Dynamic association of MLL1, H3K4 trimethylation with chromatin and Hox gene expression during the cell cycle

Authors


S. S. Mandal, Department of Chemistry and Biochemistry, The University of Texas at Arlington, Arlington, TX 76019, USA
Fax: +1 817 272 3808
Tel: +1 817 272 3804
E-mail: smandal@uta.edu

Abstract

Mixed lineage leukemias (MLLs) are histone H3 at lysine 4 (H3K4)-specific methylases that play a critical role in regulating gene expression in humans. As chromatin condensation, relaxation and differential gene expression are keys to correct cell cycle progression, we analyzed the dynamic association of MLL and H3K4 trimethylation at different stages of the cell cycle. Interestingly, MLL1, which is normally associated with transcriptionally active chromatins (G1 phase), dissociates from condensed mitotic chromatin and returns at the end of telophase when the nucleus starts to relax. In contrast, H3K4 trimethylation mark, which is also normally associated with euchromatins (in G1), remains associated, even with condensed chromatin, throughout the cell cycle. The global levels of MLL1 and H3K4 trimethylation are not affected during the cell cycle, and H3Ser28 phosphorylation is only observed during mitosis. Interestingly, MLL target homeobox-containing (Hox) genes (HoxA5, HoxA7 and HoxA10) are differentially expressed during the cell cycle, and the recruitment of MLL1 and H3K4 trimethylation levels are modulated in the promoter of these Hox genes as a function of their expression. In addition, down-regulation of MLL1 results in cell cycle arrest at the G2/M phase. The fluctuation of H3K4 trimethylation marks at specific promoters, but not at the global level, indicates that H3K4 trimethylation marks that are present in the G1 phase may not be the same as the marks in other phases of the cell cycle; rather, old marks are removed and new marks are introduced. In conclusion, our studies demonstrate that MLL1 and H3K4 methylation have distinct dynamics during the cell cycle and play critical roles in the differential expression of Hox genes associated with cell cycle regulation.

Abbreviations
CGBP

human CpG-binding protein

ChIP

chromatin immunoprecipitation

DAPI

4′,6-diamidino-2-phenylindole

DEPC

diethylpyrocarbonate

H3K4

histone H3 at lysine 4

H3K9

histone H3 at lysine 9

HCF1

host cell factor 1

HMT

histone methyltransferase

Hox

homeobox-containing gene

MLL

mixed lineage leukemia

RNAP II

RNA polymerase II

Histone methyltransferases (HMTs) are key enzymes that post-translationally methylate histones and play critical roles in gene expression, epigenetics and cancer [1–11]. Mixed lineage leukemias (MLLs) are human HMTs that specifically methylate histone H3 at lysine 4 (H3K4) and are linked with gene activation [12–20]. Notably, Set1 is the sole H3K4-specific HMT present in yeast [21–23]. Humans encode six Set1 homologs: MLL1, MLL2, MLL3, MLL4, Set1A and Set1B [12,13,16,19,24–27]. Each of these proteins exists as multiprotein complexes sharing several common subunits, including Ash2, Wdr5, Rbbp5, human CpG-binding protein (CGBP) and Dpy30 [12–14,16,19,24–31]. MLLs are well known as the master regulators of homeobox-containing (Hox) genes that are critical for cell differentiation and development [13,32,33]. Although recent discoveries of HMT activities of MLLs have shed significant light into their complex function in gene regulation, their mechanism of action and distinct roles in different cellular events still remain elusive. The presence of multiple H3K4-specific HMTs in vertebrate genomes indicates that each of the MLLs may have specialized functions in regulating the differential expression of specific target genes or in the methylation of distinct nonhistone proteins for other functions.

