SEARCH

SEARCH BY CITATION

Keywords:

  • cardiac metabolism;
  • nuclear factor of kappa light polypeptide gene enhancer in B cells;
  • nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor alpha gene;
  • peroxisomal proliferator response elements;
  • peroxisome proliferator-activated receptors

Abstract

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and methods
  6. Acknowledgements
  7. References

The purpose of this study was to provide a better understanding of the regulatory role of the nuclear steroid receptor on the nuclear factor of kappa light polypeptide gene enhancer in B cells (NFκB) in mouse heart. NFκB regulates many nuclear genes and has been associated with many human cardiac diseases. NFκB’s protein regulator gene, nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor alpha gene (IκBα), was found in this study to be regulated by peroxisome proliferator-activated receptors (PPARs). PPARs, retinoid X receptors (RXRs) and thyroid hormone receptors (THRs) are members of the nuclear receptor superfamily, which consists of a large number of transcription factors whose activities are regulated by their cognate ligands. These steroid hormone receptors are important regulators of gene expression and differentiation in the heart. These receptors form homo-(RXR, THR) and hetero-(PPAR–RXR, RXR–THR) dimers that bind DNA at various response elements (PPAR, RXR and THR) in the promoter regions of target genes. The PPAR/RXR response elements in the promoter of IκBα are described in this article. A known PPAR activator (Wy14643) and dimethylsulfoxide (vehicle) were introduced into control (FVB) and δ337T thyroid hormone receptor (TRβ) transgenic mice. The δ337T TRβ transgenic mouse has a resistance to the thyroid hormone (RTH) phenotype. Affymetrix 430_2 chip gene expression was examined for four study groups (control, control with Wy14643, δ337T TRβ and δ337T TRβ with Wy14643), consisting of seven mice each. IκBα mRNA expression in the Wy14643 control and in transgenic mice was upregulated significantly in microarray (P < 0.05) and quantitative RT-PCR (P < 0.01) analyses. The increase in mRNA level was also accompanied by an increase in IκBα protein in cells, as measured by Western blot analysis. Duplex oligo-DNAs containing the putative PPAR/RXR motif (AGGTCA/TCCAGT) from the IκBα promoter were used in gel shift assays to verify the binding of PPAR and RXR to their response elements. pGL4.0 [Luc] constructs of the IκBα promoter, with and without the PPAR/RXR motifs, were co-transfected with mouse PPAR α, β and γ1 into HepG2 cells and used in luciferase assays to verify gene activation. In conclusion, our study revealed that PPAR regulates the mouse cardiac IκBα gene in both control and transgenic mouse heart. The implications of this finding are discussed in relation to possible changes in cardiac function.

Abbreviations
GAPDH

glyceraldehyde-3-phosphate dehydrogenase

IκBα

nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor alpha gene

NFκB

nuclear factor of kappa light polypeptide gene enhancer in B cells

PPAR

peroxisome proliferator-activated receptor

PPRE

peroxisomal proliferator response element

RAR

retinoic acid receptor

RE

response element

RTH

resistance to the thyroid hormone

RXR

retinoid X receptor

THR

thyroid hormone receptor

TSS

transcription start site

The nuclear factor of kappa light polypeptide gene enhancer in B cells (NFκB) is responsible for regulating a large number of nuclear genes, including cytokines/chemokines, immunoreceptors, cell adhesion, growth and transcription factors, viruses and enzymes [1,2], and is consequently associated with many human diseases, such as asthma, cardiac hypertrophy, chronic heart failure, diabetes (types 1 and 2), heart and pulmonary disease, and parathyroid and thyroid cancer [3–5]. The transcription protein NFκB is associated with oncogenesis and apoptosis [6] and has been studied extensively in recent years. NFκB is most frequently composed of two DNA-binding subunits, p50- and p65-kDa, which exist as an inactive form in the cytoplasm when bound to the inhibitory protein IκB. Most agents that activate NFκB employ a common pathway mediated by the IκB kinase signaling complex based on the phosphorylation of the two NH2-terminal serines in IκB, resulting in subsequent ubiquitination and degradation of these proteins by the 26S proteasome [7]. The free NFκB dimers (p50 : p65) translocate to the nucleus and regulate gene transcription by binding to target sequences in regulatory regions of NFκB-regulated genes. In unstimulated cells, NFκB is sequestered in the cytoplasm by inhibitor molecules of the IκB family (α, β and ε).

