.  Comparison of the amino acid sequences of the RAD2/XPG family. (A) Schematic representation of the conserved N and I domains of some members of the RAD2/XPG family. The total number of amino acids in each protein and homology (% identity) between DmGEN and other members are indicated. (B) The conserved sequences encompassing the nuclease active site are aligned. Asterisk 1 indicates the nonconserved aspartic residue of DmGEN. Asterisks 2 and 3 indicate the active residues of DmGEN substituted by site-directed mutagenesis. (C) Comparison of positively charged amino acid residues essential for the FEN−1–DNA interaction with those of DmGEN. In total, 18 amino acid residues are compared in gray boxes.

Download figure to PowerPoint

Table 2.   Conservation of essential positively charged amino acid residue.
HsFEN-1DmGENConservedFunctional motifBinding site
R47D43NSubstrate-binding loopsUpstream
R70R58YSubstrate-binding loopsUpstream
K93K81YHelical clamp5′ flap
R104Q92NHelical clamp5′ flap
K125K114YHelical clamp5′ flap
K128S117NHelical clamp5′ flap
K129R118NHelical clamp5′ flap
K132H121NHelical clamp5′ flap
R192R177YSubstrate-binding loopsUpstream
K200A190NSubstrate-binding loopsUpstream
K201G191NSubstrate-binding loopsUpstream
K244D235NH3TH motifDownstream
R245G236NH3TH motifDownstream
K252K243YH3TH motifDownstream
K254K245YH3TH motifDownstream
K267G258NSubstrate-binding loopsDownstream
R327E317NSubstrate-binding loopsUpstream
K326L318NSubstrate-binding loopsUpstream

Expression, purification and characterization of DmGEN

DmGEN was expressed in Escherichia coli, tagged with six His residues at the N-terminus. DmGEN expression in E. coli was increased dramatically over the previously reported amount [7] by using the pCold I expression vector carrying the cold-shock promoter and inducing overexpression of DmGEN at 15 °C. The recombinant protein was sequentially purified by chromatography using a Ni-NTA resin column, SP Sepharose beads, and then fractionated on a Superdex-200 gel-filtration column. In the gel-filtration column, the protein (expected molecular mass ∼ 82.5 kDa) migrated between the expected molecular mass markers 75 and 100 kDa (Fig. 3A). Gel-filtration chromatography was crucial to completely purify the protein.

image

Figure 3.  Flap endnuclease activity of purified wild-type and mutant recombinant DmGEN (labeled as GEN). (A) Silver-stained gel showing the molecular mass markers and 290 ng of purified DmGEN and DmGEN (E143A E145A). Proteins were separated by electrophoresis on a 10% SDS-polyacrylamide gel. (B) Flap endonuclease activity at different concentrations of DmGEN. 5′-End-labeled flap structure substrate (25 nm) was incubated with different amounts of DmGEN (24, 48, 96 and 192 nm) or DmGEN E143A E145A double mutant (24, 48, 96 and 192 nm) at 37 °C for 90 min in a 20 µL reaction volume. (C) 3′-End-labeled flap structure substrate (25 nm) was incubated with DmGEN (24 and 48 nm) or DmGEN E143A E145A double mutant (96 nm) at 37 °C for 90 min in a 20 µL reaction volume. (D) ssDNA and dsDNA substrate (25 nm) was incubated with DmGEN (192 nm) or DmGEN E143A E145A double mutant (192 nm) at 37 °C for 60 min in a 20 µL reaction volume. Asterisk indicates the position of the radiolabel. Substrate and cleavage product sizes were as indicated. Electrophoresis was carried out on 10% polyacrylamide/7 m urea gels. The amounts of nuclease products were calculated with the aid of an image analyzer (image j 1.36b, National Institutes of Health).

Download figure to PowerPoint

Next, to characterize DmGEN nuclease activity more precisely, we constructed an active-site double mutant (E143A E145A) of DmGEN as described in Experimental procedures. As shown in Fig. 2B, these active-site residues (asterisks 2 and 3 in Fig. 2B) are highly conserved in the I domain of the RAD2/XPG family, and are important in coordinating divalent metal ions to interact with an incoming nucleotide [21]. We previously reported that DmGEN has both 5′−3′ and 3′−5′ exonuclease activity and endonuclease activity at a site 3 or 4 bp from the 5′-end in double-stranded DNA (dsDNA) [7]. The mutants were used to confirm these activities.

We analyzed the nuclease activities of wild-type and E143A E145A double-mutant DmGEN. Wild-type DmGEN did not show any detectable 3′−5′ exonuclease and endonuclease activities towards either single-stranded DNA (ssDNA) or dsDNA (Fig. 3D). These results differed from our previous report [7]. The previously reported nuclease activities of DmGEN [7] may have resulted from other contaminating nucleases. Indeed, when we checked other fractions from the gel-filtration column, we found these activities in a fraction obtained from the shoulder area of the elution profile. In our previous study, we were not able to use gel-filtration for purification because of the low yield of DmGEN.

