Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity

Authors


S. K. Dhar, Special Centre for Molecular Medicine, JNU, New Delhi 110067, India
Fax: +91 11 26741781
Tel: +91 11 26742572
E-mail: skdhar2002@yahoo.co.in

Abstract

Helicobacter pylori, an important bacterial pathogen, causes gastric ulcer and gastric adenocarcinoma in humans. The fundamentals of basic biology such as DNA replication are poorly understood in this pathogen. In the present study, we report the cloning and functional characterization of the single-stranded DNA (ssDNA) binding protein from H. pylori. The N-terminal DNA binding domain shows significant homology with E. coli single-stranded DNA binding protein (SSB), whereas the C-terminal domain shows less homology. The overall DNA-binding activity and tetramerization properties, however, remain unaffected. In in vitro experiments with purified proteins, H. pylori (Hp) SSB bound specifically to ssDNA and modulated the enzymatic ATPase and helicase activity of HpDnaB helicase. HpSSB and HpDnaB proteins were co-localized in sharp, distinct foci in exponentially growing H. pylori cells, whereas both were spread over large areas in its dormant coccoid form, suggesting the absence of active replication forks in the latter. These results confirm the multiple roles of SSB during DNA replication and provide evidence for altered replicative metabolism in the spiral and coccoid forms that may be central to the bacterial physiology and pathogenesis.

Abbreviations
dsDNA

double-stranded DNA

Ec

E. coli

FITC

fluoroscein isothicyanate

GST

glutathione S-transferase

Hp

Helicobacter pylori

IPTG

isopropyl thio-β-d-galactoside

Pi

inorganic phosphate

SSB

single-stranded DNA binding protein

ssDNA

single-stranded DNA

Helicobacter pylori causes gastric ulcer and gastric adenocarcinoma related diseases in humans [1,2]. Although there are effective therapies against these bacteria, an increasing incidence of antibiotic resistance and recurrent infection following treatment complicates the situation [3,4]. Considerable research has been conducted on the clinical aspects of H. pylori infection but the fundamental aspects of cell cycle and DNA replication are poorly understood.

H. pylori can transform from the active helical bacillary form into the dormant coccoid form, which is the manifestation of a bacterial response towards antibiotics, stress, aging and unfavorable conditions [5–8]. Almost nothing is known regarding the molecular mechanisms involved in vegetative to coccoid transition and the biology of the dormant coccoid form.

DNA replication requires the timely interplay of various proteins that co-ordinate initiation, elongation and termination. Although H. pylori fall into the kingdom of Gram negative bacteria, the sequence analysis of Helicobacter genome reveals interesting features that include the location of the dnaA gene, approximately 600 kb away from the dnaN-gyrB gene cluster and the absence of important genes such as recF and the helicase loader dnaC [9,10]. We have shown recently that the H. pylori (Hp) DnaB helicase can bypass E. coli (Ec) DnaC function in vivo that may explain the absence of the dnaC gene in H. pylori [11,12]. The C-terminal region of HpDnaB is unique, with a 34 amino acid residue insertion region that is essential for its function [13]. Recently, a protein HobA, the structural homolog of E. coli protein DiaA has been shown to interact with the initiator protein DnaA and this interaction is essential for DNA replication in Helicobacter [14,15].

One protein that is central to the DNA replication, repair and recombination is single-stranded DNA binding protein (SSB) [16,17]. The N-terminal domain of SSB is highly conserved and forms an oligonucleotide binding fold, and this region is also responsible for oligomerization, typically homotetramerization in eubacteria. The C-terminal region is less conserved and is responsible for protein–protein interaction [18,19]. The proteins that may interact with SSB include DNA polymerase, RNA polymerase and DNA helicases [20–22]. Although, no direct interaction has been shown between SSB and DnaB replicative helicase, the physical interaction between SSB and PriA helicase, the major DNA replication restart protein, has been demonstrated recently [23]. The extreme C-terminal ten residues are essential for the interaction of EcSSB with PriA helicase and the deletion of these residues affects the stimulation of helicase activity of PriA mediated through SSB [23]. Interestingly, deletion of 10 amino acid residues from the extreme C-terminus affects in vivo function of EcSSB [24]. Taken together, these results suggest that the extreme C-terminal residues of SSB are important for protein–protein interaction.

To understand the basic DNA replication machinery of H. pylori in detail, we have cloned, over-expressed and characterized the functional properties of HpSSB both in vitro and in vivo. We found that HpSSB is a true homolog of SSB in vivo because it can complement the Ecssb mutant strain and is localized in the replisome assembly of E. coli. Furthermore, we show that HpSSB can modulate the enzymatic activities of HpDnaB significantly. Finally, we report that both HpSSB and HpDnaB are co-localized in distinct foci in replicating H. pylori but not in the dormant coccoid form, indicating an important difference between the two forms regarding bacterial physiology and growth. These results further enhance our knowledge on SSB proteins from a slow growing pathogenic bacteria and offer great potential to study DNA–protein and protein–protein interaction that is central to the DNA replication machinery in prokaryotes. To the best of our knowledge, this is the first probe into the coccoid stage demonstrating its distinction from the vegetative, spiral stage in DNA replication activity.

