1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Miscanthus sinensis has high biomass yield and contributed two of the three genomes in M. x giganteus, a bioenergy crop widely studied in Europe and North America, and thus is a potential biomass crop and an important germplasm for Miscanthus breeding. Molecular markers are essential for germplasm evaluation, genetic analyses and new cultivar development in M. sinensis. In the present study, we reported transferability of simple sequence repeat (SSR) markers from Brachypodium distachyon to M. sinensis. A set of 57 SSR markers evenly distributed across the B. distachyon genome were deliberately designed. Out of these B. distachyon SSR markers, 86.0% are transferable to M. sinensis. The SSR loci amplified in M. sinensis were validated by re-sequencing the amplicons. The polymorphism information content (PIC) of the transferable SSR markers varied from 0.073 to 0.375 with a mean of 0.263, assessed based on 21 M. sinensis genotypes. Phylogenetic tree based on 162 alleles detected by 49 SSR markers could unambiguously distinguish B. distachyon from M. sinensis, and cluster 21 M. sinensis genotypes into three groups that are basically in coincidence with their geographical distribution and ecotype classifications. The markers developed by the comparative genomic approach could be useful for germplasm evaluation, genetic analysis, and marker-assisted breeding in Miscanthus.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Perennial grass crops as renewable energy sources are important for ensuring energy security and the reduction of negative impacts of grain-based ethanol production (Hill et al. 2006). Miscanthus is a typical C4 perennial grass species with high potential in energy production due to high biomass yields and ligno-cellulose (Lewandowski et al. 2000, 2003). A sterile triploid hybrid Miscanthus x giganteus, a cross between M. sacchariflorus and M. sinensis, has been proved to be a suitable biofuel crop in Europe (Price et al. 2004). The aboveground standing biomass is recorded up to 20–30 t/ha (Jorgensen and Schwarz 2000). Particularly, many mineral nutrients are recycled through leaf drop and in vivo re-translocation to rhizomes for next growing season, which leads to relative low establishment costs. Miscanthus (35.76 t/ha) is more than three times as productive as switchgrass (9.4 t/ha) (Khanna et al. 2008). Therefore, Miscanthus is an ideal plant species for producing fuel ethanol at a low cost. However, narrow genetic base of M. x giganteus limits the breeding for tolerance to environmental stresses and good adaptation to marginal lands prone to drought.

Miscanthus sinensis is one of the species in the genus Miscanthus and widely distributed in China, and has good adaptability and high genetic diversity. It contains two genomes of the three possessed by M. x giganteus. Therefore, priority could be given to using M. sinensis germplasm to enhance the genetic diversity of M. x giganteus hybrids. Despite the increasing importance of M. sinensis in research and production of biomass and bioenergy, we currently know little about the nature underlying traits related to utility of the grass as an energy crop. Better understanding of the genetics of biomass yield, cell-wall composition, nutrient uptake, abiotic and biotic stress tolerance, etc. is essential for designing appropriate strategies for efficient genetic improvement of Miscanthus.

Brachypodium distachyon (Brachypodium hereafter) is small temperate grass and has many attributes, including self-fertility, short lifecycle, simple growth requirements, small (∼271 Mbp) genome size, and efficient transformation (Vogel et al. 2010). The genome was recently sequenced and abundant genomic information is publically available. Therefore, Brachypodium is an excellent model organism in temperate grasses, cereals and dedicated biofuel crops such as Miscanthus.