Recent studies have indicated that MLLs may play a crucial role in cell cycle progression. For example, knockout of Taspase1, a protease that specifically cleaves and activates MLL1, results in the down-regulation of cell cycle regulatory cyclin genes by affecting H3K4 trimethylation in their promoters [26,34]. Furthermore, MLLs directly interact with the E2F family of transcription factors that are responsible for the activation of cyclins [26,35]. MLL1 interacts with E2F2, E2F4 and E2F6 with different affinities, whereas MLL2 interacts with a different subset of E2Fs, such as E2F2, E2F3, E2F5 and E2F6 [26,35]. Distinct interactions between E2Fs and MLLs suggest potential roles of MLL proteins in cell cycle regulation. Similarly, independent studies have shown that the MLL-interacting proteins menin, host cell factor 1 (HCF1) and CGBP are also implicated in cell cycle regulation [35]. Menin directly regulates the expression of cyclin-dependent kinase inhibitors, such as p27 and p18 [36,37]. Knockdown of HCF1 results in cell cycle arrest at G1. Therefore, both physical and functional interactions of MLLs with cell cycle regulatory proteins indicate potential roles of MLLs in cell cycle regulation.

Notably, chromatin condensation, decondensation and differential expression of cell cycle-associated proteins are critical for the correct progression and maintenance of the cell cycle. As MLLs and H3K4-specific methylations are well known to play critical roles in gene expression, we analyzed the dynamics and functions of MLLs and H3K4 methylation during cell cycle progression. Our results demonstrate that MLL and H3K4 trimethylation show different dynamics during cell cycle progression. MLLs dissociate and reassociate with condensed and relaxed chromatin, respectively, whereas H3K4 trimethylation marks remain associated with chromatins throughout the cell cycle. In addition, although the global levels of MLLs and H3K4 trimethylation are not affected, they are modulated at the promoters of specific genes over different phases of the cell cycle.

Results and Discussion

Dynamics of MLL1 and its interacting proteins during the cell cycle

Prior to the analysis of the dynamics of MLL and histone methylation, we synchronized HeLa cells at different phases of the cell cycle using double thymidine treatment, as described previously [38]. Briefly, cells were treated with 10 mm thymidine (18 h), released into fresh medium (9 h), blocked again by the addition of 10 mm thymidine (17 h) and finally released into fresh medium at the G1/S boundary. Cyclins B and E were used as markers for cell cycle synchronization. In agreement with previous studies, cyclin B was expressed prominently in the G2/M phase, whereas cyclin E expression was high in S and G1 phase, but low in G2/M phase (Fig. 1) [39].

Figure 1.

 Synchronization of cells. HeLa cells were synchronized using double thymidine treatment and released into the G1/S boundary, as described previously. Cyclins B and E were used as markers for cell cycle synchronization. Proteins at different phases of the cell cycle were analyzed by western blotting using anti-cyclin E and B sera. Actin was used as loading control.

In order to understand the dynamics of MLL1, we performed immunofluorescence staining of the synchronized HeLa cells with anti-MLL1 serum, and visualized its localization using fluorescence microscopy at different stages of the cell cycle. In agreement with our previous studies, we found that MLL1 was localized inside the euchromatic region [less intense 4′,6-diamidino-2-phenylindole (DAPI)-stained region] of the nucleus at the G1 phase of the cells (G1 phase, panels 1–3, Fig. 2) [12]. However, as the cell entered into mitosis and chromatin was condensed, most of the MLL1 protein was dissociated from the chromatin and spread into the cytoplasm, generating a distinct footstep (gap) for condensed chromatin (see metaphase, anaphase and early telophase stages, panels 1–3, Fig. 2). Notably, the spreading of MLL1 protein into the cytoplasm coincided with the disappearance of the nuclear membrane at the beginning of mitosis (Fig. S1, see Supporting information). Interestingly, at early telophase, when the cells were completely divided but the nuclei of the nascent daughter cells were yet to relax into euchromatin, MLL1 was present in the cytoplasm (early telophase, panels 1–3, Fig. 2). However, at later stages, MLL1 returned to the condensed chromatin, probably marking the initiation of chromatin relaxation (euchromatin formation) (late telophase, panels 1–3, Fig. 2).

Figure 2.