Subsequently, on further careful characterization, we found that purified wild-type DmGEN shows flap endonuclease activity, and the E143A E145A double mutant lacks such activity (Fig. 3B). Thus, DmGEN cleaves the flap structure substrate at the junction between the ssDNA and dsDNA, and subsequently generates a product of 20 nucleotides. This activity of DmGEN was confirmed using 3′-end-labeled flap substrate (Fig. 3C). As shown, the 3′-end-labeled 30-nucleotide flap substrate was cleaved by wild-type DmGEN, but not by mutant DmGEN. Neither wild-type nor mutant DmGEN cleaved a 30-nucleotide ssDNA substrate or blunt-ended dsDNA substrate (Fig. 3D).

Ability of DmGEN to cleave other structures

To analyze the substrate specificity of DmGEN, we examined various test substrates, which were expected to be cleaved by the nuclease. These are shown schematically in Fig. 1. First, we tested whether DmGEN possesses nick- or gap-dependent 5′−3′ exonuclease activity, and produced gapped and nicked double-stranded substrates as reported previously [7]. As shown in Fig. 4A, DmGEN exhibited weak nick-dependent 5′−3′ exonuclease activity, but showed little or no gap-dependent 5′−3′ exonuclease activity. We confirmed that DmGEN cut only one nucleotide from the 3′-end-labeled nicked substrate (Fig. 4B). Because we had to use a large amount of DmGEN to cleave the nicked substrate, the cleaving rate of the nick-dependent 5′−3′ exonuclease activity of DmGEN is obviously lower than the flap endonuclease activity. Next, we tested whether DmGEN would cleave the bubble-like and the Holliday junction substrates, which are known to exist in vivo. Although XPG (class I nuclease) incised the target strand 3′ to the bubble-like and damage-containing structures [10], DmGEN was unable to cleave the bubble-like structure substrate (Fig. 4C, left). Nor was the Holliday junction substrate cleaved by DmGEN (Fig. 4C, right).

image

Figure 4.   (A) Nuclease activity of DmGEN protein (192 nm) on the 5′-end-labeled nicked and gapped substrates (25 nm). The reaction condition is described in Experimental procedures. Time-course experiments were performed. Substrates are depicted schematically in each panel. The asterisk indicates the position of the radiolabel. Substrate and cleavage product sizes were as indicated. (B) Nuclease activity of DmGEN protein (192 nm) on the 3′-end-labeled nicked substrates (25 nm). Time-course experiments were performed. (C) Nuclease activity of DmGEN (192 nm) on bubble and Holliday junction structure substrates (5 and 25 nm, respectively). Incubation was carried out at 37 °C for 60 min in a 20 µL reaction volume. Substrates are depicted schematically in each panel. Asterisk indicates the position of the radiolabel. Substrate sizes were as indicated. (A,B) Electrophoresis carried out on 20% polyacrylamide/8 m urea gels. (C) Electrophoresis carried out on 10% polyacrylamide/7 m urea gels. wt: DmGEN wild-type; mut: DmGEN E143A E145A double mutant.

Download figure to PowerPoint

Biochemical properties of DmGEN

To characterize the difference between the flap endonuclease activity of DmGEN and that of FEN-1 (class II), optimal reaction conditions for DmGEN were first determined using the flap structure substrate (Fig. 5). (Details of the reaction conditions are given in the legend to Fig. 5.) The optimal pH for DmGEN flap activity was 8, which was same as for FEN-1 (class II). DmGEN required divalent metal ions (such as Mg2+ and Mn2+), and the concentration of Mg2+ or Mn2+ ions required for optimal flap activity was 5 mm. However, the cleavage product of DmGEN in the presence of 5 mm Mn2+ was only 43.3% that in the presence of 5 mm Mg2+. Ca2+ and Zn2+ could not substitute for Mg2+ or Mn2+. DmGEN nuclease activity was highest in reaction mixtures containing 25 mm KCl, and further increasing the concentration of KCl inhibited the activity. These biochemical properties of DmGEN differed from data reported previously [7]. The requirement for divalent metal ions and low ionic strength for DmGEN optimal activity were like those of EXO-1 (class III). The above-described biochemical properties of DmGEN differed from those of other members (class I, II, and III) of the RAD2/XPG family.