Results and Discussion

Cloning, expression, purification and biochemical activity of HpSSB

The coding region of the ORF, HP1245 (annotated as the putative HpSSB homlog) was amplified using specific primers (as shown in the Experimental procedures) and genomic DNA from H. pylori strain 26695. The amplified PCR product was subsequently cloned in the expression vector pET28a and was sequenced completely. The deduced amino acid sequence was aligned with E. coli and Bacillus subtilis SSB sequences using the multiple sequence alignment program clustalw (Fig. 1A). Overall, HpSSB shows 30% identity and 45% homology with EcSSB. The analysis shows more homology at the N-terminal DNA-binding domain (∼ 67%) compared to the C-terminal domain (∼ 34%), which is assumed to be the region responsible for protein–protein interaction. Sequence comparison reveals many interesting features that include the absence of some important residues in HpSSB compared to that of EcSSB. The tryptophan residues (Trp40 and Trp54 in EcSSB) have been replaced by phenyl alanine residues [25]. In vitro, mutations in these residues in EcSSB show a moderate effect on DNA binding. His55, a residue important for oligomerization, is replaced by Ile in HpSSB. However, mutation of His55 to Ile does not affect in vitro oligomerization of EcSSB [26].

Figure 1.

 Primary sequence analysis of HpSSB and biochemical properties. (A) The amino acid sequences of E. coli, B. subtilis and H. pylori were aligned using the clustalw multiple sequence alignment programme. *Identical residues; ‘:’ and ‘.’ indicate strongly and weakly similar residues, respectively. (B) Coomassie gel showing the expression and purification of His-tagged HpSSB. The molecular mass is shown on the right. (C) In vivo expression of HpSSB in H. pylori. The western blot shows the expression of HpSSB in H. pylori lysate using polyclonal antibodies raised against HpSSB. These antibodies also recognize the recombinant protein efficiently, whereas the pre-immune sera fail to recognize any such band. (D) Size exclusion chromatography of HpSSB. HpSSB protein, along with the marker proteins, was passed through the Amersham Superdex 200 gel filtration column followed by elution of the proteins. The molecular masses of the standard proteins were plotted on a logarithmic scale against the fraction numbers respective to their elution pattern. The molecular mass of HpSSB was deduced from the plot. (E) HpSSB shows a strong affinity towards ssDNA over dsDNA. M13mp18 ssDNA or pUC18 dsDNA alone or a mixture of both was incubated either in the absence or presence of a different amount of HpSSB followed by separation of the DNA–protein complex using agarose gel electrophoresis. The retardation pattern of the ssDNA reveals the binding of HpSSB with ssDNA but not with dsDNA. (F) Electrophoretic mobility shift assay to show the binding of HpSSB to the short radiolabeled oligonucleotide. The intensity of the shifted band increased with an increasing protein concentration before reaching a saturation point.

To purify recombinant HpSSB for biochemical characterization, the E. coli BL21 codon plus strain was transformed with pET28a-HpSSB construct, as described in the Experimental procedures, and the His-tagged fusion protein was purified using Ni-NTA agarose beads (Fig. 1B). The purified His6-HpSSB protein shows an apparent molecular mass of approximately 25 kDa, which is very close to the deduced molecular mass of untagged HpSSB (∼ 20 kDa).

Polyclonal antibodies were raised in mice using the purified His-HpSSB as antigens. These antibodies effectively recognized the purified HpSSB antigen (Fig. 1C). To prove that HpSSB is truly expressed in H. pylori, a western blot experiment was performed using the same antibodies against H. pylori bacterial lysate. A single band was detected in the lane containing bacterial lysate confirming the expression of HpSSB in H. pylori (Fig. 1C). There is a difference in the migration of the recombinant protein and the endogenous protein because the recombinant protein is His-tagged. The pre-immune sera under the same experimental conditions fail to recognize any band, suggesting the specificity of these antibodies (Fig. 1C).

EcSSB forms homotetramers in solution. The critical residue for EcSSB homotetramer formation (His55) is not conserved in HpSSB [26]. To investigate whether HpSSB forms homotetramers in solution, gel filtration analysis was performed using different marker proteins as standards followed by HpSSB. A standard curve was plotted using the log molecular mass values of various standard proteins against the fraction numbers of the proteins at which they are eluted (Fig. 1D). From this standard curve, the molecular mass of HpSSB was calculated to be approximately 80 kDa. These results suggest that HpSSB forms a tetramer in solution because the molecular mass of monomeric HpSSB is approximately 20 kDa.

Finally, we investigated the DNA-binding property of HpSSB. For this purpose, single-stranded M13mp18 DNA or double-stranded pUC18 DNA, or a mixture of both, was incubated in the absence or presence of different quantities of HpSSB followed by resolving the DNA–protein complexes using agarose gel electrophoresis (Fig. 1E). The band corresponding to the M13mp18 ssDNA is retarded significantly with an increasing amount of HpSSB protein, whereas pUC18 double-stranded DNA (dsDNA) band is not retarded at all under the same experimental conditions, indicating that HpSSB shows a strong affinity towards ssDNA compared to dsDNA. Furthermore, the affinity of HpSSB towards ssDNA was documented by performing gel retardation assay using a small oligonucleotide single-stranded radiolabeled probe. No shift was observed in the absence of HpSSB, whereas an increasing amount of HpSSB resulted in a more intense shifted band, finally reaching a saturation point due to the exhaustion of the free probe (Fig. 1F). The above results indicate that, although HpSSB shows some differences with EcSSB at the amino acid level, overall, HpSSB shows oligomeric properties and ssDNA binding activities similar to that of EcSSB.