 Dynamics of MLL1 during the cell cycle. Synchronized HeLa cells (at different stages) were subjected to immunofluorescence staining with anti-MLL1 serum and visualized by immunostaining with FITC (green) conjugated secondary antibodies. Cells were costained with DAPI to visualize the DNA. Merge 1 shows the merge between DAPI and MLL1 images. Merge 2 shows the merge between DAPI and differential interference contrast images of the same cell.

Recently, Liu et al. [40] performed immunostaining experiments with anti-MLL1 serum using asynchronous HeLa cells. In contrast with our observations, they reported that MLL1 remains associated with condensed chromatins even during mitosis, but is degraded at late M (mitosis) and S phases. To address this apparent contradictory MLL1 distribution pattern in mitotic cells, we performed further immunostaining experiments with several MLL1-interacting proteins, such as CGBP, Ash2, Rbbp5, etc., using synchronized HeLa cells. Interestingly, each of these MLL-interacting proteins (CGBP, Ash2 and Rbbp5) was dissociated from mitotic chromatin, leaving a distinct gap in the mitotic cells in a very similar fashion to the MLL1 distribution (Fig. 3). Notably, in our studies, we also found the presence of these distinct gaps for MLL1 and interacting proteins in mitotic cells in a population of asynchronous cells (data not shown). These results indicate that MLL1 and its interacting proteins dissociate from mitotic chromatins, spread into the cytoplasm and coordinate in a similar fashion during the cell cycle.

Figure 3.

 Dynamics of MLL-interacting proteins. Synchronized HeLa cells at metaphase stage (mitosis) were subjected to immunofluorescence staining with anti-MLL1, anti-CGBP, anti-Ash2 and anti-Rbbp5 sera, and visualized by immunostaining with FITC (green) conjugated secondary antibodies. Cells were costained with DAPI to visualize the DNA. The merge panel shows the overlay between DAPI and FITC images.

H3K4 trimethylation marks are associated with mitotic chromatins

In contrast with MLL1 and its interacting proteins, H3K4 trimethylation marks behave differently during the cell cycle. Notably, like MLL1, H3K4 trimethylation is well known to be associated with transcriptionally active euchromatin [12,41]. Therefore, MLL1 and H3K4 trimethylation have been shown (by our laboratory and others) to be colocalized in the euchromatic regions of the nucleus, and this is probably because of their involvement in active gene expression [12,41]. Herein, in order to understand the dynamic association of H3K4 trimethylation with chromatin during the cell cycle, we performed immunofluorescence staining of HeLa cells with anti-H3K4 trimethyl serum at different stages of the cell cycle. The cell nucleus was counterstained and visualized using DAPI staining. As expected, in the G1 phase, H3K4 trimethylation marks were localized in the less intense DAPI-stained regions in the nucleus (representing less condensed euchromatin), leaving gaps in the more intense DAPI-stained regions (representing more condensed heterochromatin) (G1 phase, panels 1–3, Fig. 4). However, in contrast with MLL1, as the cells entered into mitosis and DNA was condensed, H3K4 trimethylation marks still remained associated with condensed chromatin and remained so throughout the cell cycle (panels 1 and 2, Fig. 4). As H3K4 trimethylation is well recognized as a mark for active chromatins, the existence of these marks, even in the highly condensed mitotic chromatin, was unanticipated. The contradictory association of MLL1 and H3K4 trimethylation marks indicates at least two different possibilities. H3K4 trimethylation marks that are introduced into transcriptionally active euchromatins at the G1 phase are not removed from histones and are carried over throughout the cell cycle. Secondly, even in condensed chromatin during mitosis, some genes remain transcriptionally active and these are marked by H3K4 trimethylation. Notably, the association of H3K4 trimethylation marks with mitotic chromatin has been observed previously by Valls et al. [42]. We analyzed H3K9 dimethylation as the mark of heterochromatin and, as expected, H3K9 methylation marks were found to be associated with heterochromatin throughout the cell cycle (panels 4–6, Fig. 4).

Figure 4.