image

Figure 5.  Biochemical properties of the DmGEN protein. Purified DmGEN (39 nm) was incubated with 5′-end-labeled flap structure substrate (25 nm) at 37 °C for 90 min in a 20 µL reaction volume. To test the effect of divalent metal ions, the reaction was carried out in 1 mm dithiothreitol, 10% glycerol, 50 mm Tris (pH 8) supplemented with 50 mm KCl and various concentrations of a given divalent metal ion, as indicated in the figure. To test the effect of salt, the reaction was carried out in 5 mm MgCl2, 1 mm dithiothreitol, 10% glycerol and 50 mm Tris (pH 8) and a given concentration of KCl, as indicated in the figure. To test the effect of pH, the reaction was carried out in 5 mm MgCl2, 1 mm dithiothreitol, 50 mm KCl, 10% glycerol and 50 mm Tris (pH 6.5–9.5). Following the reaction, products were resolved on 20% polyacrylamide/8 m urea gels and quantified using the image j 1.36b image analyzer.

Download figure to PowerPoint

Effect of DmGEN on the various flap structures

To determine the flap nuclease activity of DmGEN, we tested the action of DmGEN on several derivatives of the flap structure substrates. We prepared pseudo Y, gapped-flap, blocked-flap, double-flap and 3′-flap substrates, as shown in Fig. 1. In agreement with previous studies [14,22], FEN-1 cleaved the flap, pseudo Y, gapped-flap, blocked-flap and double-flap structure substrates (Fig. 6). Previously, it was reported that the blocked-flap substrate was hardly cleaved by the flap endonuclease activity of FEN-1 [23]. However, according to a recent report, the blocked-flap was cleaved by the gap endonuclease activity of FEN-1 [14]. Unlike FEN-1, DmGEN did not cleave the pseudo Y, gapped-flap and 3′-flap, but did cleave the blocked-flap and double-flap structures. In contrast to FEN-1, DmGEN preferred the blocked-flap structure substrate (Fig. 6).

image

Figure 6.  Nuclease activities of DmGEN (51 nm) and HsFEN-1 (4.7 nm) on various flap structure substrates (5 nm). Incubation was carried out at 37 °C for 60 min for DmGEN and 15 min for HsFEN-1 in a 20 µL reaction volume. Electrophoresis was carried out on a 20% polyacrylamide/8 m urea gel. Substrates are depicted schematically in each panel. Asterisk indicates the position of the radiolabel. Substrate and cleavage product sizes were as indicated. Amounts of nuclease products were calculated with the aid of the image j 1.36b image analyzer. wt: DmGEN wild-type; mut: DmGEN E143A E145A double mutant; hFEN-1: HsFEN-1 wild-type.

Download figure to PowerPoint

DmGEN cleaves blocked-flap structures and model replication fork substrates

To characterize DmGEN nuclease activity on the blocked-flap structure, we prepared blocked-flap structure substrates with various sizes of oligonucleotides bound to the 5′-tail of the single-stranded flap. The sizes of the blocking oligonucleotides in the blocked-flap (BF) substrates – BF1, BF2 and BF3 – were 15, 17 and 19 bp, respectively (Fig. 7A). The single-stranded region of the BF structure was 19 bp, and the gap sizes of the blocked strand of BF1, BF2 and BF3 were 4, 2 and 0 nucleotides, respectively. In agreement with a previous study [24], the cleavage efficiency of HsFEN-1 decreased with the narrower gapped substrate (Fig. 7A). FEN-1 cleaved the blocked-flap substrate at much slower rate than the free flap structure substrate. However, DmGEN cleaved both BF1 and BF2 to a similar extent as the nonblocked flap substrate (Fig. 7B). There was also some cleavage of BF3, the blocked-flap substrate without gap (Fig. 7B). Because the free 5′ ssDNA end of the flap is important for FEN-1 cleavage efficiency [14,23,24], we also examined flap endonuclease activity on the hairpinned-flap structure with no free 5′-end. We prepared the hairpinned-flap structure substrates with the same sequence as the blocked-flap substrate (Table S1). In agreement with a previous study [24], the cleavage efficiency of HsFEN-1 on the hairpinned-flap substrates decreased considerably with the narrower gapped substrate (Fig. S1A). However, DmGEN cleaved hairpinned-flap, although the activity was weaker than on the free flap substrate (Fig. S1B).

image

Figure 7.   (A) Nuclease activity of HsFEN-1 (4.7 nm) on the flap structure substrate and blocked-flap structure substrates (5 nm). The reaction condition is described in Experimental procedures. Time-course experiments were performed. Substrates are depicted schematically in each panel. Asterisk indicates the position of the radiolabel. Substrate and cleavage product sizes were as indicated. Electrophoresis was carried out on a 20% polyacrylamide/8 m urea gel. hFEN-1: HsFEN-1. (B) Nuclease activity of DmGEN (48 nm) on the flap structure substrate and blocked-flap structure substrates (25 nm). (C) Nuclease activity of DmGEN protein (97 nm) on the model replication fork substrates (25 nm). (B,C) Electrophoresis was carried out on 10% polyacrylamide/7 m urea gels. Amounts of nuclease products were calculated with the aid of the image j 1.36b image analyzer. wt: DmGEN wild-type; mut: DmGEN E143A E145A mutant.