Complementation of E. coliΔssb strain with HpSSB and in vivo localization of HpSSB in E. coli

Although HpSSB showed oligomerisation and ssDNA binding activity in vitro typical of SSB related proteins, we further analyzed its function as a true SSB homolog in vivo. For this purpose, we performed plasmid bumping experiments where we tried to replace an Ecssb containing plasmid (pRPZ150, ColE1 ori, TcR) in E. coli RDP317 (Δssb::kan) (a kind gift from U. Varshney, IISC, Bangalore, India) with plasmids (AmpR) containing either Ecssb or HpssbWt or HpssbΔC20 (deletion of 20 amino acid residues from the C-terminus) or pTRC vector (ColE1 ori, AmpR) alone where the above genes have been cloned [27]. The details of the bacterial strains and plasmid constructs are shown in Table 1. It is important to note that SSB is an essential protein. Therefore, if the incoming AmpR plasmids containing test SSB coding genes are capable of complementing the Δssb E. coli strain, TcR plasmids will show the TcS, AmpR phenotype. Using this strategy and Ecssb as a positive control, we found that continuous subculture of the bacteria in the media containing Amp and Kan but lacking Tc helps to replace the TcR plasmid with the incoming AmpR plasmid with greater than 90% efficiency. Similarly HpssbWt shows very high efficiency (∼ 87%) compared to that of HpssbΔC20 or vector alone control. The results are summarized in Table 2 and clearly indicate that Hpssb can complement E. coliΔssb strain in vivo. Moreover, the data suggest that the last twenty amino acid residues are important for in vivo function of HpSSB because HpssbΔC20 cannot complement the E. coli mutant strain. It is important to note that the amino acid residues at the extreme C-terminal residues of EcSSB have been reported to be essential because they may be involved in protein–protein interaction [24]. EcSSB, HpSSBWt and HpSSBΔC20 were expressed efficiently in the E. coli mutant strain as shown by SDS/PAGE and Coomassie staining of the bacterial lysate from the transformed cells (Fig. 2A).

Table 1.   Bacterial strains and plasmids.
Strain/plasmidGenotype/relevant characteristicsReference
DH10βF-mcrAΔ(mrr-hsdRMS-mcrBC)ϕ80lacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL nupGInvitrogen
pET28aT7, his, kanRNovagen
pET28a HpSSBWt and HpSSB ΔC 20pET28 a derivative containing 540 bp and 480 bp of H. pylori SSB full length and C-terminal deletion mutantThis study
pET28a HpDnaBpET28a derivative containing 1.5 kb of H. pylori dnaBSoni et al. [11]
pGEX-2T HpDnaBpGEX derivative containing 1.5 kb of H. pylori dnaBSoni et al. [12]
BL21 (DE3)F ± ompT hsdSB (rB ± mB) gal dcm (DE3)Novagen
E. coli RDP317 strainCarries a deletion in its chromosomal ssb gene (ssb::Kan) and a wild-type copy of the ssb gene on a support plasmid, pRPZ150 (ColE1 ori, TcR)Gift from U. Varshney (IISC, Bangalore, India)
pTRC E. coli SSB WtPlasmid expressing E. coli SSB ColE1 ori, AmpRGift from U. Varshney
pTRC HpSSBWt and HpSSB ΔC 20.Plasmid expressing HpSSBWt and ΔC20. ColE1 ori, AmpRThis study
pET28a HpSSB-mCherrypET28a derivative expressing fusion protein of Wt HpSSB and mCherryThis study
H. pylori 26695 Gift from A. Mukhopadhyay (NICED, Kolkata, India)
Table 2.   Complementation analysis of HpSSB. E. coli RDP 317 Δssb strain was transformed with various AmpR plasmids (as indicated) and, subsequently, they were grown in continuous subcultures in liquid media in the presence of Amp and Kan. Samples after four subcultures were streaked on agar plates and the resultant single colonies were further patched on agar plates containing Amp or Amp and Tc. The ability of the patches to grow on the different plates was monitored and the efficiency of plasmid replacement was counted. Amp, ampicillin; Tc, tetracyclin.
Test SSB genesNo. of colonies (Amp resistant)No. of colonies (Amp, Tc resistant)Efficiency of plasmid replacement Tc(R) to Tc(S) (%)
EcSSB60591
HpSSB60886.6
HpSSBΔC2052503.8
pTRC vector50500
Figure 2.

In vivo function of HpSSB. (A) Expression of EcSSB and HpSSB (wild-type and mutant forms) proteins in the E. coli SSB mutant strain was checked by SDS/PAGE analysis of bacterial lysate obtained from un-induced and IPTG induced bacterial culture in each case followed by Coomassie staining. *Position of the respective proteins. (B) Purification of His-HpSSB-mCherry protein. mCherry was fused with Wt HpSSB at the C-terminus in pET28a with a His6-tag as described in the Experimental procedures. The fusion protein was purified using Ni-NTA agarose and the quality of the protein was checked by SDS/PAGE and Coomassie staining. His-HpSSB is also shown. (C) DNA binding property of mCherry-HpSSB protein is shown as described earlier for the HpSSB protein. The arrowhead indicates the position of the ssDNA in the absence of SSB protein and the subsequent retardation of the band with an increasing amount of SSB is also shown. *Position of the double-stranded control DNA. (D) Localization of mCherry-HpSSB in growing E. coli cells. E. coli strain BL21 was transformed with pET28a vector containing mCherry-HpSSB and the bacteria culture was grown in liquid media in the presence of 0.1 mm IPTG. D600 was monitored at different time points and glass slides were made to check the fluorescence under the microscope from different growth phases. Bright red fluorescent spots were observed from cells obtained from the log phase of the growth (as indicated by arrowheads) but not from the stationary phase bacteria.