 Dynamics of H3K4 trimethylation and H3K9 dimethylation during the cell cycle. Synchronized HeLa cells (at different stages) were subjected to immunofluorescnce staining with H3K4 trimethyl and H3K9 dimethyl antibodies, and visualized by immunostaining with rhodamine (red) conjugated secondary antibodies. Cells were costained with DAPI to visualize the DNA. Merge panels show the overlay between DAPI- and rhodamine-stained images.

MLL1 and H3K4 trimethylation levels remain unaffected whereas Hox genes are differentially expressed during the cell cycle

As MLL1 and H3K4 trimethylation show distinct dynamics during cell cycle progression, we analyzed the expression profiles of MLL1, CGBP, Ash2 and Rbbp5, together with cyclins E and B, as a function of the cell cycle. Western blot analysis of the whole-cell extract and histones from different stages of the cell cycle demonstrated that the overall levels of MLL1 and H3K4 trimethylation were unaffected throughout the cell cycle (Fig. 5). Similarly, MLL-interacting proteins, such as CGBP, Ash2 and Rbbp5, were unaffected during the cell cycle (data not shown). Notably, again, our observations showing the unaffected global level of MLL1 (protein level) during the cell cycle contradict the observations by Liu et al. [40], who demonstrated that MLL1 proteins were degraded during late M (mitosis) and S phases. However, in agreement with Liu et al. [40], using RT-PCR analysis, we observed that the expression of MLL1 at the mRNA level was increased from G1/S towards G2/M (Fig. S2, see Supporting information). Furthermore, to confirm cell synchronization, we analyzed the changes in phosphorylation level of H3Ser28, which is considered to be a marker for mitotic cells. Indeed, in agreement with previous studies, we found that H3Ser28 phosphorylation was only observed during mitosis, indicating correct cell cycle progression and synchronization (Fig. 5) [43,44]. These observations further support the fact that H3K4 trimethylation marks are maintained throughout the cell cycle, even in mitotically condensed chromatins. As the levels of MLL1 protein remained unaffected, we conclude that MLL proteins are not degraded during mitosis, but rather moved away from condensed chromatin towards the cytoplasm, generating the MLL1 gaps present in mitotic chromatin.

Figure 5.

 MLL1 expression and histone modifications during the cell cycle. Synchronized HeLa cells were collected at 2.5 h intervals after release at the G1/S boundary and subjected to whole-cell protein extract and histone purification. The protein extracts were analyzed using western blotting with antibodies specific to MLL1, Ash2 and CGBP. Actin was used as loading control. Histones were probed with anti-H3K4 trimethyl, anti-H3K9 dimethyl, anti-H4 acetylation and anti-H3S28 phosphorylation sera. Cyclin B and E expression and H3S28 phosphorylation were used as markers for cell synchronization. Coomassie stain for histone was used as loading control.

In contrast with MLL1 and H3K4 trimethylation levels, the MLL target Hox genes were differentially expressed during the cell cycle. We analyzed the expression profiles of three Hox genes, HoxA5, HoxA7 and HoxA10. HoxA5 is expressed at a low level at the beginning of the S phase and increases by approximately eight-fold as the cell progresses from S to G2/M (0–10 h); it then decreases to almost the initial level and remains so throughout mitosis and the G1 phase (Fig. 6A,B). In contrast, HoxA7 expression is low at the beginning (S phase) and increases gradually all the way from S to G2/M to G1 phases (0–20 h) (Fig. 6A,B). Interestingly, however, HoxA10 is only expressed in the beginning of S phase and shuts down almost completely for the remaining phases of the cell cycle (Fig. 6A,B). Cyclins B and E were used as markers, and their expression patterns were in agreement with previous studies and the results presented in Fig. 1.

Figure 6.

