8-Oxoguanine in a quadruplex of the human telomere DNA sequence

Authors


J. Sagi, Rimstone Laboratory, RLI, 29 Lancaster Way, Cheshire, CT 06410, USA
Fax: +1 203 439 0064
Tel: +1 203 439 0064
E-mail: jans@rimstonelab.com

Abstract

8-Oxoguanine is a ubiquitous oxidative base lesion. We report here on the effect of this lesion on the structure and stability of quadruplexes formed by the human telomeric DNA sequence 5′-dG3(TTAG3)3 in NaCl and KCl. CD, PAGE and absorption-based thermodynamic stability data showed that replacement of any of the tetrad-forming guanines by 8-oxoguanine did not hinder the formation of monomolecular, antiparallel quadruplexes in NaCl. The modified quadruplexes were, however, destabilized in both salts, the extent of this depending on the position of the lesion. These results and the results of previous studies on guanine-to-adenine exchanges and guanine abasic lesions in the same quadruplex show a noticeable trend: it is not the type of the lesion but the position of the modification that determines the effect on the conformation and stability of the quadruplex. The type of lesion only governs the extent of changes, such as of destabilization. Most sensitive sites were found in the middle tetrad of the three-tetrad quadruplex, and the smallest alterations were observed if guanines of the terminal tetrad with the diagonal TTA loop were substituted, although even these substitutions brought about unfavorable enthalpic changes. Interestingly, the majority of these base-modified quadruplexes did not adopt the rearranged folding induced in the unmodified dG3(TTAG3)3 by potassium ions, an observation that could imply biological relevance of the results.

Abbreviations
8-oxoG

8-oxoguanine

R-B

Robinson–Britton

ROS

reactive oxygen species

Introduction

Reactive oxygen species (ROS) can damage DNA in vivo [1,2]. Mitochondrial respiratory chains are the main cellular source of ROS [3], and the hydroxyl radical is thought to be the major causative agent among ROS [4]. It can react with the sugar component of the nucleotides in nucleic acids, resulting in single-strand breaks, and also with the bases, leading to base lesions. Several dozen oxidative base lesions are known [5], but 8-oxo-7,8-dihydroguanine, or 8-oxoguanine (8-oxoG), and its further oxidized, ring-opened derivative 2,6-diamino-4-hydroxy-5-formamidopyrimidine are the most frequent products, owing to the lowest oxidation potential of guanine among nucleic acid bases [6]. Of the estimated 10 000 DNA lesions formed in a human cell per day [4,7], ∼ 2000 are 8-oxoG [8]. Recent studies estimated the levels of 8-oxoG to be between 0.3 and four lesions in 106 bases [9]. Base damage can occur in any part of the chromosomal DNA, including the chromosome end-protecting telomere sequences, both in its double-helical and in its noncanonical secondary structures formed by its single-stranded 3′-overhang. The 100–200-nucleotide overhang is composed of TTAGGG repeats in humans, and the major form of these noncanonical structures is thought to be quadruplex. The distribution of 8-oxoG along the chromosomal DNA was found to be not random [10], and the chromosome end location would increase the likelihood of oxidation of the telomeric 3′-overhang as compared with internal chromosome locations [11]. Consecutive runs of guanines within a sequence further lower the oxidation potential of guanine, which is the case in the human telomeres [11–13]. In vivo, the quadruplex units are protected by a variety of proteins, and can form higher-order structures, such as the T-loop, which also contains quadruplexes [14], but this may not hinder the formation of lesions. If not repaired, 8-oxoG is highly mutagenic, as it can mispair with adenine in its energetically favored syn conformation through Hoogsteen base pairing [4,15–17]. Although 8-oxoG does not block DNA replication, the 8-oxoG:A mismatches cause G:C to T:A transversions [18,19], and this mutagenicity has been linked to numerous diseases [3,20–22]. 8-OxoG formed in telomeric DNA can interfere with telomere functions such as the association of telomere maintenance proteins and the regulation of telomere length maintenance [23].