Microsatellites (simple sequence repeats – SSRs) are among the most preferred types of molecular markers for their ubiquitous distribution in the genome and high polymorphism (Brown et al. 1996), and have been widely used for studies on genetic diversity, evolution, genetic map construction, and quantitative trait loci (QTL) and gene mapping (Cho et al. 2000; Peng et al. 2000, 2003). Conventional development of SSR markers in any species is costly and laborious because it involves library construction and clone sequencing. Plant genome research has been focused on major crops and model species (Arabidopsis Genome Initiative 2000; Yu et al. 2002; International Rice Genome Sequencing Project 2005; Vogel et al. 2010). A number of public SSR databases are available for the major crops and model plant species (;;; Comparative genetic analyses in the grass genomes showed significant conservation of molecular marker and gene order across several cereal crops (Gale and Devos 1998; Kellogg 1998; Bowers et al. 2005). Transferability of SSRs across species or genera has been reported in several crop families, such as Poaceae, cotton, Cruciferae and Leguminosae etc. (Peakall et al. 1998; Cordeiro et al. 2001; Holton et al. 2002; Thiel et al. 2003; Kuleung et al. 2004; Guo et al. 2005; Peng and Lapitan 2005; Varshney et al. 2005; Wang et al. 2005). Transferable SSR markers from gramineae species would be useful for the genetic analyses of Miscanthus.

A few research projects were conducted on the genetic diversity and linkage map construction of M. sinensis using random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) markers so far (Greef et al. 1997; Chou et al. 2000; Atienza et al. 2002; Hodkinson et al. 2002). Transferability of SSR markers and RFLP probes from maize to Miscanthus was 75% and 100%, respectively (Hernandez et al. 2001). The maize SSR primers were feasible to assess genetic diversity of Miscanthus species (Zhong et al. 2009). But the limited number of reliable SSR markers becomes a bottleneck for genetic analyses and molecular breeding of Miscanthus. The whole genome sequence of the new model grass Brachypodium became available recently, and a tremendous number of SSR sequences in the genome have been released (Vogel et al. 2010). This genomic resource may open a new door to the development of SSR markers for M. sinensis study. Therefore, the main objectives of the present study were to: (i) assess the transferability of Brachypodium SSR markers to M. sinensis; (ii) evaluate polymorphism of the transferable SSR markers in M. sinensis; and (iii) test efficiency of transferrable Brachypodium SSRs in phylogenetic analysis of M. sinensis.


  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Transferability of Brachypodium derived SSR markers to M. sinensis

The successful amplification of Brachypodium SSR markers in M. sinensis implies the transferability between these two species. Polymerase chain reaction (PCR) products of all the examined 57 pairs of SSR primers (Table 1) were clear and bright in the two control Brachypodium genotypes, indicating a successful design of the SSR markers. Of these 57 Brachypodium-derived primer pairs, 49 (86.0%) could produce amplicons and thus were defined as transferable. These transferable Brachypodium SSR markers could show polymorphism in M. sinensis. The other eight primer pairs (14.0%) could not amplify the M. sinensis DNAs and thus were not transferable. Out of the transferable Brachypodium SSR markers, 18 (31.0%) produced perfect, polymorphic, and easily-scoring bands. These markers should have priority for use in genetic analyses of M. sinensis.

Table 1. Primer sequences and characteristics of Brachypodium distachyon simple sequence repeat (SSR) markers, their transferability and average polymorphism information content (PIC) value in Miscanthus sinensis
Chromosome locationPrimer IDPrimer sequence (5′ to 3′)SSR feature in Brachypodium genomeTransferabilityaPolymorphism in M. sinensis
Motif/no. repeatsGenome locationPICNo. alleles
  1. a+, transferable; –, untransferable.

2DBM-28FCAAAAGCAGCACCAAAATCAGCTT/4Gene spacer and part overlap with Bradi2g62670+0.2552
3DBM-33FCTCAGAAAAGCCCATCTAGGGGCC/4Gene spacer and part overlap with Bradi3g45021+0.1132
4DBM-44FTCGTGGATGACTGGTAAGAGCCT/8Gene spacer and part overlap with Bradi4g17330
4DBM-48FGCTCACTTCTCACACTGACGACA/6Gene spacer and part overlap with Bradi4g30580+0.20813