 (A) Hox gene expression during the cell cycle. Total RNA was isolated from HeLa cells at different phases of the cell cycle and analyzed by RT-PCR using primers specific to cyclin E, cyclin B, HoxA5, HoxA7 and HoxA10. Actin was used as loading control. (B) PCR products of Hox genes in (A) were quantified and plotted. Experiments were repeated thrice and the bars indicate the standard errors of the mean (SEMs). (C) ChIP experiments. HeLa cells were collected at S (0 h), M (10 h) and G1 (20 h) phases of the cell cycle (after synchronization), fixed with formaldehyde, sonicated and analyzed by ChIP assay using antibodies against RNAP II, H3K4 trimethyl and MLL1. The immunoprecipitated DNAs were PCR amplified using primers specific to the promoters of HoxA5, HoxA7 and HoxA10 genes. (D) The PCR products in (C) were quantified and the fold increase in ChIP PCR products compared with the control (input) was plotted for the respective Hox genes. Bars indicate SEMs. (E) Antisense-mediated knockdown of MLL1 and its effect on the expression of Hox genes. HeLa cells were transfected with MLL1 antisense or scramble phosphorothioate antisense for 48 h, and RNAs from the transfected cells were analyzed by RT-PCR using primers specific to MLL1, HoxA5, HoxA7 and HoxA10. Actin was used as loading control.

Recently, several studies have indicated that Hox genes may also be involved in cell cycle progression. For example, HoxA5 activates p53, which regulates the expression of p21, an inhibitor of cyclin-dependent kinases, which are critical for cell cycle progression. Furthermore, Bromleigh and Freedman [45] showed that HoxA10 directly upregulates the expression of p21, leading to cell cycle arrest at the G1 phase. Both p21 and p53 play a vital role in cell cycle regulation. Thus, although further studies are needed to elucidate the detailed functions of different Hox genes in cell cycle regulation, our studies showing the differential expression of HoxA5, HoxA7 and HoxA10 at different phases of the cell cycle indicate that these genes may have critical roles in cell cycle checkpoint regulation, probably via the involvement of p53 and p21.

MLL1 and H3K4 methylation are critical for Hox gene regulation during the cell cycle

In order to understand the molecular mechanism of the differential regulation of Hox gene expression, we analyzed the changes in H3K4 methylation and recruitment of MLL1 and RNA polymerase II (RNAP II) at the Hox gene promoters at different phases of the cell cycle using chromatin immunoprecipitation (ChIP) assay [12]. We performed ChIP analysis using anti-RNAP II, anti-MLL1 and anti-H3K4 trimethyl sera at three different phases of the cell cycle [0 h (S), 10 h (G2/M) and 20 h (G1)] after synchronized cells were released at the S phase. In the case of HoxA5, recruitment of RNAP II and MLL1, and the level of H3K4 trimethylation in the promoter, were low at S phase (0 h), increased by 1.7-fold at G2/M (10 h) and decreased again at G1 (20 h) (Fig. 6C,D). Notably, the enrichment of RNAP II, MLL1 and H3K4 trimethylation at the HoxA5 gene promoter at the G2/M phase was correlated with its expression profile (as shown in Fig. 6A,B), indicating the importance of MLL1 and H3K4 trimethylation in HoxA5 gene regulation during cell cycle progression. The association of a certain amount of RNAP II with the HoxA5 gene promoter at 20 h (although much lower in comparison with that at 10 h) indicates that a certain amount of basal transcription still continues at this stage of the cell cycle. Similar to HoxA5, the occupancy of RNAP II, MLL1 and H3K4 trimethylation in HoxA7 and HoxA10 gene promoters was also correlated with their respective expression profiles (compare Fig. 6A,B with Fig. 6C,D). In the case of the HoxA7 gene promoter, the recruitment of RNAP II and MLL1 and the level of H3K4 trimethylation were low at the beginning (S phase) and gradually increased as the cell progressed from S to G2/M to G1, reaching a maximum at G1 (20 h) (Fig. 6C,D). In the case of the HoxA10 gene, significantly higher levels of RNAP II and MLL1 recruitment and H3K4 trimethylation marks were observed at the beginning of the S phase (0 h), and these marks were attenuated for the rest of the cell cycle (10 and 20 h), correlating with the expression of the gene (Fig. 6C,D). The correlation of promoter occupancy of MLL1, H3K4 trimethylation and RNAP II with Hox gene expression indicates the critical roles of MLL1 and H3K4 trimethylation in differential Hox gene expression during the cell cycle. To further confirm the importance of MLL1 in the regulation of HoxA5, HoxA7 and HoxA10 genes and cell cycle progression, we knocked down MLL1 using a specific antisense oligonucleotide and analyzed the expression of Hox genes and cyclins. As shown in Fig. 6E, the knockdown of MLL1 down-regulated the expression of HoxA5, HoxA7 and HoxA10 genes. Notably, HoxA5 expression was almost completely abrogated, whereas HoxA7 and HoxA10 were only partially down-regulated. The partial down-regulations of HoxA7 and HoxA10 on knockdown of MLL1 indicate that, in addition to MLL1, other alternative factors may regulate their expression. Notably, cyclins B and E were also down-regulated in an MLL1 knocked down environment (data not shown).