Download figure to PowerPoint

Because DmGEN cleaved the blocked-flap structure, we examined whether DmGEN cleaves model replication fork (RF) substrates. Model replication fork substrates, in which the junction branch migrates, were made as shown in Fig. 7C. We prepared four derivatives (RF1–RF4) of the model replication fork. RF1 resembles the replication fork that lacks the progressing lagging strand. RF2, RF3 and RF4 are the forms of the normal replication fork differing in the gap sizes of the lagging strand. The gaps in the RF2, RF3 and RF4 are 8, 4 and 0 bp, respectively. As shown in Fig. 7C, DmGEN cleaved the lagging strand of the model normal replication forks with gaps (RF2 and RF3) to the similar extent as the RF1. However, DmGEN poorly cleaved RF4, the substrate without any gap both at the lagging strand and the leading strand (Fig. 7C).

Localization of DmGEN in Drosophila embryos

To confirm the relationship between DmGEN and DNA replication in vivo, immunostaining of Drosophila embryos was performed. In Drosophila, the embryonic stages were separated into 17 steps [25]. The first 13 nuclear divisions occurred in stage 1–4 embryos (0:00–2:10 h embryos). The first seven rounds take place within the interior of the embryo, the majority of nuclei then migrate to the cortex during cycles 8 and 9, leaving behind a small number of yolk nuclei [26]. Polyclonal anti-DmGEN serum used for the immunocytochemical study reacted specifically with the DmGEN protein (expected molecular mass 82.5 kDa) in a crude extract of 0–3 h Drosophila embryos (Fig. 8, left). As a result of immunostaining, DmGEN was localized in the nucleus throughout the 13 nuclear division cycles. The nuclear localization of DmGEN was seen in the interior of the embryo at the stage 2 (Fig. 8A–C, right). However, nuclear localization of DmGEN was observed in a wide range of embryo at the stage 3 (Fig. 8D–F, right).

image

Figure 8.  A rabbit polyclonal anti-DmGEN serum was used for Immunostaing of 0–3 h Drosophila embryos. Microscopic imaging of embryos labeled with DNA in blue (DAPI) and DmGEN in green (α-DmGEN pAb). (A–C) Embryo at stage 2 (0:25 to 1:05 h embryo). (D–I) Embryo at stage 3 (1:05 to 2:10 h embryo). (J–L) Negative control. Magnification: ×100 (A–F); ×400 (G–I); ×100 (J–L).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

The purpose of this study was to precisely characterize a newly found member (class IV) of the RAD2/XPG family of nucleases, DmGEN, from Drosophila melanogaster. The biochemical properties of class IV nucleases are largely unknown in various animals and plants. For this purpose, we created an active-site mutant, and used this mutant to confirm the biochemical properties of DmGEN. We purified wild-type and mutant DmGEN protein using an improved purification protocol, and analyzed the nuclease activities of the purified proteins. Thus, we showed that DmGEN was a new type of flap endonuclease.

The amino acid sequence of DmGEN protein has three principal features (Fig. 2). First, one of the acidic residues at the active center for catalysis was not conserved in DmGEN (Fig. 2B, asterisk 1). Regarding this nonconserved aspartic acid residue, Constantinou et al. [27] reported that the D77E active-site mutant of XPG protein showed considerably lower nuclease activity than wild-type XPG protein. Second, most of the positively charged amino acids residues, which are essential for binding FEN-1 to DNA [14,20], were not conserved in DmGEN protein (Fig. 2C, Table 2). These two features contribute to the low nuclease activity of DmGEN. Lastly, DmGEN shows high homology between the N and I regions and XPG (class I), but the spacing of these regions is similar to in FEN-1 and EXO-1 (class I and III, respectively). We confirmed how this feature contributes the nuclease activity of DmGEN (class IV). DmGEN had a flap endonuclease activity, like FEN-1, but was not able to cleave the bubble structure, unlike XPG (Figs 3, 4). Because DmGEN had no 5′−3′ exonuclease activity on the dsDNA substrate (Fig. 3D), DmGEN is distinctly different from EXO-1 (class III). Recently, it was suggested that the activity of the RAD2/XPG nuclease family is determined by the properties and positions of the two nuclease domains [19,28]. The adjacent position of the two domains may be responsible for not cleaving the bubble structure (Fig. 4C), because a XPG mutant with a deletion in the spacer region was shown to prefer the pseudo Y structure to the bubble structure [19].

