Identification of Dp71e, a new dystrophin with a novel carboxy-terminal end

Authors

  • Abril Saint Martín,

    1.  Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, C.P. 07360 México, Mexico
    Search for more papers by this author
  • Jorge Aragón,

    1.  Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, C.P. 07360 México, Mexico
    Search for more papers by this author
  • Francisco Depardon-Benítez,

    1.  Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, C.P. 07360 México, Mexico
    Search for more papers by this author
    • Deceased.

  • Alejandra Sánchez-Trujillo,

    1.  Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, C.P. 07360 México, Mexico
    Search for more papers by this author
  • Guillermo Mendoza-Hernández,

    1.  Department of Biochemistry, Faculty of Medicine, UNAM: Universidad Nacional Autónoma de México., Av. Circuito Exterior s/n. Ciudad Universitaria, C.P. 04510 México, Mexico
    Search for more papers by this author
  • Victor Ceja,

    1.  Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, C.P. 07360 México, Mexico
    Search for more papers by this author
  • Cecilia Montañez

    1.  Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, C.P. 07360 México, Mexico
    Search for more papers by this author

C. Montañez, Department of Genetics & Molecular Biology, CINVESTAV: Research Centre for Advanced Studies, IPN, Av. Instituto Politécnico Nacional 2508, México 07360, Mexico D.F.
Fax: +52 55 57473931
Tel: +52 55 57473334
E-mail: cecim@cinvestav.mx

Abstract

Several dystrophin Dp71 isoforms have previously been described and can be grouped into two subfamilies (Dp71d or Dp71f) depending upon the splicing of exon 78. As a consequence of this splicing, each group has a carboxy-terminal end with a unique amino acid composition; this composition imparts specific characteristics with respect to subcellular localization and interactions with particular members of the dystrophin-associated proteins (DAPs) complex. We have discovered a new alternative splicing event at the 3′ region of the Dp71 transcript. This spliced region has a unique sequence that codes for 10 amino acids and prevents the translation of exons 78 and 79. This novel Dp71 isoform is called Dp71e and is expressed in undifferentiated cells and during nerve growth factor-induced differentiation of PC12 cells. Interestingly, Dp71e mRNA and protein expression increase during PC12 cell differentiation mediated by NGF. This new Dp71 isoform is also expressed in rat organs and in human cell lines.

Database

  • Dp71e nucleotide sequence data are available in the GenBank/EMBL/DDBJ databases under the accession number JF510048.1

Abbreviations
BMD

Becker muscular dystrophy

DAPs

dystrophin-associated proteins

DMD

Duchenne muscular dystrophy

IPTG

isopropyl thio-β-d-galactoside

NGF

nerve growth factor

pI

isoelectric point

Introduction

Duchenne muscular dystrophy (DMD) is a severe X-linked recessive and progressive muscle-wasting disease that is caused by mutations in the dystrophin gene [1–3], which is also the largest gene described in humans. The protein product is encoded by 79 exons [4] and was named dystrophin because the lack of it causes dystrophy [1]. The dystrophin protein consists of four structural domains: an amino-terminal actin-binding region; a rod structure with 24 spectrin-like repeats; a cysteine-rich domain with calcium-binding motifs; and a unique carboxy-terminal domain that interacts with several proteins called dystrophin-associated proteins (DAPs) [5,6].

The expression of the DMD gene is very highly regulated; the full-length dystrophin transcript is controlled by three independently regulated promoters [7–9]. The gene has at least four internal promoters that express shorter dystrophin transcripts with a unique first exon that encodes truncated isoforms, which are named according to their respective molecular weights: Dp260 [10], Dp140 [11], Dp116 [12] and Dp71 [13–15]. Furthermore, variants in the 3′ terminal region produced by alternative splicing have also been identified, primarily by RT-PCR amplification of dystrophin mRNA [16,17]. Some of these variants are expressed in separate tissues at different stages of development [16].

The carboxy-terminal portion of the dystrophin family members represents the most highly conserved region of the dystrophin molecule [18]. One of the shortest isoforms is Dp71; this isoform undergoes several alternative splicing events. Dp71 protein products arising from intact exon 78 are named Dp71d, or, alternatively, Dp71a. Exon 71 is either present or spliced out. Splicing of exon 78 causes a frameshift resulting in a protein with a novel hydrophobic carboxy terminus [15]. This protein product is called Dp71f, and it exists in two variants: Dp71b (exon 71 is present) or Dp71ab (exon 71 is absent). The Dp71c (before Dp71Δ110m [19]) transcript lacks exons 71–74; removal of exon 71 or exons 71–74 results in loss of the syntrophin-binding site from the protein [19,20]. The Dp71Δ110 transcript splices out exons 71–74 and exon 78 [19]. The cellular localization of Dp71 isoforms depends on the carboxy terminus [8,21–23], and consequently it may modify their functions.

Our group has been studying the diverse Dp71 isoforms expressed in PC12 rat pheochromocytoma cells, a model cell line well-established for studying neuronal differentiation [24]. The PC12 cell line expresses different Dp71 isoforms (from which exon 71 has been spliced out), including Dp71d and Dp71ab [23,25], and a novel Dp71 isoform, described in this work, called Dp71e.