The basic quadruplex-forming unit of the TTAGGG repeats in the telomeric 3′-overhang region is dG3(TTAG3)3, a 21mer sequence [24]. The quadruplex formed is composed of three planar stacks of four guanines, called tetrads, connected via TTA loops, and is held together by stacking interactions between the tetrads and monovalent cation coordination to the O6 atoms of guanines. Circular, Hoogsteen-type hydrogen bonds and the coordinating cations hold the planar tetrad together [25]. Structural alterations caused by the formation of 8-oxoG in canonical B-DNA, and replication and repair of 8-oxoG, have been extensively studied with double-helical oligodeoxynucleotide models [1,2,26]. Similarly, the conformation and stability of various types of quadruplex, and the effect of a variety of base analogs on these structures, have also been described during the past decade [27–33], and are still the subjects of intensive research. Szalai et al. [30] incorporated 8-oxoG into each position of a GGG triplet within the human telomere sequence, and found that the nucleotide analog influenced both the formation and the telomerase activity of the quadruplex: 8-oxoG in the 5′-position of the triplet allowed quadruplex formation but suppressed telomerase activity, whereas 8-oxoG in the middle of the triplet resulted in nondefined structures and did not suppress telomerase activity. Position 8 of the guanines in the guanine tetrad points away from the tetrad, out into the groove, into the solvent, so this position is probably easily accessible for an attack by the hydroxyl radicals. Thus, apparently all guanines of the guanine tetrad are vulnerable to attacks, at least in vitro. To elucidate the role of all guanine positions in the structure of dG3(TTAG3)3, we replaced each of the 12 guanines one-by-one with 8-oxoG, and recorded CD spectra, performed PAGE and measured thermal transition profiles in both Na+ and K+ solutions in a similar way as we have done for adenine [31,32] and abasic site-modified quadruplexes [33].

Results and Discussion

Table 1 lists the sequences synthesized, and Fig. 1 shows the location of guanines in the monomolecular, basket-type antiparallel quadruplex scaffold, according to Wang and Patel for dAG3(TTAG3)3 [34]. This quadruplex is supposed to be the major arrangement also for dG3(TTAG3)3 in Na+ solution, based on the same CD spectral and electrophoretic properties [35,36] and thermodynamic parameters [37].

Table 1.   The DNA sequences studied. Number is used to refer to this sequence in the text, and it also indicates the position of 8-oxoG. oG, 8-oxoG.
Number5′- to 3′
  1. a A 22mer sequence.

 0GGGTTAGGGTTAGGGTTAGGG
 1oGGG TTAGGGTTAGGGTTAGGG
 2GoGG TTAGGGTTAGGGTTAGGG
 3GGoGTTAGGGTTAGGGTTAGGG
 7GGG TTAoGGGTTAGGGTTAGGG
 8GGG TTAGoGGTTAGGGTTAGGG
 9GGG TTAGGoGTTAGGGTTAGGG
13GGG TTAGGGTTAoGGGTTAGGG
14GGG TTAGGGTTAGoGGTTAGGG
15GGG TTAGGGTTAGGoGTTAGGG
19GGG TTAGGGTTAGGGTTAoG
20GGG TTAGGGTTAGGGTTAGoGG
21,TaGGG TTAGGGTTAGGGTTAGGoGT
Figure 1.

 The ‘basket’ folding pattern of 5′-dG3(TTAG3)3 in NaCl solution. The shadowed rectangles represent the syn gaunosines, and the white ones the anti guanosines. The line type framing a given guanine rectangle is also used for the corresponding CD spectrum in Fig. 2. The blue tetrad with two edgewise TTA loops is referred to in the text as the top tetrad of this three-tetrad quadruplex, and the other extremity with the single diagonal TTA loop as the bottom tetrad (red).