Complementation of E. coliΔssb strain using HpSSB ensures that it can take over EcSSB function in vivo. It has been shown recently using green fluorescent protein-SSB that replisome machinery containing replication proteins assemble at the replication origin [28]. To investigate whether HpSSB can take part in replisome machinery, we made a His-HpSSB-mCherry fusion construct where His-tagged HpSSB is fused at the N-terminus of fluorescent mCherry protein. The protein was expressed and purified from E. coli BL21 strain and the purified protein was used for DNA binding activity. mCherry-HpSSB shows DNA-binding activity that is similar to the Wt HpSSB, suggesting that the fusion of mCherry does not affect the DNA binding property of HpSSB (Fig. 2B,C). Subsequently, we performed in vivo localization experiments using either lag phase or log phase or stationary phase E. coli BL21 cells transformed with mCherry-HpSSB where the expression of mCherry-HpSSB could be induced using isopropyl thio-β-d-galactoside (IPTG) if required. The in vivo localization experiments to localize fluorescent mCherry proteins indicate that the expression of mCherry-HpSSB is poor in the majority of the lag phase cells, with somewhat diffused staining pattern (data not shown). Interestingly, the majority of the cells from the logarithmic phase show moderate expression of mCherry-HpSSB with distinct foci (Fig. 2D, upper panel). At the stationary phase of growth, these cells show expression of mCherry all over the cell without foci formation (Fig. 2D, upper panel). Green fluorescent protein-SSB fusion has recently been used to label replication forks in E. coli in time-lapse microscopy to demonstrate the dynamics of replication fork movement during a round of replication of the bacterial chromosome [28]. We strongly believe that these distinct foci are the replisome foci because the foci are not present in the bacteria from the control stationary phase. These results clearly indicate that HpSSB can take part in the replisome foci in E. coli, which is consistent with the complementation of EcSSB mutant strain with HpSSB.

Effect of HpSSB on HpDnaB enzymatic activity

We have shown that HpSSB is a true homolog of SSB both in vitro and in vivo. SSB interacts with many proteins at the replication fork and modulates their activities. One of these proteins is DnaB helicase whose activity can be modulated by SSB [22]. We have recently cloned, characterized, purified and performed structure–function analysis of the major replicative helicase DnaB from H. pylori [13]. We were interested to see whether HpSSB would modulate the enzymatic activities of HpDnaB.

One of the hallmarks of the replicative helicases is its DNA-dependent ATPase activity, which is central to the helicase activity because it provides energy for the DNA unwinding and forward translocation on the replication fork. We have recently shown that the ATPase activity of HpDnaB can be stimulated many times in the presence of ssDNA [13]. It has been reported that DNA-dependent ATPase activity of DnaB helicase can be inhibited in the presence of SSB protein [22]. We also found that the ssDNA-dependent ATPase activity of HpDnaB can be inhibited significantly in the presence of HpSSB (Fig. 3A,B). The inhibition of ssDNA-dependent ATPase activity of HpDnaB by HpSSB is likely to be due to the inability of DnaB to bind the SSB-bound DNA. EcSSB also shows an inhibitory effect on DNA dependent ATPase activity of EcDnaB when ssDNA is taken as substrate [22].

Figure 3.

 (A) Effect of HpSSB on ATPase activity of HpDnaB in the presence of ssDNA. The release of radiolabeled Pi from (γ-32P)ATP was monitored in the absence and presence of different concentrations of HpSSB in a mixture containing HpDnaB and ssDNA by thin-layer chromatography. The positions of ATP and released Pi are shown. (B) The amount of released Pi in each case was quantified using densitometric scanning and the values were plotted accordingly. (C) The effect of HpSSB on helicase activity of HpDnaB. The release of unwound oligo from radiolabeled substrate by HpDnaB was monitored in the absence and presence of different concentrations of HpSSB. (D) The amount of released oligo in each case was quantified using densitometric scanning and the values were plotted accordingly. (E) Co-precipitation of HpSSB and HpDnaB. The retention of HpSSB or HpDnaB alone or a mixture containing both the proteins in the pellet (P) and supernatant (S) fraction was monitored following ammonium sulfate precipitation and subsequent SDS/PAGE analysis. The positions of both the proteins are indicated. (F) GST pull-down experiments either using GST-HpDnaB or GST proteins in the presence of purified HpSSB proteins at a low salt concentration (50 mm NaCl) followed by washing the beads and SDS/PAGE and western blot analysis of the released proteins using anti-SSB sera. HpSSB binds specifically to HpDnaB but not to GST alone under the same experimental conditions.

Furthermore, we investigated the effect of HpSSB on the helicase activity of HpDnaB. For this purpose, the release of a radiolabeled 29 mer ssDNA oligo from an annealed substrate containing M13mp18 ssDNA was monitored using HpDnaB and different amount of HpSSB. We found that, initially, HpSSB stimulates the helicase activity of HpDnaB at a lower concentration. However, at a higher concentration of HpSSB, the helicase activity was inhibited completely (Fig. 3C,D). It is possible that, at a lower concentration of HpSSB, the released ssDNA from the annealed substrate may become stabilized following binding with HpSSB, thereby preventing rehybridization of the unwound oligo with the M13mp18 ssDNA. However, at a higher concentration of HpSSB, the excess multimeric HpSSB in the vicinity of fork structure may affect the loading of HpDnaB by preventing the access of HpDnaB to the fork structure.