The flap endonuclease activity of DmGEN is more accurate and weaker than that of FEN-1 (class II nuclease). For example, FEN-1 cleaves many DNA structures such as 5′-single-strand overhang including flap, pseudo Y, gapped-flap and 5′-overhang double-strand [14]. In contrast, as shown Fig. 6, DmGEN cleaves the normal flap substrate and a special flap structure: the blocked-flap substrate in which the 5′-single-strand overhang of the flap is double-stranded; DmGEN cleaves just at the ssDNA/dsDNA junction point. We found very little cleavage of gapped-flap and pseudo Y substrates by DmGEN. Therefore, the DNA structure at the junction seems to be important for DmGEN-mediated cleavage. Unlike pseudo Y and gapped-flap, DmGEN preferred a substrate in which the 5′-upstream of the flap is completely double-stranded. This idea is supported by the fact that DmGEN cleaved the double-flap substrate (Fig. 6). The interesting feature of DmGEN is that this nuclease cleaves the blocked-flap structure, and this activity is slightly stronger than the normal flap structure cleaving activity, a feature that is distinctly different from that of FEN-1. In agreement with the previous report [24], we also found that the activity of FEN-1 decreases considerably when the flap substrate is double-stranded (Fig. 7A). On the hairpinned-flap substrates having no free 5′-end, the nuclease activity of both FEN-1 and DmGEN are weaker than that on the normal flap substrate (Fig. S1). Because FEN-1 prefers a free 5′ ssDNA end of flap [14,23,24], the nuclease activity on the hairpinned-flap substrate is weak, like for the blocked-flap substrate [24]. Therefore, in contrast to FEN-1, DmGEN prefers a free 5′-end of flap, which is either single- or double-stranded, this is deduced from the fact that DmGEN preferred the blocked-flap structure, but not the hairpinned-flap structure. These results suggest that binding of the substrate to DmGEN might differ from that of FEN-1. This is also suggested by the fact that most of the positively charged amino acids residues, which are essential for binding of FEN-1 to DNA [14], were not conserved in the DmGEN protein (Fig. 2C).

The most interesting activity of DmGEN is that it cleaves the blocked-flap structure and the hairpinned-flap structure substrate (Fig. 7B, Fig. S1). The blocked-flap structure can be regarded as a model for the normal replication fork. Interestingly, DmGEN cleaved the lagging strand of the model replication fork with gaps (Fig. 7C). Furthermore, DmGEN was localized in the nucleus of Drosophila early embryos, in which DNA replication is actively occurred (Fig. 8). To maintain chromosome integrity, several DNA repair pathways coupled with the lagging strand of the replication fork are working [29,30]. Lopes et al. reported that ssDNA gaps accumulate along replicated duplexes in vivo, when DNA replication forks pause and restart near lesions on the template [31]. They also argued that translesion synthesis and recombinational repair play a crucial role in repairing these ssDNA gaps [31]. RAD51-mediated DNA recombinational repair needs free 3′-overhang DNA [32,33]. We speculate that DmGEN may cleave the lagging strand of the replication fork with gaps. As a result of the cleavage, DmGEN produces free 3′-overhang DNA, which subsequently becomes available for RAD51-mediated recombinational repair.

The above-described properties of DmGEN obviously differ from other members of the RAD2/XPG family of nucleases. Thus, we suggest that DmGEN should be categorized in a new class (class IV) of the RAD2/XPG family. Homologues of DmGEN are widely found in animals and plants. This suggests that DmGEN may play an important biological role. Further characterization of DmGEN may shed new light on biological events related to DNA metabolism.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