Results

Identification of the novel Dp71e isoform

We have previously described the expression of the Dp71 isoforms Dp71d and Dp71f, in the PC12 cell line [23]. Considering that the expression of a variety of Dp71 proteins has been described, we investigated whether additional Dp71 isoforms are expressed in PC12 cells. Total RNA was isolated from undifferentiated PC12 cells, and cDNA was synthesized using the dcDNA primer, as described in the Materials and Methods. The cDNA was amplified by PCR using the primers rDp71F and rTAADp71abRNotI (complementary oligonucleotides to the 5′-UTR and the 3′ region of the rat Dp71ab sequence). Several Dp71 cDNAs expressed in PC12 cells were obtained and then cloned into the vector pGEM-T Easy for further analysis. To characterize the different types of Dp71 isoforms expressed in PC12 cells, a PCR assay was performed using the primer rDp7177F (complementary to the last part of exon 77) and the primer 2296. The length of the PCR product was characteristic of the 3′-terminal region present in each cloned isoform. The Dp71a isoform contains the 3′-terminal exons 77, 78 and 79, and it yielded a PCR product of 158 bp (Fig. 1A, lanes 1 and 3). The Dp71ab isoform (also called Dp71f) contains the 3′-terminal region ‘ab’, and the size of the PCR product was 126 bp because exon 78 is spliced out (Fig. 1A, lane 4). Unexpectedly, we found a PCR product that was longer than any of the previously reported isoforms (Fig. 1A, lane 2). This Dp71 fragment was isolated and sequenced. According to the DNA sequence analysis, the fragment corresponded to a Dp71 isoform with a novel 3′ end. To identify the nature of this new sequence, it was aligned with the complete rat dystrophin gene sequence using the Basic Local Alignment Search Tool (blast; http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Fig. 1B). The result showed a new Dp71 transcript that undergoes an alternative splicing event at intron 77 of the dystrophin gene. This splicing introduces 34 bp (Fig. 1B), causes a frameshift and introduces a stop codon before the coding region of exon 78. The frameshift and the stop codon prevent the translation of exons 78 and 79. This sequence encodes a new carboxy-terminal region composed of 10 amino acids; we refer to this new transcript as sequence ‘e’. This group of 10 amino acids has a hydrophilic character, and several of the amino acids in this region have the potential to be phosphorylated (Fig. 1C). The complete cDNA of this isoform was sequenced; the coding and amino acid sequences of Dp71e are shown in Fig. 2A. The ‘e’ sequence is also present in the human and mouse genome; however, a change is observed in one codon in the ‘e’ sequence of the human genome (Fig. 2B). The new isoform is named Dp71e and has a predicted molecular mass of 68.5 kDa.

Figure 1.

 Identification of a novel Dp71 isoform transcript in PC12 cells. (A) An RT-PCR assay was performed using the primers rDp7177F and 2296. Lanes 1 and 3: 158-bp PCR product that corresponds to Dp71a. Lane 2: 192-bp PCR product that corresponds to Dp71e. Lane 4: 126-bp PCR product that corresponds to Dp71ab. M, Φ174 ladder; the sizes (in bp) are indicated on the left. (B) The DNA sequence of the 192-bp PCR product was analyzed with the Web blast Tool, using, as a reference, the Rattus norvegicus strain BN/SsNHsdMCW chromosome X genomic scaffold, RGSC_v3.4, locus NW_048042 DNA linear of 169625 bp. The new 34-bp sequence (region ‘e’, underlined) is in chromosome X of the rat genome as part of the Dystrophin intron 77. The stop codon is shown in bold. Exon 77 and 78 sequences are shown in bold capital letters. (C) Using the clustal x alignment program, a comparison was made between the theoretical amino acid sequences of the Dp71e and Dp71a isoforms. The carboxy-terminal region encoded by the 34-bp sequence is translated into 10 new amino acids that form region ‘e’ (shown in bold and underlined).

Figure 2.

 Dp71e cDNA and amino acid sequences. (A) Complete Dp71e coding and amino acid sequence. Exons 63, 64 and 78 are indicated; the junction of the exons is underlined and the ‘e’ sequence is in bold. The last 10 amino acids (DLSASSSLYY) are specific to the Dp71e. (B) Alignment of the Dp71e sequence from rat, mouse and human (r, m and hDp71e, respectively). The ‘e’ sequence is indicated in bold and the amino acid sequence is shown at the bottom of the figure. A change is observed (L→T) in the second amino acid of the human ‘e’ sequence. The Dp71 isoforms from PC12 cells do not contain the exon 71 (GenBank/EMBL/DDBJ databases under the accession number JF510048.1). Exons 77 and 78 are indicated.