Folding patterns and molecularity based on CD and PAGE results

The CD spectrum of dG3(TTAG3)3, which contains 3.5 runs of the human telomere repeating sequence TTAGGG, consists of a large positive maximum at 295 nm, a smaller one near 245 nm, and a negative CD peak at ∼ 265 nm, in buffered 0.1 m NaCl (Fig. 2, upper panel) [38]. This type of spectrum is characteristic for the antiparallel basket-type quadruplex [35,38] observed with dAG3(TTAG3)3 in Na+ solution [34]. The 8-oxoG-modified dG3(TTAG3)3 sequences also exhibited this type of spectral shape in Na+ solution, with only minor differences. The exception was the 21,T quadruplex, which displayed a very deep negative band. The structure of this 22mer may differ from those of the 21mers, on the basis of the fold reported for the nonmodified 22mer sequence containing a terminal 3′-T [39]. All other CD spectra displayed slightly lowered amplitudes than those of dG3(TTAG3)3, and three of the four middle-tetrad-modified quadruplexes (Fig. 2, green spectra) and structure 15 had blue-shifted long-wavelength maxima. Among these three middle-tetrad-modified quadruplexes, structures 14 and 20 were not clear monomolecular scaffolds, as both contained in their PAGE runs a second band of minor intensity and of low mobility corresponding to a 42-nucleotide marker (Fig. 3, upper panel). This suggests bimolecular arrangements. Except for sequences 14 and 20, the replacement of guanine by 8-oxoG in dG3(TTAG3)3 did not change the ability of 8-oxoG-modified sequences to form exclusively monomolecular (Fig. 3), antiparallel quadruplexes (Fig. 2), similarly to the unmodified dG3(TTAG3)3.

Figure 2.

 CD spectra of dG3(TTAG3)3 and its 8-oxoG analogs. CD spectra were measured in the R-B buffer (pH 7) and (upper panels) 0.1 m NaCl or (bottom panels) 0.1 m KCl at 2 °C. The total Na+ or K+ concentration was 0.169 m.

Figure 3.

 PAGE images of dG3(TTAG3)3 and its 8-oxoG analogs. PAGE runs were carried out in R-B buffer (pH 7) plus (A) 0.1 m NaCl or (B) 0.1 m KCl, at 2 °C. The dG3(TTAG3)3˙d(C3TAA)3C3 duplex and unmodified dG3(TTAG3)3 were used as markers for 42 and 21 bases, respectively.

Another story emerges in K+ solution, in which the cation induces dG3(TTAG3)3 as well as dAG3(TTAG3)3 to adopt modified arrangements with altered CD shapes. The main feature of the altered shapes is the disappearance of the large negative peak at 265 nm, and the appearance of a strong shoulder at ∼ 270 nm. There are a variety of interpretations for the K+-induced arrangement in the literature. According to explanations based on methods that are able to determine exact solution (NMR) and solid-phase (X-ray) conformations, dAG3(TTAG3)3 is a hybrid of parallel and antiparallel folds, the so called 3 + 1 quadruplex structure [40–42], and a parallel-stranded quadruplex with propeller like sidelong loops [43], respectively. These methods use much higher concentrations of the oligonucleotide than the CD or UV methods. Recent studies have, however, shown that the DNA concentration greatly influences the folding patterns in K+ solution [35]. Thus, we have to rely on the CD-based interpretation. According to this, both dG3(TTAG3)3 and dAG3(TTAG3)3 adopt intramolecular quadruplex conformations with antiparallel folding also in K+ solution at a low (∼ 3 μm) strand concentration, but both contain modified stacking interactions of the tetrads, as compared with the stacking in Na+ solution [35]. This interpretation is supported by results obtained with other methods [44–46]. The change in stacking is supposed to be a consequence of the intercalation of the larger (than Na+) potassium ions between two tetrad planes, thus coordinating with eight O6 atoms of eight guanines. Sodium ions occupy the center of the tetrad plane and coordinate with four O6 atoms of the tetrad’s four guanines [47].