Finally, we were interested in determining whether HpSSB has any affinity towards HpDnaB. We performed co-precipitation experiments in the presence of ammonium sulfate as described previously [29]. We found that HpSSB is precipitated completely in the presence of ammonium sulfate because most of it can be seen in the pellet fraction following precipitation and SDS/PAGE analysis. Interestingly, most of the HpDnaB can be found in the supernatant fraction following precipitation in the presence of ammonium sulfate under the same experimental conditions (Fig. 3E). However, when we performed co-precipitation experiments using both HpDnaB and HpSSB under the same experimental conditions, most of the HpDnaB was found in the pellet fraction along with HpSSB (Fig. 3E). These results suggest that HpSSB has an affinity towards HpDnaB that allows their coprecipitation.

Association of HpDnaB and HpSSB at high salt concentration indicates that these two proteins may have an affinity towards each other. To substantiate this issue further under more physiological conditions, we performed a pull-down assay using beads of glutathione S-transferase (GST)-HpDanB beads or GST alone in the presence of HpSSB protein. The pull-down experiments were carried out at a low salt concentration (50 mm NaCl) followed by washing the beads first using the binding buffer and, finally, at high stringency (300–500 mm salt concentration). The pull-down experiments indicate that HpSSB interact specifically with GST-HpDnaB but not with control GST protein under the same experimental conditions (Fig. 3F). Thus, association of HpDnaB and HpSSB both at the low and high salt concentrations suggests that these proteins may physically interact with each other. A similar interaction has been reported between replication restart helicase PriA and SSB protein in E. coli [23].

The interaction of SSB with DnaB helicase appears to be biologically relevant because the loading of the HpDnaB helicase may be facilitated by SSB bound to single-stranded moiety at the fork structure. In chromosomal DNA replication, initiation of Okazaki fragments requires SSB coating of the lagging strand; similar coating plays a critical function in the restart of paused replication forks where SSB–DnaB interactions might play critical, although yet undefined roles [22]. Unlike EcDnaB, HpDnaB does not require a helicase loader (EcDnaC) [12]. Hence, HpSSB might have a closer and more specific interaction with the HpSSB C-terminal that shows poor homology compared to that of the EcSSB C-terminal region.

Comparison of localization of replication proteins between the active helical bacillary form and the dormant coccoid form of H. pylori

As discussed earlier, H. pylori undergoes morphological transition from the spiral shape to the coccoid form under physiologically unfavorable conditions. It is reported that the coccoid form is the degenerate form of the bacteria leading to cell death [30]. There are also reports indicating the presence of bacterial enzymatic activities in the dormant form, suggesting the continuation of metabolic activity at this stage [31–33]. We compared the DNA replication machinery in H. pylori in the helical bacillary form and in the coccoid stage by attempting to detect and localize active replication forks. For this purpose, we used two independent markers of active growing replication forks (HpSSB and HpDnaB, respectively) and followed their localization pattern in the above two forms by immunofluorescence microscopy using specific antibodies against these markers. We obtained striking results, where the majority of the active bacillary forms show clear distinct foci of HpDnaB and HpSSB (wherever staining was obtained) that are the manifestation of active replication forks in these bacteria (Fig. 4A,B, upper panels). HpDnaB and HpSSB foci also co-localized completely with each other, confirming the presence of active replication forks in the bacillary form (Fig. 4C). These results also suggest that these proteins are the components of the replisome complex in vivo and validate our in vitro co-precipitation and pull-down results (Fig. 3E,F). Interestingly, the coccoid forms showed diffused staining pattern for both the proteins (Fig. 4A,B, lower panels). The absence of distinct replication foci in the coccoid forms clearly suggests that these forms are physiologically different from the bacillary form. It has been reported previously that the DNA content of the coccoid forms is very low compared to the bacillary forms [30]. Taken together, these results suggest that either very low or no DNA replication takes place in the coccoid forms.

Figure 4.

 Immunolocalization of HpDnaB and SSB proteins in H. pylori bacillary and coccoid forms. (A) Glass slides containing either the bacillary form (upper panel) or coccoid form (lower panel) were treated for immunofluorescence (as described in the Experimental procedures) using HpSSB antibodies (mice, 1 : 500 dilution) followed by FITC conjugated anti-mice sera as secondary antibodies. Green fluorescence was detected using a fluorescence microscope. (B) Localization of HpDnaB in the above two stages of H. pylori. HpDnaB antibodies (rabbit, 1 : 500) were used as primary antibodies and Alexafluor594 conjugated anti-rabbit sera were used as secondary antibodies. (C) Co-localization of HpDnaB and HpSSB proteins in the bacillary form. Both the HpDnaB and HpSSB antibodies were used in combination as primary antibodies. Alexafluor594 conjugated anti-rabbit and FITC conjugated anti-mice secondary sera were used in combination.