To confirm further the role of MLL1 in cell cycle regulation, we examined the effects of knockdown of MLL1 on cell cycle progression using flow cytometry analysis. Briefly, HeLa cells (at 60% confluence) were transfected with MLL1-specific antisense oligonucleotide for 24 h, stained with propidium iodide and analyzed using a flow cytometry analyzer. Interestingly, as shown in Fig. 7, on treatment with the MLL1 antisense oligonucleotide, the cell population at the G2/M phase increased from 3.5% (control) to 19.7% (antisense treated). Notably, application of the scramble antisense oligonucleotide (with no homology to MLL1) also led to a slight increase in the G2/M cell population (to 7%) in comparison with the control. The MLL1 antisense-mediated increase in the cell population at the G2/M phase indicated that knockdown of MLL1 resulted in cell cycle arrest at the G2/M phase. These observations further confirmed the significant role of MLL1 in cell cycle progression.

Figure 7.

 Knockdown of MLL1 induces cell cycle arrest at G2/M phase. HeLa cells were treated with MLL1 and scramble antisense separately for 24 h, and subjected to flow cytometry analysis. (A) Control cells treated with no antisense. (B) Cells treated with phosphorothioate scramble antisense (no homology to MLL1). (C) Cells treated with MLL1-specific antisense. The cell populations at different stages of the cell cycle are shown inside the respective panels.

Our results demonstrate that MLL1 and H3K4 trimethylation show different dynamics during the cell cycle. MLL1, which is well known for transcription activation, remains associated with transcriptionally active chromatin (euchromatin), dissociates from condensed mitotic chromatin and returns at the end of telophase when the nucleus starts to relax. In contrast, H3K4 trimethylation marks, which are marks for gene activation, remain associated with euchromatin in the G1 phase and even with condensed chromatin throughout the cell cycle. The global levels of MLL1 protein and H3K4 trimethylation are not degraded or removed from the cells during mitosis, but H3Ser28 phosphorylation is only observed during mitosis. However, the recruitment of MLL1 and the level of H3K4 trimethylation are modulated in the promoters of specific Hox genes as a function of their expression. Importantly, as we observed that H3K4 trimethylation fluctuates at specific gene promoters, we hypothesize that the H3K4 trimethylation marks that are present in S phase may not be the same as the marks in other phases of the cell cycle (as shown by immunofluorescence staining and western blotting); rather, old marks are removed and new marks are introduced, at least in some of the promoters. Furthermore, although we observed distinct gaps for MLL1 (as well as its interacting proteins) in immunofluorescence staining experiments in the region of mitotically condensed chromatin, ChIP experiments demonstrated that MLL1 is still bound to the promoters of active Hox genes even during mitosis. These observations indicate that a certain amount of MLL1 protein is still associated with chromatin even during mitosis, although most of the proteins migrate away from chromatin.