Expression of Dp71e mRNA in the PC12 cell line

To analyze the expression of Dp71e mRNA during NGF-induced differentiation of PC12 cells, a semiquantitative RT-PCR assay was performed using the primers rATGDp71F (specific for exon 1 of Dp71) and rDp71eR (specific for the ‘e’ region; see Table 1). Expression of Dp71e mRNA was observed throughout the 12-day treatment with NGF, as described in the Materials and Methods. Expression of the Dp71e transcript increased during the differentiation process from day 5 until day 12 (Fig. 3A). Amplification of the β-actin mRNA was used as a control (Fig. 3B).

Table 1.   Primer sequences, PCR conditions and size of the different amplified products. The restriction sites are underlined.
Amplified productsPrimerSequence (5′–3′)Product size (bp)PCR conditions
Dp71 cDNA synthesisdcDNA
Aragón et al. [32]
GAATATTATAAAAACCATGCGSee Material and Methods
Dp71erATGDp71F
Aragón et al. [32]
ATGAGGGAACACCTCAAAGGCCACG179694 °C per 30 s, 68 °C per 3 min
32 cycles
72 °C per 10 min
rDp71eRTAGAGAGAGGAAGAGGCAGATAGAT
rATGDp71FEcoRICTAGTAGAATTCACATGAGGGAACACCTCAAAGGCCACG196394 °C per 30 s, 68 °C per 3 min
32 cycles 72 °C per 10 min
rTAADp71abRNotIGATCTAGCGGCCGCTTATTCTGCTCCTTCTTCATCTATCATGACTG
Dp71ecrDp7169FCATGGTAGAGTACTGCACTCCG64594 °C per 30 s, 68 °C per 3 min
35 cycles
72 °C per 10 min
rDp71eRTAGAGAGAGGAAGAGGCAGATAGAT
Dp71 isoformsrDp71FCTGACTGCCTGTGAAATCCTTAC1910–196294 °C per 30 s, 68 °C per 3 min
35 cycles
72 °C per 10 min
rTAADp71abRNotIGATCTAGCGGCCGCTTATTCTGCTCCTTCTTCATCTATCATGACTG
Dystrophin isoformsrDp7177FCCTTCCCTAGTTCAAGAG126–19294 °C per 30 s, 58 °C per 30 s
60 °C per 60 s
35 cycles
72 °C per 10 min
2296 Austin et al. [47]TCTAGAATTCTTATTCTGCTCCTTCTTC
Human Dp71erATGDp71FATGAGGGAACACCTCAAAGGCCACG1804–184394 °C per 30 s, 58 °C per 3 min
35 cycles
72 °C per 10 min
rTAADp71eRCTTCCTCTCTCTATTATTAA
β-actinActin1TTGTAACCAACTGGGACGATATGG76394 °C per 30 s, 58 °C per 30 s
60 °C per 30 s
35 cycles
72 °C per 10 min
Actin2GATCTTGATCTTCATGGTGCTAGG
Figure 3.

 Dp71e transcript expression in the PC12 cell line. RT-PCR was performed using total RNA isolated from PC12 cells after treatment with NGF for 0–12 days (indicated by the numbers above the lanes), as indicated in the Materials and Methods. Fragments were resolved by electrophoresis through a 0.8% agarose gel. (A) The Dp71e PCR-amplified product of 1796 bp was generated using the primers rATGDp71F and rDp71eR. (B) The rat β-actin PCR-amplified product of 763 bp was obtained using the primers actin1 and actin2. M, 100-bp ladder.

Characterization of the novel Dp71e protein expressed in PC12 cells

To determine if the new Dp71 mRNA could be translated, a western blot assay was performed using a polyclonal antibody named Dp71e Ab, which specifically recognizes the 10 amino acids of the ‘e’ region (see the Materials and Methods). Lysates from undifferentiated and differentiated PC12 cells treated with NGF for 4, 8 or 12 days were analyzed by SDS/PAGE and immunoblotting. Dp71e is a protein of approximately 68.5 kDa, and its expression increased during the process of NGF-induced differentiation (Fig. 4). This result correlates with the transcript expression.

Figure 4.

 Expression of the novel Dp71e protein in PC12 cells. Total protein lysates (100 μg) from undifferentiated PC12 cells and from PC12 cells after treatment with NGF for 4, 8 and 12 days (numbers above each lane) were separated by electrophoresis on 10% SDS polyacrylamide gels under reducing conditions and transferred to nitrocellulose membranes. Blots were immunostained using the specific Dp71e Ab. (A) The novel Dp71e protein was observed at the expected molecular mass (68.5 kDa). (B) The β-actin protein was used as a standard. The molecular mass markers (kDa) are annotated on the left.

The next step in the characterization of the Dp71e protein was to determine its isoelectric point (pI). Analysis of the Dp71e protein amino acid sequence using the Expert Protein Analysis System (ExPASy, Swiss Institute of Bioinformatics, Switzerland) web proteomics server predicted a pI of 6.04. To determine if the experimental Dp71e pI matches the theoretically predicted pI, lysates from PC12 cells differentiated for 8 days were analyzed by 2D electrophoresis using IPG strips with a pH range of 5.0–8.0, as indicated in the Materials and Methods. After immunoblot analysis using Dp71e Ab as a probe, a spot corresponding to the Dp71e protein with a pI of 5.9 was found (Fig. 5).