Three members of the steroid hormone receptor superfamily have been studied with regard to their role in the regulation of NFκB’s inhibitor protein IκBα in mouse heart. Peroxisome proliferator-activated receptors (PPARs), retinoid X receptors (RXRs) and thyroid hormone receptors (THRs) are members of the family and are involved in nuclear and mitochondrial gene regulation [8–10]. PPARs are lipid-sensing transcription factors that have a role in embryonic development, but are primarily known for the modulation of energy metabolism, lipid storage and transport, as well as inflammation and wound healing [11]. PPARs consist of three different isotypes α, β and γ, which, in turn, heterodimerize with the α, β and γ isotypes of the 9-cis-retinoid X receptor for binding to peroxisomal proliferator response elements (PPREs) in the promoter regions of target genes involved in energy metabolism [12]. RXRs play a role in diverse physiological processes, including cell proliferation, differentiation, metabolism and apoptosis [13]. Thyroid hormone (T3) and its transcription factors (THRs) are critical for growth, differentiation, development and maintenance of metabolic homeostasis [14]. PPARs bind to a direct repeat of two divergent half-sites (AGGTCA), spaced by one or two nucleotide (DR1 or DR2) motifs, and can only bind DNA as heterodimers with RXRs. These heterodimers regulate several genes [15–19]. Retinoic acid receptor/RXR-response elements (RAR/RXR-REs) are direct repeat REs composed of two half-sites (TGACCT) [20], which represent the complementary DNA sequence of canonical PPREs. A recent study has coalesced the great diversity of PPREs in the promoter regions of various genes [21], and has reported the degeneracy of these elements through evolution and speciation [22,23]. This degeneracy most probably results from the inability of PPARs to bind REs by themselves, and the required heterodimerization with retinoid receptors, whose RE requirements have been more conserved throughout evolution [12,24]. THRs bind hexamer half-sites (AGGTCA) with degeneracy in sequence and orientation to the regulatory regions of their target genes [25,26]. They bind as either monomers to a half-site or homodimers to a full-site (AGGTCAAGGTCA), but can also bind as heterodimers with PPAR and RXR [18,27,28]. In a recent study, the relationship between a dominant negative THRβ and PPAR signaling in mouse heart was described [29]. From that study, it was found that PPAR significantly upregulated the IκBα gene, but had no effect on the IkBβ and IkBε genes in mouse heart. In a more detailed investigation of this finding, it is reported here that the PPAR/RXR-RE complement motifs (AGGTCA/TCCAGT) from the promoter region of the IκBα mouse gene have been identified as PPRE/RXR-REs for the binding sites of these nuclear receptors.

Results

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and methods
  6. Acknowledgements
  7. References

THR mutants inhibit normal binding in the regulatory region of their target genes and can alter metabolism through the interaction of heterodimer formation with other nuclear receptors, such as RXR and PPAR. THRβ mutants exhibit reduced affinity for their ligand and/or impair interaction with one or more of the cofactors involved in transcription control of THR-regulated genes. In this study, the δ337T TRβ transgenic mouse model was used. The δ337T TRβ single amino acid deletion abrogates ligand binding and transforms the THRβ receptor into a constitutive repressor. It is important to determine what effect this has on PPAR activation. A known PPARα activator (Wy14643) was introduced into control and transgenic mice, followed by an examination of mouse heart gene expression using Affymetrix microarrays [29]. The study revealed no significant gene expression differences between the untreated Wy14743 control (FVB) and transgenic (δ337T TRβ) mice for the IκB family (α, β and ε), as illustrated by the quantitative RT-PCR data for the IκBα gene (Fig. 1). However, the study also revealed that mice treated with Wy14643 displayed a significant upregulation of the IκBα gene member in heart (Fig. 1, Table 1), indicating a PPAR-binding site somewhere in the promoter region of the IκBα gene.

image

Figure 1.  Cardiac expression of IκBα in Wy14643 (WY) treated, untreated control (Con) and δ337T TR transgenic (Trans) mice. Treated mice received an intraperitoneal injection with a mixture of saline, dimethylsulfoxide and WY14643, and control mice received an injection of vehicle (dimethylsulfoxide) and saline. Hearts were extracted 6 h after treatment and IκBα expression was determined by quantitative RT-PCR. Results are the mean ± standard error of the mean. Differences were evaluated by Student’s t-test.