Our studies also demonstrate that Hox genes (HoxA5, HoxA7 and HoxA10) are differentially regulated during the cell cycle and MLL1 occupancy at the Hox gene promoter fluctuates as a function of Hox gene expression. Notably, HoxA5 has been shown to activate p53, which regulates the expression of the cyclin-dependent kinase inhibitor p21 [46]. Similarly, HoxA10 is known to upregulate p21, leading to cell cycle arrest at the G1 phase in both monocytic and fibroblast cell lines [45]. Thus, it is possible that HoxA5, similar to HoxA10, regulates the cell cycle via p53 and p21 channels. Similar to the Hox gene, MLLs have also been shown to interact with the E2F family of proteins and to regulate cell cycle regulatory genes, including cyclins [26]. Thus, our results and independent observations from different laboratories indicate that both MLL1 and Hox genes are critical players in cell cycle progression. Although further studies are needed to understand the detailed roles of MLLs and different Hox genes in cell cycle regulation, our studies demonstrate distinct dynamics and the importance of MLL1, H3K4 methylation and selected Hox genes during cell cycle progression.

Experimental procedures

Cell culture and synchronization

HeLa cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with heat-inactivated fetal bovine serum (10%), l-glutamine (1%) and penicillin/streptomycin (0.1%), as described previously [12,47,48]. Cells were synchronized at G1/S phase using double thymidine treatment, as described previously [38,49]. Briefly, cells were grown in a 10 cm tissue culture plate up to 25% confluence, treated with 10 mm thymidine (Sigma, New York, NY, USA) for 18 h, released into fresh medium for 9 h and blocked again by the addition of 10 mm thymidine for an additional 17 h. Finally, the cells were released into fresh medium at G1/S phase and analyzed at 2.5 h intervals.

Preparation of whole-cell extract, histones and western blotting

HeLa cells (10 cm plates) were harvested, incubated with 200 μL of whole-cell extract buffer (50 mm Tris/HCI, pH 8.0, 150 mm NaCl, 5 mm EDTA, 0.05% NP-40, 0.2 mm phenylmethanesulfonyl fluoride, 1× protease inhibitors) on ice for 20 min and centrifuged (10 000 g for 10 min). The supernatant was used as whole-cell extract and the pellet was used for histone purification, as described previously [49]. The whole-cell protein extracts and histones were analyzed by western blotting using anti-MLL1 (Bethyl Laboratories, Montgomery, TX, USA), anti-Set1 (Bethyl Laboratories), anti-Ash2 (Bethyl Laboratories), anti-Rbbp5 (Bethyl Laboratories), anti-CGBP (IMGENEX, San Diego, CA, USA), anti-cyclin B (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-cyclin E (Santa Cruz Biotechnology), anti-H3K4 trimethyl (Upstate Biotech, Waltham, MA, USA), anti-H3S28 phosphoryl (Upstate Biotech) and anti-H3K9 dimethyl (Upstate Biotech) sera.

RNA purification and RT-PCR

For RNA purification, cells were resuspended in 200 μL of diethylpyrocarbonate (DEPC)-treated buffer A (20 mm Tris/HCl, pH 7.9, 1.5 mm MgCl2, 10 mm KCl, 0.5 mm dithiothreitol, 0.2 mm phenylmethanesulfonyl fluoride), incubated on ice (10 min) and centrifuged at 3500 g for 5 min. The supernatant (cytoplasmic extracts) was subjected to phenol–chloroform extraction, followed by ethanol precipitation, to obtain cytoplasmic mRNAs. mRNA was washed with DEPC-treated 70% ethanol, air dried, resuspended in DEPC-treated water, quantified and subjected to RT-PCR. RT reactions were performed in a total volume of 25 μL containing 1 μg of total RNA, 2.4 μm of oligo-dT, 100 U of MMLV reverse transcriptase (Promega, Madison, WI, USA), 1× first strand buffer (Promega), 100 μm dNTPs, 1 mm dithiothreitol and 20 U of RNaseOut (Invitrogen, Carlsbad, CA, USA). This cDNA (1 μL) was PCR amplified with the specific primer pairs listed in Table 1.

Table 1.   Nucleotide sequences of the primers used in PCR and ChIP analyses.
TranscriptForward primer (5′- to 3′)Reverse primer (5′- to 3′)
  1. a Primer pairs specific to promoters of respective genes.