Expression and purification of DmGEN protein

PCR was carried out using the EST clone RE33588, containing the entire Drosophila GEN (DmGEN) coding sequence. The primers synthesized chemically were 5′-CATATGGGCGTCAAGGAATTATG-3′ and 5′-GGATCCCTTAATCACTAATCACCACCA-3′. The resultant 2181 bp NdeI/BamHI DNA fragment was cloned into the corresponding sites of the pCold I expression vector (Takara, Shiga, Japan). For protein expression, the pCold I–DmGEN plasmid was transformed into the E. coli BL21(DE3) (Novagen, Darmstadt, Germany). Bacteria containing the plasmid were grown at 30 °C in 2000 mL of Luria–Bertani medium supplemented with 50 µg·mL−1 ampicillin. Cells were grown to D = 0.7 and isopropyl-β-d-thiogalactoside was added to a final concentration of 1 mm. After 24 h incubation at 15 °C, cells were harvested by centrifugation at 3000 g for 10 min. Cell pellets were resuspended in 40 mL of ice-cold binding buffer (50 mm NaPO4 pH 8.0, 0.5 m NaCl, 5 mm imidazole and 0.01% NP-40) and sonicated with five 10-s bursts. Cell lysates were centrifuged at 15 000 g for 30 min and the supernatant containing soluble proteins was collected as the crude extract. The supernatant was loaded onto a 1 mL of Ni-NTA resin column (Invitrogen Japan, Tokyo, Japan). The column was washed with 40 mL of washing buffer (50 mm NaPO4 pH 8.0, 0.5 m NaCl, 20 mm imidazole and 0.01% NP-40), and the bound protein was eluted with 10 mL of elution buffer (50 mm NaPO4 pH 8.0, 0.5 m NaCl, 0.5 m imidazole and 0.01% NP-40). The eluted protein was dialyzed against TEG (50 mm Tris/HCl pH 7.5, 1 mm EDTA and 10% glycerol). The dialysate was loaded onto a 1 mL SP Sepharose Fast Flow column (GE Healthcare, Buckinghamshire, UK) equilibrated with TEG. After washing, the bound protein was eluted with 30 mL of a linear gradient of 0–1.5 m NaCl in TEG and the collected protein was dialyzed against TEG. Finally, the dialysate was loaded onto a Superdex-200 column (GE Healthcare) equilibrated with TEMG (50 mm Tris/HCl pH 7.5, 1 mm EDTA, 5 mm 2-mercaptoethanol and 10% glycerol) containing 150 mm NaCl. The peak fraction (1 mL) of DmGEN was dialyzed against the TEMG buffer containing 150 mm NaCl, and stored at −80 °C until used. We also purified the HsFEN-1 protein from the E. coli BL21(DE3) transformed with the pET28–HsFEN-1 plasmid and following a previously published report [34], and used the purified HsFEN-1 as a positive control.

Construction of an active-site double mutant of DmGEN (E143A E145A)

We identified the active-site conserved residues of DmGEN (E143 and E145) by amino acid sequence alignment with the other members of the RAD2/XPG family of nucleases (Fig. 2B, asterisks 2 and 3), in particular, HsFEN-1, which was previously functionally characterized using point mutation analysis by Shen et al. [21]. The following primers were chemically synthesized to create DmGEN point mutations: 5′-CGTCCAAGGTCCCGGCGCAGCGGCAGCCTACTGTGCCTTT-3′ and 5′-AAAGGCACAGTAGGCTGCCGCTGCGCCGGGACCTTGGACG-3′ (altered DNA sequences are underlined). Mutagenesis was performed using the Quick Change II site-directed mutagenesis kit (Stratagene, La Jolla, CA). Expression and purification of the mutant DmGEN protein were carried out following the procedures described above for wild-type DmGEN.

Preparation of substrates for nuclease assays

The nucleotide sequences of the oligonucleotides used to form DNA substrates for this study are shown in Table 1. DNA substrates were prepared as described previously [7]. The gapped-flap is a flap substrate that has a 4 bp gap at the upstream primer of the dsDNA. By contrast, the blocked-flap (BF) is a flap substrate in which a primer is bound to the 5′-tail of the single-stranded flap. The double-flap is a flap substrate that has both a 5′ flap and a 3′ flap. Model replication fork and Holliday junction substrates were made as described by Boddy et al. [35]. Figure 1 shows the DNA structures generated.

Nuclease assay (with linear DNA as the substrate)

The DmGEN protein was incubated with 32P-labeled DNA substrate in a 20 µL reaction mixture containing 50 mm Tris/HCl pH 8.0, 5 mm MgCl2, 10% glycerol and 1 mm dithiothreitol at 37 °C. The amounts of protein and substrates used are given in the figure legends. The reaction was stopped by adding 20 µL of gel-loading buffer (90% formamide, 5 mm EDTA, 0.1% bromophenol blue and 0.1% xylene cyanol), the sample was heated for 5 min at 95 °C, and a fraction was loaded onto a 20% polyacrylamide gel containing 8 m urea in TBE buffer, and electrophoresis was carried out for 2 h. After drying, gels were exposed to BioMax MS-1 (Eastman Kodak Co., New York, NY) and the DNA bands were quantified using an image analyzer (image j 1.36b, National Institutes of Health, Bethesda, MD). FEN-1 was used as a positive control following the same procedure and using the conditions described in the figure legends.