In summary, we have reported the functional characterization of the SSB protein from an important pathogen H. pylori. Although it shows divergence from the EcSSB at the key residues involved in DNA binding and oligomerization for EcSSB, surprisingly, it can complement an Ecssb mutant strain and is localized at the replisome containing growing replication fork in E. coli and also in H. pylori. Moreover, both DNA-dependent ATPase and helicase activity of HpDnaB can be modulated by HpSSB. Whether the modulation effect is due to the titration of ssDNA in the presence of HpSSB, or due to the possible interaction between the two proteins, remains to be elucidated. However, co-precipitation of HpSSB and HpDnaB, in vitro pull-down experiments and in vivo co-localization of these proteins in the bacillary form raise the possibility that these two proteins may have an affinity with each other. Finally, the absence of distinct replication foci in the coccoid form clearly indicates a physiological difference from the active bacillary form.

Experimental procedures

Bacterial strains

The bacterial strains and plasmids used in the present study are listed in Table 1. E. coli strains were grown in LB media (supplemented with 100 mg·mL−1 ampicillin or 50 mg·mL−1 kanamycin wherever needed) either at 37 or 22 °C, as required.

H. pylori culture

H. pylori strain 26695 was grown on brain heart infusion agar (Difco, Sparks, MD, USA) supplemented with 7% horse blood serum, 0.4% IsoVitaleX and the antibiotics amphotericin B (8 mg·mL−1), trimethoprim (5 mg·mL−1) and vancomycin (6 mg·mL−1). The plates were incubated at 37 °C under microaerobic conditions (5% O2, 10% CO2) for 36 h.

The coccoid form of H. pylori cells was obtained from the culture plates kept for prolonged periods of 10–14 days, as described previously [34,35], at 37 °C under the same conditions. The morphology of bacteria was observed under the microscope and cells from both the bacillary and coccoid form cultures were harvested and used for the immunofluorescence assay.

DNA preparation methods

E. coli plasmids DNA were prepared by the alkaline lysis method [36]. Bacteriophage M13mp18 single-stranded circular DNA was prepared as per the protocol described previously [37]. H. pylori genomic DNA was isolated from confluent culture grown on BHI agar using the cetyl trimethyl ammonium bromide-phenol method [38].

DNA manipulation

In the H. pylori genomic database, an ORF (HP1245) was annotated as the putative HpSSB homolog. The 540 bp long DNA fragment representing the ORF was amplified by PCR using H. pylori strain 26695 genomic DNA as template with forward and reverse primers having BamHI restriction sites using Pfu DNA polymerase. Similarly, a fragment with a deletion of 60 bp representing the last 20 amino acids at the C-terminus of the Hpssb gene was amplified by PCR.

The PCR-amplified HpssbWt (540 bp) and HpssbΔC20 (480 bp) DNA fragments were cloned in the expression vector pET28a (Novagen, Madison, WI, USA) at the BamHI site and subsequently sequenced. For the complementation assay, wild-type and HpssbΔC20 genes were subcloned from the respective pET28a recombinant clones into pTRC vector at the NcoI–HindIII restriction sites. For pET28a-HpSSB-mCherry constructs, the Hpssb gene was amplified using the same forward primer, but a reverse primer without a stop codon and with a SacI site, and cloned into pET28a at the BamHI–SacI site followed by cloning of PCR amplified mCherry gene from PRSET-B-mCherry [39] at the SacI–XhoI site [HpSSB full length forward BamHI, 5′-CG GGATCCATGTTTAATAAAGTGATTATGG-3′; HpSSB full length reverse BamHI,5′CG GGATCCCTTCATCAATATTGATTTCAGG-3′; HpSSBΔC20 reverse BamHI, 5′-CGGGATCCTCACTGTGCTTGTAAATTCTC-3′; SSB reverse SacI (without stop codon), 5′-CGAGCTC AAA GGG GAT TTC TTC TTC-3′; mCherry forward SacI, 5′-CGAGCTC ATG GTG AGC AAG GGC GAG-3′; mCherry reverse XhoI, 5′-CCGCTCGAG TTA CTT GTA CAG CTC GTC C-3′].

Purification of His-tagged Wt and ΔC20 HpSSB protein

E. coli strain BL21 (DE3) (Novagen) harboring pET28a HpSSB (Wt), ΔC20 SSB and SSB-mCherry constructs was grown at 37 °C in LB media containing 50 mg·mL−1 kanamycin. The bacterial cultures were induced for the expression of the recombinant proteins using 0.25 mm IPTG at 22 °C for 4 h. His-tagged proteins were purified using Ni-NTA agarose beads (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions. The eluted proteins were dialyzed against dialysis buffer containing 50 mm Tris–Cl (pH 7.5), 1 mm EDTA, 100 mm NaCl, 100 mm phenylmethanesulfonyl fluoride and 10% glycerol. For helicase and ATPase assays, HpSSB (Wt) and ΔC20SSB were dialysed against MonoQ and MonoS buffers and subjected to ion exchange chromatography using MonoQ and MonoS ion-exchange columns (GE Healthcare, Uppsala, Sweden) in accordance with the manufacturer’s instructions. The fractions of ion exchange chromatography were then checked on 10% SDS/PAGE and pooled and dialysed against dialysis buffer.

Protein concentrations were determined by the Bradford method (Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions with BSA as standard. Western blot analysis was carried out following standard procedures to check the proteins.