Figure 5.

 Dp71e isoelectric point. Total protein lysates (80 μg) from PC12 cells differentiated for 8 days with NGF were separated by 2D gel electrophoresis. First dimension: 7-cm strips of pH range 5–8; second dimension: 10% SDS polyacrylamide gels under reducing conditions. The samples were transferred to nitrocellulose membranes and the blots were immunostained with the Dp71e Ab. A unique spot (indicated by an arrow) corresponds to Dp71e, which shows a pI of 5.9 and a molecular mass of 68.5 kDa. The molecular mass markers (kDa) are shown on the left, and the pH range is shown at the top of gel.

Identification and characterization of Dp71e in rat tissues and human cell lines

Because PC12 cells are an immortalized line from the rat adrenal gland, we analyzed whether the Dp71e transcript is expressed in rat tissues. Following the same strategy used for PC12 cells, we determined that Dp7e mRNA is present in several rat tissues, including brain, heart, lung, testis, pancreas, kidney, intestine, liver and eye; however, skeletal muscle does not express this transcript (Fig. 6A). Surprisingly, in some of these organs, an additional band (1505 bp in length) was amplified below the expected Dp71e fragment (1796 bp). Considering that Dp71 isoforms without exons 71–74 have been described by Austin et al. [19], we were interested in the characterization of this shorter PCR product. To investigate its nature, the band from rat brain was isolated from the gel using the QIAGEN gel-extraction kit (see the Materials and Methods) and used as template for a new PCR assay with oligonucleotides complementary to exon 69 and the ‘e’ region (primers rDp7169F and rDp71eR) (Fig. 6C). The 645-bp PCR product was then sequenced to determine its identity (Fig. 6D,E). The results showed that this 1505-bp transcript lacks exons 71–74; we therefore refer to this transcript as Dp71ec. In Fig. 6D, an additional band of 936 bp was observed; this band corresponds to the Dp71e isoform that contains exons 72–74.

Figure 6.

 Dp71e mRNA expression in rat organs and human cell lines. Total RNA was isolated, and RT-PCR was performed with the primers rATGDp71F (specific for the exon 1 of Dp71) and rDp71eR (specific for the region ‘e’; see Table 1). (A) Fragments were resolved in a 0.8% agarose gel. The Dp71e transcript was present in all rat organs analyzed, except skeletal muscle. (B) Beta-actin was amplified as a positive control. (C) Lane 1, electrophoresis of the 1796-bp fragment; lane 2, electrophoresis of the previously purified 1505-bp fragment. (D) Re-amplification of the 1505-bp PCR product using the primers rDp7169F and rDp71eR. (E) Amplification of Dp71e mRNA in human cell lines is shown in the upper panel and amplification of β-actin mRNA is shown in the lower panel. Lane 1, PC12 cells; lane 2, HeLa cells; and lane 3, SH-Y5Y cells. M, 100-bp and Φ174 ladders. (F) The 645-bp PCR product was sequenced and analyzed using clustal x. The sequence obtained (Dp71ec) lacks exons 71–74. Exon numbers are indicated.

We also analyzed the expression of Dp71e mRNA in human-derived cell lines. Interestingly, the Dp71e transcript is expressed in HeLa and SH-SY5Y cell lines (Fig. 6E). An additional band was amplified below the expected Dp71e band in human cells as was observed in rat tissues.

We subsequently analyzed the presence of the novel Dp71e protein in rat organs. Rat organ lysates were separated by SDS/PAGE and subjected to immunoblot analysis using the Dp71e Ab. A band corresponding to the Dp71e protein, and with the expected molecular mass of 68.5 kDa, was observed in heart and lung tissues. The molecular mass of this protein matches the molecular mass observed in PC12 cells (Fig. 7).

Figure 7.

 Expression of Dp71e in rat organs. Total protein lysates (100 μg) from rat organs (heart and lung) and PC12 cells after 5 days of treatment with NGF were separated on 10% SDS polyacrylamide gels under reducing conditions and transferred to nitrocellulose membranes. (A) Blots were immunostained using the specific antibody Dp71e (B) β-actin protein was used as a standard. The molecular mass markers (kDa) are annotated on the left.

To further characterize the expression of Dp71e protein in rat tissues, 2D electrophoresis was performed. Rat lung lysates were analyzed as indicated in the Materials and Methods, and immunoblot detection was performed using Dp71e Ab. A protein with a molecular mass of 68.5 kDa and a pI of 5.9 was identified (Fig. 8), which was identical to that found in PC12 cells. An additional spot was identified by the Dp71e Ab in this experiment, with a molecular mass of approximately 70 kDa and a pI of 7.1. The nature of this spot is unknown; however, it could be a member of the dystrophin family.

Figure 8.

 The Dp71e pI in rat lung. Total protein lysates (80 μg) from rat lung were separated by 2D gel electrophoresis. First dimension: 7-cm strips of pH range 3–10; second dimension: 10% SDS polyacrylamide gels under reducing conditions. The samples were transferred to nitrocellulose membranes and the blots were immunostained with the Dp71e Ab. The spot (indicated by an arrow) corresponds to Dp71e and shows a pI of 5.9 and a molecular mass of 68.5 kDa. The molecular mass values (kDa) are shown on the left, and the pH range is indicated at the top of the gel.