MLL1GAG GAC CCC GGA TTA AAC ATGGA GCA AGA GGT TCA GCA TC
Ash2CCT GAA GCA GAC TCC CCA TAAGC CCA TGT CAC TCA TAG GG
Rbbp5GCA TCC ATT TCC AGT GGA GTTGG TGA CAT CCA CTT CCT CA
CGBPGCC ACA CGA CTA TTC TGT GACAG TAA TGG CGA TTG CAC TG
Cyclin ETTTCAGGGTATCAGTGGTGCGACAACA ACA TGG CTT TCT TTG CTC GGG
Cyclin BTTG ATA CTG CCT CTC CAA GCC CAATTG GTC TGA CTG CTT GCT CTT CCT
HoxA5GGC TAC AAT GGC ATG GAT CTGCT GGA GTT GCT TAG GGA GTT
HoxA7TTC CAC TTC AAC CGC TAC CTTTC ATC ATC GTC CTC CTC GT
HoxA10CCA TAG ACC TGT GGC TAG ACG GAG ACT TTG GGG CAT TTG TC
HoxA5 (P)aAGT AAG TCC CGA AGG GCA TCGAG AGA CTG GGC TCT GTT GG
HoxA7 (P)aGAG CCT CCA GGT CTT TTT CCACA CCC CCA GAT TTA CAC CA
HoxA10 (P)aCTC CTG GCC CAT CAA TAC AGTAG CCC TTT CTG GCT GAC AT
ActinAGA GCT ACG AGC TGC CTG ACGTA CTT GCG CTC AGG AGG AG

Immunofluorescence studies

HeLa cells were grown on cover slips, synchronized, fixed in 4%p-formaldehyde, permeabilized with 0.2% Triton-X100, blocked with goat serum, incubated (1 h) with the respective primary antibodies (MLL1, CGBP, Ash2, Rbbp5, H3K4 trimethyl and H3K9 dimethyl antibodies), washed and incubated with fluorescein isothiocyanate (FITC) or rhodamine (Jackson Immuno Research Laboratories, West Grove, PA, USA) conjugated secondary antibodies. Nuclear counterstaining was performed with DAPI. Immunostained cells were mounted and observed under a fluorescence microscope (Nikon Eclipse TE2000-U; Nikon, Melville, NY, USA).

Antisense-mediated knockdown of MLL1 and ChIP assay

HeLa cells were transfected with MLL1-specific phosphorothioate antisense oligonucleotide (5′-TGCCAGTCGTTCCTCTCCAC-3′) using commercial Maxfect transfection reagent, following the manufacturer’s instructions (MoleculA, Columbia, MD, USA). A scramble antisense oligonucleotide without any sequence homology with MLL1 (5′-CGTTTGTCCCTCCAGCATCT-3′) was used as control. For ChIP assay, HeLa cells (collected at 0, 10 and 20 h after synchronization) were fixed with 1% formaldehyde, washed, resuspended in lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris/HCl, pH 8, 1× protease inhibitors and 0.2 mm phenylmethanesulfonyl fluoride), sonicated until chromatin was sheared to an average DNA fragment length of 0.2–0.5 kb and subjected to ChIP assay as described previously [12].

Flow cytometry analysis

HeLa cells were grown to 60% confluence and transfected with MLL1 and scramble antisense oligonucleotides separately using Maxfect transfection (MoleculA) reagents, and incubated for 24 h. Control and transfected cells were harvested, fixed in 70% ethanol for 2 h, washed twice with 1× NaCl/Pi and stained with propidium iodide (final concentration, 0.5 μg·mL−1). The cells were analyzed by flow cytommetry, using a Fusing Beckman Coulter (Fullerton, CA, USA) Cytomics FC500 Flow Cytometry Analyzer.

Acknowledgements

We thank Saoni Mandal and Mandal laboratory members for critical discussions. This work was supported by grants from the Texas Advanced Research Program (00365-0009-2006) and the American Heart Association (SM 0765160Y).

Ancillary