Download figure to PowerPoint

Table 1.   Five unpublished IκBα mouse mRNA expression results obtained from an Affymetrix mouse expression 430_2 gene chip array study [29]. Listed are the IκBα log2 mean expression intensities of seven mouse hearts per group and the permutation P values of drug effect (mouse versus drug), which show a significant difference between mice untreated and treated with the PPARα agonist Wy14643 (P < 0.05). Also listed are the fold changes (Wy14643 treatment/no treatment), where a value greater than unity indicates the upregulation of IκBα.
Gene symbolRepresentative public ID log2 mean controllog2 mean contl + Wy14643 log2 mean TR337log2 mean TR337 + Wy14643Permutation P value Wy14643 effectDrug fold change
IκBαNM01090710.44610.98310.40210.8950.0341.429
IκBαBB09684310.74111.14610.6711.1120.0241.341
IκBαAI46201510.84111.1710.73511.1850.061.31
IκBαAI46201512.40712.72712.41512.6650.0481.218
IκBαAI4620157.6577.9167.6167.9040.0141.208

To study the molecular mechanism by which PPARα regulates the IκBα gene, a computer analysis search was conducted to look for PPRE/RXR-RE AGGTCA/TCCAGT motif sequences in the human and mouse promoter regions of this gene (Table 2). AGGTCA/TCCAGT motif sequences were identified in this region that could potentially serve as PPRE/RXR-RE sites in the human and mouse gene. In order to identify which of these sequences act as RE site(s), gel shift and transactivation assays were undertaken. The gel shift experiments indicated that, in the presence of PPARα or RXRα only, a single complex was observed, which originated from the reticulocyte lysate (Fig. 2). An additional more intense complex was observed only in the presence of both receptors, indicating that PPAR–RXR together bind their respective REs at the same time. This complex disappeared in the presence of an excess of unlabeled specific oligonucleotide, but not completely for the nonspecific oligonucleotide (Ets). The PPAR–RXR complex did not bind to an oligonucleotide that contained two nucleotide substitutions within the IκBα PPRE. Similar results were observed for PPARγ (Fig. 2). These results indicate that PPARα and PPARγ are able to bind to the −2185 and −3173 bp AGGTCA/TCCAGT motif sequences in vitro, thereby establishing them as putative mouse IκBα promoter REs. This hypothesis was also verified when luciferase transactivation assays were carried out on human IκBα promoter constructs containing these AGGTCA/TCCAGT motifs (Fig. 3). To determine which promoter region is responsible for the PPAR-induced upregulation of IκBα expression, 0.29, 1.1, 1.9 and 2.6 kb fragments of the promoter immediately upstream of the transcription start site (TSS) were cloned in front of a luciferase reporter (pGL4), and transactivation studies were carried out in HepG2 cells (Fig. 3A). PPARα and Wy14643 increased reporter activity for the 0.29, 1.1 and 1.9 kb pGL4 constructs, but showed no or little effect in the larger 2.6 kb construct, indicating that the PPRE located between −1900 bp upstream and the TSS supports the mouse IκBα gel shift data as PPAR activator of this gene (Figs 2 and 3). In this region, two sequences were identified which are relatively conserved between the human and mouse IκBα promoters, suggesting that this region is important for regulation (Fig. 3B). Although the PPARα activator Wy14643 was the only agonist used in this study, we found that it also activated PPARβ and PPARγ, because it increased reporter activity in the three pGL4 constructs as it did for PPARα (Fig. 3C).