Agarose gel retardation assay

ssDNA binding activity of Wt HpSSB, ΔC20 and HpSSB-mCherry was checked by incubating the Wt and ΔC20 SSB protein in varying concentrations (0, 0.45, 0.9, 1.8, 2.7 and 3.6 μg, respectively) with 300 ng of M13mp18 single-stranded circular DNA and/or 300 ng of pUC18 double-stranded circular DNA in binding buffer (20 mm Tris–HCl, pH 8.0, 1 mm MgCl2, 100 mm KCl, 8 mm dithiothreitol, 4% sucrose and 80 μg·mL−1 BSA) in a 20 μL reaction mixture. After 30 min of incubation on ice, reaction mixtures were resolved in 0.7% agarose gel along with M13mp18 ssDNA alone, as a control. The increasing retardation of the nucleoprotein complex with increasing concentrations of SSB indicates the ssDNA binding activity of test proteins. BSA was taken as a negative control.

Electrophoretic mobility shift assay

Thirty-two nucleotide ssDNA oligo (CGGGA CCATGCGCCAAAAAATGCCTAAAGAC) from Microsynth (Balgach, Switzerland) was radiolabeled using (32P)ATP(γP) with the help of polynucleotide kinase enzyme and the purified labeled oligos were incubated in the absence or presence of HpSSB (20, 60, 100, 140 and 180 ng) in binding buffer (20 mm Tris–HCl, pH 8.0, 1 mm MgCl2, 100 mm KCl, 8 mm dithiothreitol, 4% sucrose, 80 μg·mL−1 BSA) for 30 min at room temperature (25 °C) and separated on a 6% native PAGE. The native gel was run at 150 V for 2 h in 1 × TBE buffer (Tris 89 mm, pH 8, boric acid 89 mm, EDTA 2 mm). The complex and the free DNA were visualized by autoradiography.

Oligomerization status

Wt HpSSB (500 μg) was subjected to size-exclusion chromatography on a Pharmacia Superdex 200 gel filtration column (Amersham Biosciences, Uppsala, Sweden) in a buffer containing 50 mm Tris–HCl (pH 7.4), 1 mm EDTA, 100 mm phenylmethanesulfonyl fluoride, 10% glycerol, 10 mmβ-mercaptoethanol and 100 mm NaCl. The column was previously calibrated using Pharmacia low- and high-molecular weight standards as indicated. Fractions (0.3 mL) were collected and checked for the presence of proteins by SDS/PAGE.

ATP hydrolysis assay

The ATPase activity of HpDnaB with and without SSB was measured in a reaction mixture (20 μL) containing 20 mm Tris–HCl (pH 8.0), 1 mm MgCl2, 100 mm KCl, 8 mm dithiothreitol, 4% sucrose, 80 μg·mL−1 BSA, 1 mm ATP, 3.4 fmol of (γ-32P)ATP and the required amount of DnaB (50 ng), along with 1 pmol of M13mp18 ssDNA and various concentrations of SSB. The reaction mixtures were incubated at 37 °C for 30 min and the reactions were stopped by putting the tubes on ice. Released inorganic phosphate (Pi) was separated by thin-layer chromatography on a poly ethylenemine cellulose strip (Sigma-Aldrich, St Louis, MO, USA) in 0.5 m LiCl and 1 m formic acid at room temperature for 1 h. The thin-layer chromatography plate was dried, autoradiographed and analyzed by a phosphorimager (Fuji®lm-BAS-1800; Fuji, Tokyo, Japan) for quantitation.

Helicase assay

The substrate for helicase assay was prepared by annealing a 29 mer oligo (5′-CCAAAACCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded circular DNA. This annealed substrate has a six bases long 5′ tail. Helicase assay was carried out in a 20 μL reaction mixture containing 20 mm Tris–Cl (pH 8.0), 8 mm dithiothreitol, 2.5 mm MgCl2, 2 mm ATP, 80 μg·mL−1 BSA, 10 mm KCl, 4% sucrose and 10 fmol of helicase substrate and the indicated amount of HpDnaB and HpSSB. HpDnaB protein (3.0 ng) was incubated in above buffer for 15 min (on ice) and then the indicated amount of HpSSB was added to the reaction. This mixture was incubated at 37 °C in a water bath for 30 min. The reaction was stopped by the addition of 5 μL of 5 × stop buffer (1.25% SDS, 75 mm EDTA, 25% glycerol) and the products were separated in 10% native gel (run in 0.5 × TBE). The gel was dried and exposed to X-ray film and the quantification was performed using a phosphorimager.

Complementation assay – plasmid bumping assay

E. coli RDP317 strain, in which the chromosomal ssb gene is replaced by a kanamycin resistance (ssb::Kan) marker and harboring a support plasmid pRPZ150 (ColEl ori, TcR) coding wild-type SSB protein was transformed with the pTRC HpSSB Wt or pTRC HpSSBΔC20 or pTRC vector alone. Transformants were grown in the presence of ampicillin (100 μg·mL−1) and kanamycin (25 μg·mL−1) in four consecutive subcultures in 5 mL of LB media, and then streaked on plain LB agar plates. The isolated single colony from the streaked plate was patched on LB agar plates containing ampicillin alone (100 μg·mL−1) and on plates containing both tetracycline (25 μg·mL−1) and ampicillin (100 μg·mL−1). The number of patches growing in both the plates was recorded and the plasmid replacement efficiency was calculated as a percentage. Because SSB is an essential protein, the original TcR plasmid can be replaced by the incoming AmpR plasmid only when it complements the function of Ecssb in vivo. The conversion of TcR strain into TcS AmpR phenotype shows that the HpSSB complements the Δssb strain of E. coli. The complementation ability is analysed in terms of the plasmid replacement efficacy of the E. coli mutant strain transformed with plasmid containing test genes [27]. The pTRCEcssb was used as a positive control whereas pTRC vector alone was used as a negative control to assess the efficacy of the experiment.