Immunostainning of Drosophila embryos

A polyclonal antibody against the DmGEN protein was raised in a rabbit using the purified recombinant DmGEN fragment (amino acid residues 508–680). Animals were fed water and standard rabbit food and maintained on a 12-h light/dark cycle. Polyclonal antiserum to the peptide was raised in rabbits by subcutaneous injections of 0.3 mg of the peptide emulsified in Freund's complete adjuvant. Two weeks after the primary injection, boosts of 0.3 mg of the peptide in Freund's incomplete adjuvant were injected every 2 weeks. The rabbits were bled one week after the final boost under anesthesia. The rabbits were treated in accordance with procedures approved by the Animal Ethics Committee of the Tokyo University of Science. Western immunoblot analysis showed that it reacts specifically with the DmGEN protein in a crude extract of 0–3 h Drosophila embryos. Embryos of Drosophila melanogaster (Canton S) 0–3 h old were collected, dechorionated, fixed and devitellinized as described by Ashburner [36]. The procedure of immunostaining was previously described by Takata et al. [37]. A polyclonal rabbit anti-DmGEN serum and Alexa488–anti-(rabbit IgG) (Sigma, St Louis, MO) were used as primary and secondary antibodies, respectively. The nuclei were stained with DAPI.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

We thank Dr Yukinobu Uchiyama and Dr Kazuki Iwabata (Tokyo University of Science) for helpful discussions.