According to the CD spectra shown in the bottom panel of Fig. 2, only the middle-tetrad-substituted quadruplexes displayed spectra that had some resemblance to the spectrum of K+-dG3(TTAG3)3. Among these, quadruplex 14 had the closest shape similarity, although the amplitudes were smaller. On the basis of its CD shape, quadruplex 2 went further in the way of transformation, and its spectrum can be interpreted as the hybrid, 3 + 1 arrangement. The 3 + 1 arrangement is characterized by two positive peaks near 295 and 260 nm of similar height in their amplitudes [24,35]. This means that the 8-oxoG at position 2 could shift the conformation towards the folding topology adopted by dG3(TTAG3)3 at higher concentrations. The CD shape of quadruplex 8 is in between the shapes of quadruplexes 2 and 14. Although present in small amounts, both quadruplexes 8 and 14, according to nondenaturing PAGE (Fig. 3, bottom panel), also contained bimolecular complexes that could influence the spectral shape.

The shape of the K+-induced spectrum of most of the top-tetrad-substituted and bottom-tetrad-substituted sequences remained rather similar to those observed in Na+ solution, except for the smaller negative or even above-zero amplitude of the 265-nm CD signal. This indicates that transformation of these quadruplexes to the K+-induced form of dG3(TTAG3)3 was inhibited by the presence of 8-oxoG, in contrast to the middle-tetrad-substituted structures. The folding properties of the dG3(TTAG3)3 analogs may well be associated with their thermodynamic stability.

Thermal and thermodynamic stability brought about by 8-oxoG substitution of dG3(TTAG3)3

Thermal stability data for dG3(TTAG3)3 have been published, and generally a 10–20 mm buffer (pH 7) plus 0.1 m NaCl or KCl solution was used. Variations in the data published could originate from the various buffers and the source of DNA used. As we generally use the higher-salt Robinson–Britton (R-B) buffer [31–33], we have also determined here the stability in 10 mm Tris/HCl, 0.1 mm EDTA and 0.1 m NaCl or KCl (pH 7.4) for comparison (Table S1), and calculated thermodynamic parameters with meltwin’s monomolecular association option for quadruplexes [48]. The data determined here are in good agreement with those previously published (Table S1). The energy difference separating the Na+ and K+ forms of the 21mers is in the range of 1.3–2.1 kcal·mol−1 [37,49,50] (our value is 1.83 kcal·mol−1). The ΔΔG°37(K-Na) values have also been published for the 22mer dAG3(TTAG3)3, and were between 1.4 and 2.4 kcal·mol−1, as determined by differential scanning calorimetry [51]. The small energy difference between the Na+ and K+ forms of either dG3(TTAG3)3 or dAG3(TTAG3)3 may support the hypothesis [35] that, despite the differences in CD spectra, the K+ form has the same basic topology as the Na+-stabilized antiparallel form at low DNA concentrations. (On this basis, we continue to refer to the guanines in positions 1, 9, 13 and 21 as being in the bottom tetrad, and those in positions 3, 7, 10 and 19 as being in the top tetrads.)

The Tm values were slightly elevated in the R-B buffer as compared with the Tm values determined in 0.1 m cation solutions [31–33] (Table S2). Before melting profiles were recorded, the DNA solutions were heated to 90 °C and then cooled slowly to allow the formation of ordered structures. According to the thermal difference spectra [52], all sequences studied formed quadruplexes at the end of this cooling process (Fig. S1). The melting profiles of all sequences studied (Fig. S2) were reversible, and the unfolding–refolding–unfolding profiles were superimposable in both Na+ and K+ solutions (Fig. S3). Thermal stability and thermodynamic parameters were obtained from these profiles by meltwin [48] (Fig. S4), as before [32,33]. Tables 2 and 3 show the thermal stability and thermodynamic parameters determined in Na+ and K+ solutions, respectively. The differential values (ΔTm and ΔΔG°37) are related to the corresponding data of the unmodified dG3(TTAG3)3 (no. 0). Quadruplexes are listed according to the tetrads.