Table 2.   PPAR-RE and RAR-RE sites (in bold) within the mouse (m) and human (h) promoter regions of the IκBα gene, as well as the response elements in the promoter regions for the mGOs2, hUCP3, hACOX1 and mPCK1 genes, which have been reported previously. Listed are the number of PPAR/RAR sites found between −5 and 2.5 kb of the transcriptional start site of each gene. The PPAR/RAR sites were obtained using the Invitrogen vector nti advance 10 program.
Gene symbolReference sequence (ID)PPAR/RAR (AGGTCA/TCCAGT)Response elements sequence (5′- to 3′)Reference
No. of sitesLocation from start site
mIκBαNM_0109077−3173AGCACTCAGGAGGTCAAGGCTGGCTGTGACC[This study]
    TCGTGAGTCCTCCAGTTCCGACCGACACTGG 
   −2185TGTTGCCCATATTGACCTCAAACTAGGCTA[This study]
    ACAACGGGTATAACTGGAGTTTGATCCGAT 
hIκBαNM_0205298−1795AAAAAAGTTAACTGACCTCTCCAACTAATG[This study]
    TTTTTTCAATTGACTGGAGAGGTTGATTAC 
   −1000CGGGAGCACAATGTAGGTCAGATAGCATAA[This study]
    GCCCTCGTGTTACATCCAGTCTATCGTATT 
mGOs2NM_00805912−1796TGCATCAGTGACCTTTGCAATTTTCTGG[39]
    GTCACTGGAAACGTTAAAAGACCGGTC 
hUCP3NM_02280310−3519TGACATTAAGGTCA[40]
    ACTGTAATTCCAGT 
   −2305TTGACCTTTGGACT[40]
    AACTGGAAACCTGA 
   −2084AGGTTTCAGGTCA[40]
    TCCAAAGTCCAGT 
hACOX1 Isoform ANM_0040358−1927CTTAGAACTAGAAGGTCACTGGTCAAGCAGCCATTT[41]
    GAATCTTGATCTTCCAGTGACCAGTTCGGTAAACC 
mPCK1NM_0110446−766CCTTCTCATGACCTTTGGCCGTGGGAG[42]
    GGAAGAGTACTGGAAACCGGCACCCTC 
image

Figure 2.  Binding of the PPAR–RXR complexes to the −2185 and −3173 bp (from TSS) mouse IκBα PPREs, as determined by gel shift assay. One double-stranded 32P-labeled oligonucleotide from each location containing the mouse IκBα PPREs was incubated with in vitro transcribed/translated human RXRα and human PPARα (left-hand side) or human PPARγ (right-hand side), and binding complexes were separated by electrophoresis. The fold excess of specific (Spec: malic enzyme PPRE) or nonspecific (Non-sp: Ets oligonucleotide) unlabeled probe is indicated.

Download figure to PowerPoint

image

Figure 3.  (A) Human IκBα reporter constructs containing −2583, −1994, −1034 and −292 bp of immediate upstream promoter region were transfected into HepG2 cells, together with mouse PPARα and mouse RXRα expression vectors. Transfected cells were incubated for 4 h in the presence or absence of the agonist Wy14643. A luciferase reporter containing three copies of the acyl-CoA oxidase PPRE was used as a positive control. Normalized luciferase activity of each reporter in the absence of PPARα and Wy14643 was set at unity. Results are the means ± standard deviation (SD) for three independent experiments. (B) Alignment of two putative regulatory regions within human and mouse IκBα promoters upstream from the transcription start site. (C) Human IκBα reporter construct containing 1994, 1034 and 292 bp of immediate upstream promoter region was transfected into HepG2 cells, together with each PPAR expression vector. Transfected cells were incubated for 48 h and then for an additional 4 h in the presence or absence of Wy14643. Normalized luciferase activity in the absence of PPAR and ligand was set at unity. Results are the means ± SD of three independent experiments.

Download figure to PowerPoint

In addition to analyzing mRNA levels in nontreated and Wy14643-treated mice, the IκBα protein level was also analyzed by Western blotting (Fig. 4). An increase in IκBα protein level was found in Wy14643-treated mice, in accordance with the elevated levels of mRNA.

image

Figure 4.  Representative western blots and relative protein expression for wild-type (C) and wild-type + Wy14643 (CW) (n = 7 per group). Protein expression is expressed relative to GAPDH to account for protein loading differences per lane. Accompanying blots show mouse IκBα protein at top and GAPDH at bottom.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and methods
  6. Acknowledgements
  7. References