References

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References
  • 1
    Szankasi P & Smith GR (1995) A role for exonuclease I from S. pombe in mutation avoidance and mismatch correction. Science 267, 11661169.
  • 2
    Harada YN, Shiomi N, Koike M, Ikawa M, Okabe M, Hirota S, Kitamura Y, Kitagawa M, Matsunaga T, Nikaido O et al. (1999) Postnatal growth failure, short life span, and early onset of cellular senescence and subsequent immortalization in mice lacking the xeroderma pigmentosum group G gene. Mol Cell Biol 19, 23662372.
  • 3
    Larsen E, Gran C, Saether BE, Seeberg E & Klungland A (2003) Proliferation failure and gamma radiation sensitivity of Fen1 null mutant mice at the blastocyst stage. Mol Cell Biol 23, 53465353.
  • 4
    Tian M, Jones DA, Smith M, Shinkura R & Alt FW (2004) Deficiency in the nuclease activity of xeroderma pigmentosum G in mice leads to hypersensitivity to UV irradiation. Mol Cell Biol 24, 22372242.
  • 5
    Bardwell PD, Woo CJ, Wei K, Li Z, Martin A, Sack SZ, Parris T, Edelmann W & Scharff MD (2004) Altered somatic hypermutation and reduced class-switch recombination in exonuclease 1-mutant mice. Nat Immunol 5, 224229.
  • 6
    Wei K, Clark AB, Wong E, Kane MF, Mazur DJ, Parris T, Kolas NK, Russell R, Hou H, Kneitz B (2003) Inactivation of exonuclease 1 in mice results in DNA mismatch repair defects, increased cancer susceptibility, and male and female sterility. Genes Dev 17, 603614.
  • 7
    Ishikawa G, Kanai Y, Takata K, Takeuchi R, Shimanouchi K, Ruike T, Furukawa T, Kimura S & Sakaguchi K (2004) DmGEN, a novel RAD2 family endo-exonuclease from Drosophila melanogaster. Nucleic Acids Res 32, 62516259.
  • 8
    Furukawa T, Kimura S, Ishibashi T, Mori Y, Hashimoto J & Sakaguchi K (2003) OsSEND-1: a new RAD2 nuclease family member in higher plants. Plant Mol Biol 51, 5970.
  • 9
    Moritoh S, Miki D, Akiyama M, Kawahara M, Izawa T, Maki H & Shimamoto K (2005) RNAi-mediated silencing of OsGEN-L (OsGEN-like), a new member of the RAD2/XPG nuclease family, causes male sterility by defect of microspore development in rice. Plant Cell Physiol 46, 699715.
  • 10
    O'Donovan A, Davies AA, Moggs JG, West SC & Wood RD (1994) XPG endonuclease makes the 3′ incision in human DNA nucleotide excision repair. Nature 371, 432435.
  • 11
    Clarkson SG (2003) The XPG story. Biochimie 85, 11131121.
  • 12
    Lieber MR (1997) The FEN-1 family of structure-specific nucleases in eukaryotic DNA replication, recombination and repair. Bioessays 19, 233240.
  • 13
    Bibikova M, Wu B, Chi E, Kim KH, Trautman JK & Carroll D (1998) Characterization of FEN-1 from Xenopus laevis. cDNA cloning and role in DNA metabolism. J Biol Chem 273, 3422234229.
  • 14
    Shen B, Singh P, Liu R, Qiu J, Zheng L, Finger LD & Alas S (2005) Multiple but dissectible functions of FEN-1 nucleases in nucleic acid processing, genome stability and diseases. Bioessays 27, 717729.
  • 15
    Genschel J, Bazemore LR & Modrich P (2002) Human exonuclease I is required for 5′- and 3′ mismatch repair. J Biol Chem 277, 1330213311.
  • 16
    Bedale WA, Inman RB & Cox MM (1993) A reverse DNA strand exchange mediated by recA protein and exonuclease I. The generation of apparent DNA strand breaks by recA protein is explained. J Biol Chem 268, 1500415016.
  • 17
    Lee BI & Wilson DM (1999) The RAD2 domain of human exonuclease 1 exhibits 5′- to 3′ exonuclease and flap structure-specific endonuclease activities. J Biol Chem 274, 3776337769.
  • 18
    Lee BI, Nguyen LH, Barsky D, Fernandes M & Wilson DM (2002) Molecular interactions of human Exo1 with DNA. Nucleic Acids Res 30, 942949.
  • 19
    Dunand-Sauthier I, Hohl M, Thorel F, Jaquier-Gubler P, Clarkson SG & Scharer OD (2005) The spacer region of XPG mediates recruitment to nucleotide excision repair complexes and determines substrate specificity. J Biol Chem 280, 70307037.
  • 20
    Qiu J, Liu R, Chapados BR, Sherman M, Tainer JA & Shen B (2004) Interaction interface of human flap endonuclease-1 with its DNA substrates. J Biol Chem 279, 2439424402.
  • 21
    Shen B, Nolan JP, Sklar LA & Park MS (1997) Functional analysis of point mutations in human flap endonuclease-1 active site. Nucleic Acids Res 25, 33323338.
  • 22
    Harrington JJ & Lieber MR (1994) The characterization of a mammalian DNA structure-specific endonuclease. EMBO J 13, 12351246.
  • 23
    Murante RS, Rust L & Bambara RA (1995) Calf 5′- to 3′ exo/endonuclease must slide from a 5′ end of the substrate to perform structure-specific cleavage. J Biol Chem 270, 3037730383.
  • 24
    Liu R, Qiu J, Finger LD, Zheng L & Shen B (2006) The DNA–protein interaction modes of FEN-1 with gap substrates and their implication in preventing duplication mutations. Nucleic Acids Res 34, 17721784.
  • 25
    Bownes M (1975) A photographic study of development in the living embryo of Drosophila melanogaster. J Embryol Exp Morphol 33, 789801.
  • 26
    Yamaguchi M, Date T & Matsukage A (1991) Distribution of PCNA in Drosophila embryo during nuclear division cycles. J Cell Sci 100, 729733.
  • 27
    Constantinou A, Gunz D, Evans E, Lalle P, Bates PA, Wood RD & Clarkson SG (1999) Conserved residues of human XPG protein important for nuclease activity and function in nucleotide excision repair. J Biol Chem 274, 56375648.
  • 28
    Hohl M, Dunand-Sauthier I, Staresincic L, Jaquier-Gubler P, Thorel F, Modesti M, Clarkson SG & Scharer OD (2007) Domain swapping between FEN-1 and XPG defines regions in XPG that mediate nucleotide excision repair activity and substrate specificity. Nucleic Acids Res 35, 30533063.
  • 29
    Rossi ML, Purohit V, Brandt PD & Bambara RA (2006) Lagging strand replication proteins in genome stability and DNA repair. Chem Rev 106, 453473.
  • 30
    Kimura S, Tahira Y, Ishibashi T, Mori Y, Mori T, Hashimoto J & Sakaguchi K (2004) DNA repair in higher plants; photoreactivation is the major DNA repair pathway in non-proliferating cells while excision repair (nucleotide excision repair and base excision repair) is active in proliferating cells. Nucleic Acids Res 32, 27602767.
  • 31
    Lopes M, Foiani M & Sogo JM (2006) Multiple mechanisms control chromosome integrity after replication fork uncoupling and restart at irreparable UV lesions. Mol Cell 21, 1527.
  • 32
    Michel B (2000) Replication fork arrest and DNA recombination. Trends Biochem Sci 25, 173178.
  • 33
    Mazin AV, Zaitseva E, Sung P & Kowalczykowski SC (2000) Tailed duplex DNA is the preferred substrate for Rad51 protein-mediated homologous pairing. EMBO J 19, 11481156.
  • 34
    Kimura S, Ueda T, Hatanaka M, Takenouchi M, Hashimoto J & Sakaguchi K (2000) Plant homologue of flap endonuclease-1: molecular cloning, characterization, and evidence of expression in meristematic tissues. Plant Mol Biol 42, 415427.
  • 35
    Boddy MN, Gaillard PH, McDonald WH, Shanahan P & Yates R (2001) Mus81–Eme1 are essential components of a Holliday junction resolvase. Cell 107, 537548.
  • 36
    Ashburner M (1989) Antibody staining of embryos. Drosophila, Laboratory Manual, pp. 214216. Cold Spring Harbor Press, New York, NY.
  • 37
    Takata K, Ishikawa G, Hirose F & Sakaguchi K (2002) Drosophila damage-specific DNA-binding protein 1 (D-DDB1) is controlled by the DRE/DREF system. Nucleic Acids Res 30, 37953808.