Table 2.   Effect of substitution of 8-oxoG for guanine on the thermodynamic parameters of dG3(TTAG3)3 in 0.169 m Na+ solution. Data are the averages ± standard deviation of three measurements. t, m and b stand for top, middle and bottom tetrads, as determined originally for the basket scaffold in NaCl. ΔTm = Tm − Tm(0). TΔS ° values are calculated for 37 °C (310 K). ΔΔG°37 = ΔG°37 − ΔG°37(0).
No.Tetrad in Na+Tm (°C)ΔTm (°C)ΔH ° (kcal·mol−1)ΔS° (cal·Kmol−1)TΔS° (kcal·mol−1)ΔG°37 (kcal·mol−1)ΔΔG°37 (kcal·mol−1)
  1. a Average values for mixed structures (upper panel, Fig. 3). b 22-nucleotide sequence.

 067.7 ± 0.5−52 ± 2−153 ± 5−47.4−4.7 ± 0.1
 3t60.2 ± 0.4−7.5−44 ± 1−131 ± 2−40.6−3.0 ± 0.11.7
 752.1 ± 0.3−15.6−43 ± 2−131 ± 5−40.6−2.0 ± 0.12.7
1550.4 ± 0−17.3−41 ± 7−126 ± 22−39.1−1.7 ± 0.33.0
1953.5 ± 0.2−14.2−41 ± 4−125 ± 13−38.8−2.0 ± 0.22.7
 2m48.2 ± 0.3−19.5−39 ± 2−121 ± 6−37.5−1.4 ± 0.13.3
 841.9 ± 0.6−25.8−40 ± 4−128 ± 13−39.7−0.6 ± 0.14.1
14a44.4 ± 0.8−23.3  – –
20a43.6 ± 1.7−24.1  – –
 1b64.0 ± 0.6−3.7−48 ± 2−141 ± 7−43.7−3.8 ± 0.20.9
 964.1 ± 0.3−3.6−48 ± 2−142 ± 6−44.0−3.8 ± 0.20.9
1365.3 ± 0.2−2.4−47 ± 1−140 ± 3−43.4−4.0 ± 0.10.7
21,Tb60.8 ± 0.1−6.9−48 ± 3−143 ± 9−44.3−3.4 ± 0.21.3
Table 3.   Effect of substitution of 8-oxoG for guanine on the thermodynamic parameters of dG3(TTAG3)3 in 0.169 m K+ solution. Data are the averages ± standard deviation of three measurements. t, m and b stand for top, middle and bottom tetrads, as determined for the basket scaffold in NaCl. ΔTm = Tm − Tm(0). TΔS° values are calculated for 37 °C (310 K). ΔΔG°37 = ΔG°37 – ΔG°37(0). ΔTm = (Tm in K+) − (Tm in Na+). ΔΔG°37 = (ΔG°37 in K+) − (ΔG°37 in Na+).
No.Tetrad in K+Tm (°C)ΔTm (°C)ΔH° (kcal·mol−1)ΔS° (cal·Kmol−1)TΔS° (kcal·mol−1)ΔG°37 (kcal·mol−1)ΔΔG°37 (kcal·mol−1)ΔTm (°C)ΔΔG°37 (kcal·mol−1)
  1. a Average values for mixed structures (bottom panel, Fig. 3). b 22-nucleotide sequence.

 075.4 ± 0.5−57 ± 3−163 ± 9−50.5−6.2 ± 0.37.7−1.5
 3t66.1 ± 0.1−9.3−53 ± 2−157 ± 5−48.7−4.6 ± 0.11.65.9−1.6
 761.2 ± 0.3−14.2−51 ± 2−152 ± 7−47.1−3.7 ± 0.22.59.1−1.7
1561.2 ± 0.1−14.2−47 ± 6−143 ± 17−44.3−3.4 ± 0.42.810.8−1.7
1960.6 ± 0.3−14.8−47 ± 6−140 ± 17−43.4−3.3 ± 0.42.97.1−1.3
 2m48.0 ± 0.4−27.4−46 ± 2−142 ± 7−44.0−1.6 ± 0.14.6−0.2−0.2
 8a44.9 ± 0.5−30.53.0
14a47.0 ± 0.8−28.42.6
20a47.1 ± 1.2−28.33.5
 1b63.2 ± 0.1−12.2−52 ± 3−155 ± 8−48.0−4.1 ± 0.22.1−0.8−0.3
 964.2 ± 0.1−11.2−50 ± 1−148 ± 3−45.9−4.0 ± 0.12.20.1−0.2
1364.4 ± 0.1−11.0−52 ± 4−153 ± 11−47.4−4.2 ± 0.32−0.9−0.2
21,Tb64.9 ± 0.2−10.5−54 ± 7−158 ± 19−49.0−4.4 ± 0.51.84.1−1