Replication foci study

E. coli BL21 (DE3) strain was transformed with pET28a HpSSB-mCherry construct and the transformants were grown in 100 mL of LB media containing Kanamycin (50 μg·mL−1) in the absence and presence of various concentration of IPTG (0.1–2 mm). At various time intervals, the cell growth was estimated by taking the value at D600 using a spectrophotometer. A 1 mL sample for each growth stages was collected and the cell pellets were resuspended in 100 μL of growth media. Some 10 μL of this cell suspension were placed on agarose gel slab (1% agarose gel slab in 0.9% NaCl or growth media) and covered by a coverslip. The cells were then observed under a Nikon fluorescent microscope (Nikon, Tokyo, Japan). The excitation and emission spectra for mCherry are 587 and 610 nm, respectively. Images were analysed for red fluorescence signals for a number of bacterial cells.

Co-precipitation experiments

HpSSB and HpDnaB (alone or a mixture containing both proteins) were precipitated in the presence of ammonium sulfate using a previously described protocol [29]. In brief, HpSSB or HpDnaB or both the proteins (10 μm each) were mixed in 20 μL of co-precipitation buffer (50 mm Tris–HCl, pH 7.5, 100 mm NaCl and 10% glycerol) and incubated on ice for 15 min. A solution of 20 μL of ammonium sulfate (250 g·L−1, final concentration 125 g·L−1) was added to the protein mixture and incubated on ice for another 15 min followed by centrifugation at 10 000 g for 1 min. Supernatant was collected separately and the pellet was washed three times with 50 μL of wash buffer (co-precipitation buffer plus 125 g·L−1 ammonium sulfate). Pellet and soup fractions were suspended in 2 × SDS/PAGE loading buffer and 20 μL of each was loaded on 10% polyacrylamide gel and stained with Coomassie brilliant blue.

GST pull-down assay

GST pull-down assays were performed by incubating purified His6-HpSSB (6 μg) in the presence of either GST-HpDnaB or GST proteins bound on glutathione beads in the binding buffer (20 mm Tris–HCl, pH 7.5, 1 mm dithiothreitol, 0.1% NP40, 5 mm MgCl2, 50 mm NaCl, 100 μm phenylmethanesulfonyl fluoride) at room temperature (25 °C) with gentle rotation. The beads were then washed three times with binding buffer containing 300 mm NaCl and the bound proteins were analysed by SDS/PAGE and western blotting.

Generation of HpSSB antibody

Polyclonal antibodies against His-HpSSB protein were generated in mice essentially following the protocol described previously [40]. The antibodies were tested for specificity by western blot analysis using standard protocols.

Immunofluorescence assays

H. pylori cells were harvested on poly-lysine coated glass slides and fixed with 4% paraformaldehyde in NaCl/Pi for 15 min at room temperature. Cells were then washed with NaCl/Pi and treated with 50 mm glucose, 20 mm Tris–HCl, pH 8.0, 10 mm EDTA, 2 mg·mL−1 lysozyme and 0.1% Triton X-100 for 1 h at 37 °C. Cells were further washed with 1 × NaCl/Pi and blocked with 2% BSA in 1 × NaCl/Pi. Cells were then incubated with primary antibodies (1 : 500 for anti-HpDnaB in rabbit and 1 : 500 for anti-HpSSB in mice) with 2% BSA in NaCl/Pi at 4 °C overnight. After washing with NaCl/Pi, cells were incubated with secondary antibodies [1 : 20 dilution for Alexafluor594 conjugated IgG antibodies raised in goat against rabbit IgG molecules and 1 : 20 dilution for fluoroscein isothicyanate (FITC) conjugated IgG antibodies raised in goat against mouse IgG molecules; Molecular Probes (Carlsbad, CA, USA) and Invitrogen (Carlsbad, CA, USA), respectively]. Cells were further washed with NaCl/Pi and 20% glycerol was used as the mounting medium. An Axioplan2 fluorescence microscope (Nikon) was used to capture images. For detection, a FITC filter was used (exciter 480/40 nm and emitter 535/50 nm). For detection of Alexafluor594, a suitable filter with an exciter range of 540–590 nm and an emission range of 600–650 nm was used. axiovision, release 4.6 (Nikon) software was used for analysis of the images.

Acknowledgements

This work was partially supported by an Indo-Swiss link grant (SIDA-VR No. 348-2006-6709) provided to S. D. and S. K. D. We acknowledge Dr Umesh Varshney (Indian Institute of Science, Bangalore, India) for providing the E. coli SSB mutant strain RDP317 and Dr Ashish Mukhopadhyay (National Institute of Cholera and Enteric Diseases, Kolkata, India) for his help in establishing H. pylori culture. A. S. acknowledges the University Grant Commission (UGC) as well as the Council of Scientific and Industrial Research (CSIR). R. G. and A. D. acknowledge UGC for fellowships. Dr Rahma Wehelie (Uppsala University, Sweden) is greatly acknowledged for providing the H. pylori culture for the immunofluorescence assay.

Ancillary