The IκBα promoter contains several regulatory regions, among which are sites for NFκB [30,31] and Sp1 [32]. These sites establish a promoter proximal transcriptional switch involving NFκB and Sp1, which creates an autoregulation of the IκBα promoter [32]. This switch establishes a transcriptional autoregulatory loop involved in maintaining appropriate NFκB and IκBα levels in the cell [31]. PPARα interferes negatively with other nuclear signaling pathways, such as AP1 [33] and NFκB [34], inhibiting genes induced by NFκB, such as vascular cell adhesion molecule-1, cyclo-oxygenase-2 and interleukin-6 [35,36]. PPARα upregulates the expression of the NFκB repressor IκBα [37] by increasing the occupancy of the NFκB-binding site present in the IκBα promoter, and thereby creating a negative feedback loop. It is believed that this occurs independently of PPARα binding to DNA, and it was proposed that there may be direct protein interaction of PPARα with the NFκB complex, as, at that time, there had been no functional PPRE found [38]. However, the work presented here indicates that there are PPREs in the IκBα promoter region, but they are not in very close proximity to TSS where previous work has focused [38]. We found no less than two active PPAR/RAR-RE sites in the human IκBα promoter region (−1000 and −1795 bp from TSS; Table 2, Fig. 3) and the mouse promoter region (−2185 and −3173 bp from TSS; Table 2, Fig. 2). DNA regions containing PPAR/RAR-RE sites conserved between human and mouse were also identified in the respective IκBα promoters (Fig. 3B).

Transactivation studies between Wy14643-treated and untreated HepG2 cell cultures indicate that the human pGL4 constructs (−292, −1043 and −1994 bp) are responsible for providing an increase in mouse PPARα signal after drug treatment (Fig. 3A,C). Indeed, Wy14643 treatment reveals that the mouse PPARβ signal also increases for the same constructs, whereas the mouse PPARγ signal increases only with the −292 bp pGL4 construct. Although the signal is rather modest in the transactivation studies (perhaps as a result of nonoptimal transfection efficiency or a lack of other co-activators associated with transcription), it indicates IκBα promoter activation by PPARs. The fourfold induction of mouse PPARα after drug treatment, when using the control 3X ACO PPRE construct, argues against nonoptimal transfection efficiency and the lack of co-activators or other transcriptional factors that may be responsible for the modest PPAR signal reported (Fig. 3A). Another possibility could be the distance of the PPAR/RXR-RE sites from TSS. The significance of the distance from TSS becomes apparent from the increase in mouse PPARγ signal for the −292 bp reporter construct only, leaving this as a possible future research topic. Although there is no PPAR/RXR-RE site in this region of the human IκBα promoter, there is a RAR-RE site which could serve as a possible RAR/PPARγ location for heterodimer DNA binding.

The PPAR/RXR-RE complement motifs (AGGTCA/TCCAGT) in the promoter region of several genes have been reported previously. The motifs have been documented in PPREs for mGOS2 [39], hUCP3 [40], hACOX1 [41] and mPCK1 [42]. The motif is apparently essential for the PPAR and RXR members of the nuclear receptor superfamily to bind the promoter region of these genes (Table 2). In this study, two PPRE/RXR-REs have been identified in the promoter region of the human and mouse IκBα gene. The significance of this finding stems from the fact that, of the IκB family members (α, β and ε), only the IκBα protein inhibitor regulates NFκB function in mouse heart. The implications of this finding may have an impact on cardiac disease by either over- or under-regulating NFκB protein levels in heart should IκBα become dysfunctional through mutations in its gene or promoter.

In conclusion, PPRE/RXR-REs were identified in the promoter regions for both human and mouse IκBα genes, and their existence was further verified through gel shift and transactivation assays. PPAR activation by the agonist Wy14643 has shown that IκBα is a novel target gene of these nuclear receptors, through the use of microarrays, quantitative RT-PCR, gel shift assays, transactivation studies and Western blot analysis. The importance of establishing PPAR and RXR as regulators of the IκBα gene is that the gene inhibits the activation of NFκB, which, in turn, allows the cascade effect of apoptosis (programmed cell death) to occur.