Characterization of the recombinant Dp71e protein

To determine the amino acid sequence of Dp71e, the cDNA cloned into the pGEM-T Easy vector, was subcloned into the pPROEX-1 vector (a prokaryotic expression vector) using the EcoRI and NotI sites. BL21 star cells were then transformed with the recombinant plasmid pPROEX-1/Dp71e, and the transformed cells were selected with ampicillin. Expression of Dp71e was induced with isopropyl thio-β-d-galactoside (IPTG). The recombinant Dp71e protein was fused to a histidine tail at its amino-terminal end (see the Materials and Methods) and had a theoretical weight of 71.54 kDa.

Once we had expressed, purified and concentrated the recombinant Dp71e (see the Materials and Methods), the protein was digested with trypsin and analyzed by MS. Using the MASCOT search algorithm (http://www.matrixscience.com), a large number of peptides belonging to the Dp71 isoform were identified (63% of the recombinant protein sequence converged; data not shown). Therefore, the amino acid sequence of the cloned and expressed cDNA is the same as that of the Dp71 isoform. The new carboxy-terminal region of the Dp71e protein was not identified because this sequence had not previously been reported for this protein family.

Discussion

The dystrophin carboxy-terminal end is a well-conserved region among dystrophin protein family members [18,26], and this region interacts with the complex of DAPs glycoproteins [5]. Mutations in this region appear to be more deleterious than alterations in other parts of dystrophin [3]. The importance of the carboxy-terminal end is also supported by the finding that this domain is always present in patients with BMD but not in those with DMD [27]. The Dp71 protein, which is synthesized from a promoter situated at intron 62 of the dystrophin gene, shares domains with full-length dystrophin; these domains include the carboxy-terminal domain. The Dp71 isoforms have half of the WW domain and a ZZ domain, which are sites required for interacting with β-dystroglycan [28,29]. It has been reported that a single amino-acid change in the ZZ domain (exons 68 and 69) can cause a DMD or a BMD phenotype [2,28]. The domain encoded by exons 74 and 75 is called a ‘coiled coil domain’ and is the region for α- and β-syntrophin interaction [20,30]. As a highly conserved domain, it has been shown to be involved in dystrophin heterodimerization [18,31]. However, little is known about the function of exons 78 and 79, although there is evidence that this region has a role in PC12 differentiation as well as in Dp71 localization [32] and is an important alternative splicing site that may be responsible for the generation of isoforms Dp71d or Dp71f [33].

Although specific roles of Dp71 isoforms have not been determined, it is known that this is the first dystrophin family member to be expressed in stem cells [34] and during embryonic development [13,14,35]. Dp71 expression has been shown to gradually increase from the embryo stage until the adult stage [36]. Furthermore, the intracellular localization of the Dp71 isoforms is different in brain cell types (hippocampal neurons and forebrain astrocytes) [21], possibly indicating different functions of Dp71 isoforms. On the other hand, it has been reported that the subcellular localization of Dp71a and Dp71ab isoforms in PC12 cells differs as a consequence of the carboxy-terminal regions present in each protein. It has been suggested that the last 13 amino acids encoded by exons 78 and 79 (Dp71a), which are replaced with 31 unique amino acids during the splicing process in the Dp71ab isoform, positively modulate the nuclear accumulation of Dp71a [23,37], and the absence of this region has a role in the localization of Dp71 at the plasma membrane [32]. These data increase the relevance of the amino acids encoded by exons 78 and 79 and allow further hypotheses to be made regarding the possibility of specific recognition by protein factors that may confer particular characteristics or a specific function or protein modification.

In this study, we have shown the existence of a new Dp71 isoform transcript that has a novel 3’ terminal end, termed ‘e’, in accordance with Dp71 nomenclature. This novel isoform is transcribed from the Dp71 promoter and therefore contains a specific sequence that codes for the Dp71 amino-terminal region as well as exons 63–77 (except for exon 71), which is shared with other isoforms reported in PC12 cells [23,25]. The novel Dp71e mRNA retains 34 bp of intron 77, which causes a frameshift and allows the translation of only 29 bp of this intron region owing to the presence of a stop codon that prevents the translation of exons 78 and 79. Analysis of the 34 nucleotides present in the intron 77 region using the web server blast Rat Sequences and the rat genome (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=10116) revealed that this nucleotide sequence is only encoded by the 3′ region of intron 77 of the dystrophin gene located in the X chromosome. This splicing event uses the pair GT–TG donor-acceptor splicing signal (Fig. 1), a noncanonical splice junction that occurs rarely in mammalian genomes [38]. This ‘e’ sequence encodes a new carboxy-terminal region composed of 10 new amino acids of primarily hydrophilic character (DLSASSSLYY); these could impose particular features on the remaining sequence of Dp71 compared with the Dp71a and Dp71ab isoforms. This novel Dp71 isoform has a molecular mass of 68.5 kDa and a pI of 5.9.