The overall picture that emerges from the thermodynamic data is that the stability of dG3(TTAG3)3 is reduced by the 8-oxoG substitution in both Na+ and K+ solutions, and that the reduction is enthalpic in origin. This can be concluded from the comparison of the differential ΔH° and TΔS° values (data not listed). The unfavorable enthalpy change may mainly arise from the altered stacking interactions. This disorder could result from the steric constraint of the hydrogen atom of N7 of 8-oxoG, which could cause a shift in the position of 8-oxoG, as compared with the position of an unmodified guanine, and probably also of the neighboring guanines. 8-OxoG also disturbs the circular hydrogen bonding. Participation of the O6 atom(s) in the coordination to either the Na+ or K+ may become less efficient as a consequence of the base shifts. Such changes would eventually perturb the stacking interaction of the modified tetrad with neighbor tetrad(s). An additional effect could result from the hydration that may increase around the polar oxygen atom of C8 as compared with hydration of C8-H of guanine. The hydration and stability of quadruplexes have been reported to be inversely related [53].

The large, unfavorable enthalpic changes observed were partially compensated for by favorable entropy changes, i.e. by the increased disorder, probably as a consequence of base shifting. The partial compensation resulted in favorable free energy values at 37 °C for all analogs. The quadruplexes with 8-oxoG in the middle tetrad showed the greatest reduction in free energy as compared with the ΔG°37 value of dG3(TTAG3)3, in both Na+ and K+ solutions. This has been found previously [29,31–33], and explained by other substitutions [31–33]. The main point is that the middle tetrad in a three-tetrad quadruplex has bilateral connections, so altering its structure should inevitably result in the greatest effect as compared with the effects measured with the modified terminal tetrads, no matter what the effect is. In Na+ solution, the bottom tetrad, containing the diagonal TTA loop, was more stable, i.e. less destabilized by 8-oxoG than the top tetrad, probably owing to the stabilizing effect of the diagonal loop through stacking to the tetrad bases, whereas this effect apparently did not exist or was much smaller with the lateral, edge-wise loops. The stabilizing force largely disappeared in K+ solution, probably because of the intercalation of the large potassium ions between the stacks resulting in diminished interaction of loop bases with the bottom tetrad.

An interesting point is the lack of effect of the originally syn and anti guanine positions on quadruplex stability. The 8-oxoG nucleoside, and the 8-substituted guanosines in general, have been reported to be more stable in the syn form [54]. In this way, if an originally anti guanosine was replaced by an 8-oxoG nucleoside, the quadruplex stability would pay an energy penalty for bringing and keeping the 8-oxoG nucleoside in an anti N-glycosidic conformation. This effect was, however, not observed when the guanosine conformations indicated in Fig. 1 were compared with the thermal and thermodynamic stability data obtained. The explanation could be that the energy difference between the two conformations of guanosine is small. Support for this is provided by the results observed with double-helical DNAs containing 8-oxoG, in which the syn conformational preference of the 8-oxoG nucleotides was apparently absent [55]. However, 8-oxoG still slightly destabilized oligonucleotide duplexes as well, and the extent of this differed according to the length of the duplex. With 13mer duplexes, the ΔTm values were −3 to −2 °C [56], with 13–15mer duplexes they were −0.6 °C [57], and with 15mer duplexes no or hardly any destabilization was observed [58]. The longer and more stable duplexes can tolerate base lesions better than the shorter duplexes [59]. In our present experiments in 10 mm Tris buffer (pH 7) plus 0.1 m KCl with sequences 3, 8 and 13 complexed with the complementary 21mer strand, the ΔTm values were 0.1 °C, 0.6 °C, and 1.2 °C, respectively, whereas ΔTm values of quadruplexes 3, 8 and 13 in the same buffer were −8.1 °C, −29.5 °C, and −9.4 °C (and 1.19, 5.02 and 1.61 kcal·mol−1), respectively, and all three original guanine positions were anti in Na+ solution (Fig. 1).