Materials and methods

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and methods
  6. Acknowledgements
  7. References

Animals, PPARα activation and microarray methods

Two mouse types were used in this study. The control group consisted of the inbred FVB mouse strain obtained from Charles River Laboratories (Wilmington, MA, USA), and the transgenic group consisted of the δ337T TRβ mouse strain that was created by a knockin mutation to reproduce the human genetic disease known as the RTH phenotype [43–45]. The use of transgenic mice, Wy14643 drug activation of PPARα target genes and microarray methods has been reported previously [29]. Microarray studies permit the monitoring of the expression of thousands of genes. To identify new putative PPAR target genes, mRNA from hearts of control and δ337T TRβ transgenic mice was extracted 6 h after treatment with the PPAR activator (Wy14643). The cDNAs were hybridized to Affymetrix 430_2 arrays and the gene expression data were analyzed. The microarray study revealed genes that were either up- or down-regulated from the Wy14643 treatment of the two mouse strains. All procedures were performed in accordance with the National Institutes of Health (NIH Publication No. 85-23, revised 1996) Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care Committee at the University of Washington.

Quantitative RT-PCR

Quantitative RT-PCR was conducted using products obtained from SuperArray Bioscience Corporation (Frederick, MD, USA) including reagents for the first-strand cDNA synthesis procedure. PCR was carried out using HotStart DNA Taq polymerase and SYBR green/fluorescein master mix containing all reagents and buffers required for quantitative RT-PCR on the iCycler PCR machine (Bio-Rad Laboratories, Hercules, CA, USA). The mouse IκBα (NM_010907.1) primer sets (PPM0294A) obtained from SuperArray generated a 146 bp amplicon that was confirmed by agarose gel electrophoresis and ethidium bromide staining. All procedures were run according to the instructions provided by the manufacturer.

Computer analysis of promoter sequences

The vector nti advance 10 computer program from Invitrogen (Carlsbad, CA, USA) was used to survey the promoter region of the mouse IκBα gene from −5000 to 2500 bp for the PPRE AGGTCA/TCCAGT motif sequence. The promoter regions of four other genes of interest, which have documented PPREs, were also analyzed for the AGGTCA/TCCAGT motif sequences (Table 2).

Transactivation assay

HepG2 cells were co-transfected by Tfx™-20 (Promega, Madison, WI, USA) with mouse PPARα, mouse PPARβ or mouse PPARγ1 expression vector (250 ng per well) and pGL4 reporter vector (250 ng per well) containing different sized fragments of the human IκBα promoter in 24-well plates containing 200 μL of culture medium with a cell density of 4 × 104 cells per well. Tfx™-20 was co-transfected at a ratio of 2 (Tfx™-20) to 0.01 (DNA); therefore, 0.5 μg of DNA required 100 μg of Tfx™-20. These conditions seem to optimize our transfection assays. The HepG2 cell line was chosen over other alternatives (i.e. 3T3-L1 fibroblasts) because of the ease and success of the transfections. All human IκBα plasmid constructs were sequenced to exclude PCR error and compared with the gene promoter region (NM_020529) for PCR accuracy. The Renilla reporter vector (5 ng per well) was also co-transfected to normalize for differences in transfection efficiency. After transfection, cells were incubated in the presence or absence of Wy14643 (50 μm) for 4 h before lysis using the M-PER method (Thermo Scientific Odessa, TX, USA). A Promega dual-luciferase reporter assay was used to measure the relative promoter activities. A Wallac Victor3 luminometer (Perkin-Elmer, Waltham, MA, USA) was used to measure the light intensities emitted from luciferase and Renilla. The results are expressed as the ratio between the firefly luciferase activity of the reporter gene and the Renilla reniformis luciferase activity of the control plasmid, constituting the control for transfection efficiency.