The carboxy-terminal region, encoded by exons 78 and 79, may undergo post-translational modifications, as observed in the case of glycosylation of the Dp71ab isoform; this modification yields an isoform with a molecular mass of about 80 kDa, unlike the 70-kDa Dp71a isoform [39]. Calderilla et al. showed that phosphorylation of the Dp71d isoform in the neuronal cell line PC12 occurs at serine and threonine residues and results in the preferential accumulation of this protein in the nucleus. Potential phosphorylation sites in Dp71 include serine 3538 in exon 75, serines 3616 and 3624 in exon 76 and threonine 3677 in exon 79 [41], according to the dystrophin protein and gene numbering. Because Dp71e does not allow the translation of exons 78 and 79, at least one of the possible phosphorylation sites will not be present in this isoform (threonine 3677); however, a prediction of phosphorylation sites using the web server NetPhos 2.0 (http://www.cbs.dtu.dk/services/NetPhos/) revealed that within the ‘e’ region, there is a new site that could be phosphorylated (serine 3667). Thus, this new isoform may have a biological function mediated by phosphorylation.

Because the expression of Dp71e mRNA and protein increase during the late stages of PC12 cell differentiation induced by NGF, we hypothesized that this new isoform may play an important role during the process of PC12 cell differentiation. Dp71 participates in cell adhesion and neurite outgrowth in PC12 cells [42,43] and binds to the nuclear matrix [44] during the late stages of PC12 neuronal differentiation.

A detailed characterization of Dp71e showed that the experimental Dp71e pI corresponded with the theoretical pI of 6.04. To better characterize the Dp71e protein, and considering that the amount of protein obtained from PC12 cells was very low, we decided to produce Dp71e cDNA from PC12 cells, clone it into the prokaryotic expression vector pPROEX-1 and express the protein in Escherichia coli. The recombinant protein was analyzed by MS; the web server Mascot found that the majority of the recombinant Dp71e peptides corresponded to Dp71. It is important to mention that because the ‘e’ region was not in the NCBI bank of sequences, the Mascot server did not find the last 10 amino acids.

We also found that Dp71e mRNA is expressed in several rat organs. Interestingly, some of the rat organs (brain, lung, testis and intestine) analyzed expressed a PCR product with a molecular mass that is slightly lower than expected. The brain PCR product was isolated, sequenced and showed the existence of a Dp71e transcript without exons 71–74 (Dp71ec). These findings are consistent with the previous discovery of Dp71 isoforms that have a splicing out of exons 71–74 (Dp71c). Apparently, the Dp71c isoform is of great importance because it is the first Dp71 isoform expressed during embryonic development [22,35] and in some cell types is the only isoform that is expressed [19].

Under the conditions used in this study, only the lung and heart tissues showed the expression of the Dp71e protein. It is possible that other tissues do not express enough Dp71e to be detected by the anti-e Ab.

On the other hand, the ‘e’ sequence was also found in the X chromosome of mouse and human genomes using the blast web server (Fig. 2B). Interestingly, the Dp71e transcript is also expressed in human HeLa and SH-SY5Y cell lines, suggesting that this isoform could have a function in humans. We also amplified the Dp71e mRNA from mouse tissues; the results obtained show that mouse organs (all those analyzed from rat) expressed the transcript except for skeletal muscle (data not shown). The ‘e’ sequence in the mouse genome is very similar to the corresponding sequence in rat and human (Fig. 2B).

Although this study reported two members of the dystrophin family that are subject to this new alternative splicing, it is necessary to determine whether other members of the dystrophin family that have been previously described (Dp427, Dp260, Dp140 or Dp116) are also affected by this alternative splicing. Correspondingly, experiments must be performed to determine whether this carboxy-terminal ‘e’ region has specific functions or confers new biochemical properties.

Regardless, our results increase the understanding of the complexity of dystrophin gene expression. The DMD gene is the largest gene so far reported in humans and is capable of synthesizing a large number of proteins. However, little is known about the functions of each of these proteins.

Materials and Methods

Cell culture

PC12 cell cultures were grown on collagen-coated plastic tissue-culture dishes in a medium containing 85% RPMI-1640, 10% heat-inactivated horse serum, 5% fetal bovine serum, 50 U·mL−1 of penicillin and 25 μg·mL−1 of streptomycin, at 37 °C in a water-saturated atmosphere with 5% CO2. The cultures were exposed to 50 ng·mL−1 of 2.5 S (sedimentation coefficient) neural growth factor (NGF) during periods of 1–12 days. The HeLa and SH-SY5Y cell lines were grown on plastic tissue-culture dishes in 90% DMEM (Dulbecco’s modified Eagle’s medium), 10% fetal bovine serum, 50 U·mL−1 of penicillin, 25 μg·mL−1 of streptomycin and 1 mm sodium pyruvate, at 37 °C in a water-saturated atmosphere with 5% CO2.