A further point is the effect of K+ on stability and destabilization, as compared with the effects measured in Na+ solutions. The two columns on the right of Table 3 show these differential values. The large increase in stability measured with the unmodified 21mer strand, 7.7 °C in Tm, and −1.56 kcal·mol−1 in ΔG°37, was also observed with the quadruplexes modified in the top tetrad, whereas smaller or very small but still favorable free energy changes were observed with the other quadruplex analogs.

Comparison of results with those for two other natural base lesions that were systematically studied with dG3(TTAG3)3

Adenine can be incorporated in vivo into telomeric DNA through 5-methylcytosine and cytosine deamination to thymine and uracil, respectively, and then by the G-to-A transition during replication. Based on this, the substitution of adenine for each guanine in dG3(TTAG3)3 has been studied [31]. In a similar way, the effects of guanine abasic lesions (AP-sites) have been determined by incorporating the tetrahydrofuranyl AP-sites into dG3(TTAG3)3 [33]. Adenine, the AP-site and 8-oxoG are very different base/nucleotide derivatives from a structural point of view. Adenine lacks oxygen atoms, so cation coordination becomes less effective in any G3:A tetrad than it can be in the G4 tetrad. The arrangement of exocyclic groups and donor/acceptor sites of adenine inevitably leads to disruption of the circular hydrogen bonding of the guanine tetrad, and, although adenine also possesses stacking ability, its ‘vertical’ interactions are supposed to be dissimilar from that of the guanine in a quadruplex. The AP-site, which lacks the heterocyclic base, was thought to have dramatic effect on the physical properties of a quadruplex, whereas 8-oxoG apparently has the closest resemblance to guanine, so smaller effects than those by the AP-site were predicted for 8-oxoG. Despite the great differences in the structures of these three derivatives, all have similar effects on the properties of the quadruplex. Below, the main points regarding the folding properties are (a)–(c), and those regarding the stability are (d)–(g). (a) PAGE runs show that only the middle-tetrad-substituted sequences can form bimolecular structures in addition to monomolecular scaffolds in Na+ and/or K+ solutions. (b) Position 2 in the middle tetrad is apparently a special location for the replacement of guanine: in contrast to the other middle-tetrad-substituted sequences, sequence 2 containing either adenine, the AP-site or 8-oxoG formed only a monomolecular quadruplex in both Na+ and K+ solution. (c) The presence of lesions in the terminal (top and bottom) tetrads hindered the formation of the quadruplex arrangement observed with the nonmodified sequence in K+ solution. (d) The middle tetrad of the three-tetrad quadruplex is the most sensitive part also from the point of view of stability. Both in Na+ solution and in K+ solution, the largest destabilization effects were observed here. Because of multiple folding arrangements in most cases, differential thermal stability values (not thermodynamics) are given in Table 4, which summarizes the comparative stability data. Only the extent of destabilization was different with the various substitutions, and not even the missing guanine (AP-site) caused the largest negative effect. (e) Replacement of guanines in the bottom, the diagonal loop-connected tetrad caused the smallest destabilization of dG3(TTAG3)3 in Na+ solution (Table 4). (f) The relatively small destabilization effects observed in Na+ solution with the bottom-tetrad-substituted analogs almost disappeared in K+ solution. (g) Certain single positions of the quadruplex were special for stability: replacement of guanine in position 3 caused the smallest negative effect among the four guanines of the top tetrad, especially in Na+ solution (Table 4).