Gel shift assay

The human RXRα, PPARα and PPARα proteins were generated from pSG5 expression vectors using the transcription and translation (TNT) coupled in vitro system (Promega). The following oligonucleotides were annealed: IkBα-PPRE (−2185), 5′-TGTTGCCCATATTGACCTCAAACTAGG-3′ and 5′-AACGGGTATAACTGGAGTTTGATCCGGG-3′; IkBα-PPREmut (−2185), 5′-TGTTGCCCATATTGAGCTCAAACAAGG-3′ and 5′-AACGGGTATAACTCGAGTTTGTTCCGGG-3′; IkBα-PPRE (−3173), 5′-GCACTCAGGAGGTCAAGGCTGGCTGTGACC-3′ and 5′-CGTGAGTCCTCCAGTTCCGACCGACACTGG-3′; IkBα-PPREmut (−3173), 5′-GCACTCAGGAGGACAAGGCAGGCTGTGACC-3′ and 5′-CGTGAGTCCTCCTGTTCCGTCCGACACTGG-3′; for specific competition, malic enzyme PPRE, 5′-GGACTTTCTGGGTCAAAGTTGATCCCCC-3′ and 5′-CCTGAAAGACCCAGTTTCAACTAGGGGGAG-3′; and for nonspecific competition Ets, 5′-TGGAATGTACCGGAAATAACACCA-3′ and 5′-ACCTTACATGGCCTTTATTGTGGT-3′. Oligonucleotides were annealed and labeled by Klenow filling enzyme (Promega) using Redivue [α–32P] dCTP (6000 Ci·mmol−1) (Perkin-Elmer). In vitro-translated proteins (1 mL per reaction) were pre-incubated for 15 min on ice in 1× binding buffer [80 mm KCl, 1 mm dithiothreitol, 10 mm Tris/HCl (pH 7.4), 10% (v/v) glycerol plus protease inhibitors] in the presence of 2 μg of poly (dI-dC).(dI-dC), 5 μg of sonicated salmon sperm DNA and competitor oligonucleotides in a final volume of 20 μL. Then, 1 ng (1 ng·μL−1) of radiolabelled oligonucleotide was added, and incubation was continued for another 10 min at room temperature (25 °C). Complexes were separated on a 4% polyacrylamide gel (acrylamide/bisacrylamide, 37.5 : 1) equilibrated in 0.5 × TBE (Tris/borate/EDTA) at 20 mA.

Western blotting

Fifty micrograms of total protein extract from mouse heart tissue were electrophoresed together with two lanes of molecular mass size markers (chemichrome western control; Sigma-Aldrich Corporation, St Louis, MO, USA) in a 4.5% stacking and a 10% running SDS–polyacrylamide gel. The gels were then electroblotted onto poly (vinylidene difluoride) (PVDF) plus membranes. The Western blot was blocked for 1 h at room temperature with 5% nonfat milk in Tris-buffered saline plus Tween-20 (TBST) (10 mm Tris/HCl, pH 7.5, 150 mm NaCl and 0.05% Tween-20), followed by overnight incubation at 4 °C with an IκBα rabbit polyclonal primary antibody (sc-847, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) diluted in the above blocking solution. After two 10 min washes with TBST and one 10 min wash with Tris-buffered saline (TBS), the membrane was incubated at room temperature for 1 h with a donkey polyclonal to rabbit IgG secondary antibody conjugated to horseradish peroxidase (HRP) (sc-2313, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). The membranes were washed twice for 10 min with TBST and visualized with enhanced chemiluminescence after exposure to Kodak biomax light ML-1 film (Eastman Kodak Company, Rochester, NY, USA). The membrane was stripped by washing twice for 30 min with 200 mm glycine, 0.1% SDS and 1% Tween-20 (pH adjusted to 2.2), followed by three 10 min washes with TBS. The membrane was again blocked for 1 h as above, followed by overnight incubation at 4 °C with a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) rabbit polyclonal antibody (sc-25778) diluted 1 : 200 in blocking solution. The next day the membrane was washed (as above), a donkey polyclonal to rabbit IgG-HRP (sc-2313) was applied, and the remaining procedure as described above was followed. GAPDH was used as an internal reference to verify protein lane loadings.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and methods
  6. Acknowledgements
  7. References

We thank Walter Wahli for kindly providing the human RXRα, PPARα and PPARγ pSG5 expression vectors and Sander Kersten for the acyl-CoA oxidase PPRE expression vector used in this study. We would like to thank Valeria Vasta for reviewing the manuscript.

References

  1. Top of page
  2. Abstract
  3. Results
  4. Discussion
  5. Materials and methods
  6. Acknowledgements
  7. References