Dissection conditions

All procedures for animal care and use were carried out following federal and local regulations for animal care and use (CINVESTAV-IACUC; approved by the Mexican Official Norm: NOM-062-ZOO-1999). Adult male Wistar rats were decapitated at around 10 weeks of age and whole organs (brain, heart, lung, pancreas, kidney, intestine, testicle, eye, skeletal muscle and liver) were rapidly removed, frozen in liquid nitrogen and stored at −70 °C.

RT-PCR synthesis

Total RNA was extracted from undifferentiated and NGF-differentiated PC12 cells and from human-derived cell lines using the Trizol method [45], and then 5 μg of each RNA sample was primed with dystrophin-specific primer (dcDNA) (Table 1) or random hexamers for β-actin mRNA amplification and reverse transcribed using the Advantage RT-for-PCR Kit according to the manufacturer’s instructions (CLONTECH Laboratories, Inc., Takara Bio Inc., Shiga, Japan). This cDNA was used as a template for the recognition of each transcript by PCR using specific oligonucleotides. The sequence of the primers, PCR conditions and sizes of the amplified products are indicated in Table 1. A kinetic expression analysis of the Dp71e mRNA was performed by a PCR amplification assay using 20–38 cycles. Thirty-two cycles were required to obtain a semiquantitative expression analysis of this transcript.

PCR product analyses

An aliquot of each PCR reaction was electrophoresed in Tris-Borate-EDTA (TBE) buffer in 0.8% agarose gels. Gels were stained with ethidium bromide, and the PCR products were evaluated by measuring the fluorescence intensity of the bands with an image analyzer (Kodak Digital Science 1D Eastman Kodak Company, Rochester, New York, USA). At each developmental stage, the relative amount of mRNA produced from the target gene was calculated from the ratio of the percentage of the intensity of the target gene product to the percentage of the intensity of β-actin gene product. To purify the PCR products from agarose gels, the Rapid Gel Extraction System kit (Marligen Bioscience Inc. OriGene, Rockville, MD, USA) was used. Each PCR product was sequenced using the ABI PRISMTM Ready Reaction DyeDeoxyTM Terminator Cycle Sequencing Kit, and purified using CENTRI-SEP Columns (Life Technologies, Grand Island, New York, USA). The alignment analysis was performed using clustal x (http://www.clustal.org/).

Total protein extracts

The extraction of total protein was performed using a two-step protocol. Whole-tissue samples from three individual male rats were analyzed separately. A frozen sample of each tissue type was placed in liquid nitrogen and ground thoroughly to a very fine powder with a mortar and pestle. Rat organs (1 g) were homogenized at 4 °C in 500 μL of RIPA buffer [10 mm Tris/HCl, pH 7.2, 150 mm NaCl, 0.1% (weight by volume (w/v)) SDS, 1% (volume by volume (v/v)) Triton X-100, 1% (w/v) deoxycholate, 5 mm EDTA, containing a mixture of protease inhibitors] and centrifuged at 5000 g for 1 min. The supernatants were recovered and resuspended in electrophoresis sample buffer [75 mm Tris/HCl, 15% (w/v) SDS, 5% (v/v) β-mercaptoethanol, 20% (v/v) glycerol and 0.001% (w/v) Bromophenol Blue]. Protein extracts (100 μg) were resolved by 10% SDS/PAGE and then electrotransferred to nitrocellulose membranes. Protein concentrations were determined using BSA as a standard.

To analyze the PC12 cell line, the cells were washed twice with 1× NaCl/Pi (PBS) buffer. After a brief centrifugation, the cells were resuspended in 250 μL of RIPA buffer. The cells were then lysed by sonication to obtain the protein extracts. The extracts were centrifuged at 5000 g for 1 min, and the supernatants were recovered and resuspended in electrophoresis sample buffer.

Antibodies

A specific antibody that recognizes the unique last 10 residues of Dp71e was produced by Washington Biotechnology Inc. (Columbia, MD, USA). The antibody was an affinity-purified polyclonal antibody against the peptide DLSASSSLYY; this polyclonal antibody was named Dp71e Ab. The monoclonal antibody against β-actin was kindly donated by Dr Manuel Hernandez (Department of Cellular Biology, CINVESTAV, Mexico).

2D gel electrophoresis

2D gel electrophoresis was carried out using IPG strip gels (Bio-Rad). A sample containing 80 μg of total soluble protein was mixed with Lysis buffer containing thiourea and Tris with 0.5% (v/v) pH 3−10 IPG buffer in a final volume of 25 μL. IPG strips were placed onto the protein samples and allowed to passively rehydrate for 16–18 h. We used the focusing protocol for a 7-cm strip, pH 5–7 or pH 3–10, at 20 °C and a total of 20 000 Vh (volt hour). Following IEF, the strips were incubated in equilibration buffer [50 mm Tris/HCl (pH 8.8), 6 m urea, 30% (v/v) glycerol, 2% (w/v) SDS] containing 2% (w/v) dithiothreitol for 10 min with gentle oscillatory agitation, followed by incubation in the same equilibration buffer supplemented with 2.5% (w/v) iodoacetamide for the same period of time. For the second dimension, the IPG strips were placed onto polyacrylamide gels and overlaid with overlay agarose solution [60 mm Tris/HCl, pH 6.8, 60 mm SDS, 0.5% (w/v) agarose and 0.01% (w/v) Bromophenol Blue]. SDS/PAGE was carried out at a constant current of 100 V for 2.5 h. Molecular masses were determined using the PrecisionPlusProtein™ Standard (Bio-Rad, Laboratories Inc. CA, USA). For each sample, triplicate IPG strips and polyacrylamide gels were run in the same conditions.