Table 4.   Comparison of thermal and thermodynamic stability data of quadruplexes containing base modifications at special locations.
Substitution inSubstitution of guanine by
Adenine [31]Abasic site [33]8-oxoG (from Tables 2 and 3)
ΔTm (°C)ΔΔG°37 (kcal·mol−1)ΔTm (°C)ΔΔG°37 (kcal·mol−1)ΔTm (°C)ΔΔG°37 (kcal·mol−1)
Middle tetrad−22 to −29 in Na+ and K+−12 to −23 in Na+
−21 to −26 in K+
−19 to −26 in Na+
−27 to −31 in K+
Bottom tetrad−2 to −7 in Na+
−10 to −16 in K+
−7 to −9 in Na+
−10 to −13 in K+
1.2 to 1.7 in Na+
1.8 to 2.7 in K+
−2 to −7 in Na+
−10 to −12 in K+
0.7 to 1.3 in Na+
1.8 to 2.2 in K+
Position 3−9−30.56−7.51.64
Average of the other positions in upper tetrad−19−172.76−162.76

Conclusions

The natural base lesion 8-oxoG can arise in vivo through the attack of ROS on the guanines of the protein-protected telomere quadruplex structures at the chromosome ends. Part of the present study was carried out in near-physiological K+ concentrations. On the basis of these in vitro results, it may be realistic to assume that the modified quadruplexes will also be destabilized in vivo by 8-oxoG. If the 8-oxoG is formed in a tetrad with bilateral stacking connections, such as in the middle tetrad of the three-tetrad quadruplex of dG3(TTAG3)3, the extent of destabilization could be so great that the quadruplex would be more than partially unfolded at 37 °C. This could render the structure vulnerable to attacks by cellular nucleases. It is not yet known if damaged quadruplexes in telomeric DNA can be repaired, or indeed whether there are any repair enzymes specialized for quadruplexes in cells. If natural base lesions in quadruplexes, such as 8-oxoG are not repaired in vivo, they may cause untimely shortening of the telomeres.

Experimental procedures

The oligodeoxynucleotides studied were purchased from Generi Biotech (Hradec Kralove, Czech Republic) and purified by HPLC. Purity was checked by denatured gel electrophoresis. PAGE (apparatus SE-600; Hoefer Scientific, San Francisco, CA, USA), CD (Jobin-Yvon Mark VI dichrograph; Jobin-Yvon, Longjumeau, France) and UV melting (Varian Cary 4000 UV/VIS; Varian, Mulgrave, Victoria, Australia) experiments were carried out as described previously [31]: 0.1 m NaCl or KCl was added to R-B buffer (26 mm mixture of boric, phosphoric and acetic acids and 69 mm NaOH or KOH) (pH 7), resulting in final concentration of 0.169 m Na+ or K+ in all experiments. UV absorption-based thermal stability data are averages of three measurements, including both heating and cooling curves. Strand concentrations were 3 μm, calculated by using the molar absorption of 223 000 L·(mol·cm)−1, given by the manufacturer for the unmodified 21mer, for all analogs, in final volumes of 0.9 mL in 1-cm-pathlength cuvettes. Before the measurements, the samples were held at 90 °C for 5 min, and then left to cool slowly to room temperature. Melting curves (2–93 °C, 93–18 °C, and 18–93 °C) were measured with a temperature increase of 1 °C and 4 min of waiting at each temperature before a spectrum was obtained in a Varian Cary 4000 spectrophotometer, and analyzed at 296 m. The melting of each quadruplex was single-phase and reversible, and the melting and annealing curves were superimposable. This indicates true equilibrium, which is the basis for two-state melting. Thermodynamic parameters were extracted from the curves with the use of meltwin, version 3.0 [48], as previously described [32,33].

Acknowledgements

M. Vorlícková, M. Tomasko and K. Bednarova thank the Grant Agency of the Academy of Sciences of the Czech Republic for grants IAA  100040701, AVOZ50040507, and AVOZ50040702. The work was also supported by the project ‘CEITEC  – Central European Institute of Technology’ (CZ.1.05/1.1.00/02.0068) from the European Regional Development Fund.

Ancillary

Advertisement