Cloning and purification of recombinant Dp71e

The cDNA from undifferentiated PC12 cells was amplified by PCR using the primers rDp71F and rTAADp71abRNotI and the PCR product was ligated into the pGEM-T Easy vector according to the manufacturer’s instructions. Then, the E. coli BL21 star (DE3) strain (Invitrogen, Life Technologies, NY, USA) was transformed with the ligation mixture. Several colonies were analyzed by the PCR assay to characterize the Dp71 isoforms expressed in PC12 cells using the primer rDp7177F (complementary to the last part of the exon 77) and the primer 2296. The Dp71e cDNA cloned into the pGEM-T Easy vector was used as template for a PCR assay using oligonucleotides complementary to the 5′ and 3′ ends of the Dp71e cDNA with a terminal extension containing restriction sites for EcoRI and NotI for the cloning process (primers rATGDp71FEcoRI and rTAADp71abRNotI, respectively). The sequence of the primers, PCR conditions and sizes of the amplified products are given in Table 1. This PCR product was cloned into the expression vector pPROEX-1 using the EcoRI and NotI restriction sites (Life Technologies, NY, USA). Restriction and ligation reactions were performed according to the manufacturer’s protocols. For purification of recombinant Dp71e, transformed BL21 star strains were cultured overnight at 37 °C in LB (Luria–Bertani) medium containing 100 μg·mL−1 of ampicillin. A 1 : 50 dilution was then prepared in fresh medium, and 1 mm IPTG was added once the cultures reached an attenuance (600 nm) of 0.4. After 4 h of induction, the cells were concentrated 10-fold in lysis buffer [50 mm Tris, pH 8, 100 mm NaCl, 0.1 mm EDTA containing a mixture of protease inhibitors], incubated with 100 mg·mL−1 of lysozyme and lysed by sonication. Insoluble proteins and cell debris were removed by centrifugation, and the clear lysate was mixed 5 : 1 with nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA, USA) to purify His-tagged Dp71e, following the manufacturer’s protocol. Protein preparations were concentrated using 10-fold concentration of acetone and 1 mL of absolute ethanol; all incubations were performed overnight at −20 °C followed by centrifugation (5000 g, 15 min, 4 °C). Preparations were quantified by spectrophotometry using Protein Assay reagents (Bio-Rad) and BSA as a standard.

Liquid chromatography/electrospray ionization-MS/MS

The excised gel bands from 1D acrylamide gels were treated with 100 μL of destain solution [50% (v/v) methanol, 5% (v/v) acetic acid] and shaking for 5 min. After the solution was removed, each gel band was incubated with 200 mm ammonium bicarbonate (Sigma-Aldrich, St. Louis, MO, USA) for 20 min, cut into small pieces, completely dehydrated with 100% acetonitrile and vacuum-dried. In-gel digestion was performed by adding 30 μL of modified porcine trypsin solution (20 ng·μL−1; Promega, Madison, WI, USA) in 50 mm ammonium bicarbonate followed by overnight incubation at room temperature. Peptides were extracted twice with 50% (v/v) acetonitrile and 5% (v/v) formic acid for 30 min each time with sonication. The volume of the extracts was reduced by evaporation in a vacuum centrifuge and then adjusted to 20 μL with 1% (v/v) formic acid.

MS analysis was carried out on a 3200 Q TRAP hybrid tandem mass spectrometer (Applied Biosystems/MDS Sciex, Concord, ON, Canada) equipped with a nanoelectrospray ion source (NanoSpray II) and a MicroIonSpray II head. The instrument was coupled online to a nanoAcquity Ultra Performance LC System (Waters Corporations, Milford, MA, USA). Spectra were acquired in the automated mode using Information-Dependent Acquisition (IDA). The instrument operation conditions were as previously described [46]. Database searching and protein identification were performed with the MS/MS spectra data sets using the MASCOT search algorithm (version 1.6b9; Matrix Science, London, UK, available at http://www.matrixscience.com). Mass tolerances of 0.5 Da for the precursor and 0.3 Da for the fragment ion masses were used, and one missed cleavage for trypsin was allowed. Searches were conducted using the National Center for Biotechnology Information non-redundant database (http://www.ncbi.nih.gov).

Acknowledgements

We gratefully acknowledge Conacyt for support of this work (AS Doctoral Fellowship 183851 and CM Grants No. 37515M and 47026M). We thank Dr Guarneros’s group for technical assistance and equipment support, Dr Hernandez for his kind gifts of β-actin antibody and his technical assistance, and Adalberto Herrera and Veronica Ramirez for their technical and clerical assistance, respectively.

Ancillary