As expected, not all Brachypodium SSR markers yielded identical product in M. sinensis as in the Brachypodium controls, Bd21 and ABR3 (Figure 1). The PCR amplification patterns of those transferable Brachypodium SSR markers in M. sinensis were complicated to some extent. The PCR bands of DBM19 and DBM27 were relatively faint in M. sinensis though the annealing temperature was lowered from 62 °C suitable for Brachypodium to 50 °C (Figure 1). Multiple bands were amplified in M. sinensis for 46.6% of the transferable Brachypodium SSR markers, e.g. DBM5 (Figure 1). Some produced stutter bands in M. sinensis. Multiple loci were amplified in M. sinensis for a single Brachypodium SSR marker, as shown in Figure 2. Brachypodium SSR markers DBM40 could amplify DNA fragments only in part of M. sinensis genotypes, indicating that the cross-species transferability of Brachypodium SSR markers is genotype-dependent (Figure 3).


Figure 1. Agarose gel-based polymerase chain reaction (PCR) patterns of 12 Brachypodium distachyon-derived simple sequence repeat (SSR) markers. Two Miscanthus sinensis (M) DNA pools and two Brachypodium distachyon (B) genotypes were tested for each primer pair.

Download figure to PowerPoint


Figure 2. Polyacrylamide gel electrophoresis (PAGE) gel-based polymerase chain reaction (PCR) amplification profile in Miscanthus sinensis and Brachypodium distachyon generated with the primer DBM48, which amplified multiple loci. Lanes 1–21 are the M. sinensis accessions listed in Table 2, and lanes 22 and 23 are the two B. distachyon genotypes, Bd21 and ABR3, respectively.

Download figure to PowerPoint


Figure 3. Agrose gel-based polymerase chain reaction (PCR) amplification profiles in Miscanthus sinensis and Brachypodium distachyon generated with the primer DBM40. Lanes 1 and 2 are the two B. distachyon genotypes, Bd21 and ABR3, respectively; lanes 3–23 are the M. sinensis accessions listed in Table 2; and lane 24 is a M. sinensis DNA pool.

Download figure to PowerPoint

Sequence analysis indicated that the eight untransferable Brachypodium SSRs (DBM7, DBM9, DBM13, DBM14, DBM23, DBM43, DBM44, and DBM52) were all derived from the non-coding region of the Brachypodium genome. Most of the transferable SSRs were derived from the coding regions of the Brachypodium genome (Table 1).

Sequence confirmation of transferable Brachypodium SSR markers

In the present study the amplified M. sinensis bands with size equal to or similar with that in Brachypodium were deemed allelic and otherwise non-allelic sites between these two species. Seven randomly selected allelic (DBM22–117, DBM15–132, DBM5–115) and non-allelic bands (DBM8–172, DBM18–163, DBM25–208 and DBM33–207) were exercised and sequenced to examine whether amplified fragments contain the target SSR motifs. The same SSR motif and repeat numbers were observed in M. sinensis for the allelic bands of DBM22–117 and DBM15–132 (Figures 4.1 and 4.2), and the sequence identities were all 100% between M. sinensis and Brachypodium. As for the allelic DBM5–115 (Figure 4.3), sequence of PCR amplicon in M. sinensis was not fully consistent with that in Brachypodium, indicating sequence variation occurred between the two species even in the target SSR motifs. For the other four non-allelic PCR amplicons from M. sinensis, the SSR motifs were all absent though the priming sites are identical with Brachypodium (Figures 4.4, 4.5, 4.6 and 4.7). Therefore, PCR-based transferability of Brachypodium SSR markers to M. sinensis does not necessarily imply that the PCR amplicons contain the SSRs identical to that in the target site of Brachypodium genome.


Figure 4. Sequence alignments between Miscanthus sinensis and Brachypodium distachyon for polymerase chain reaction (PCR) amplicons obtained with simple sequence repeat (SSR) markers, DBM22 (4.1), DBM15 (4.2), DBM5 (4.3), DBM8 (4.4), DBM18 (4.5), DBM25 (4.6), and DBM33 (4.7). The shaded nucleotide highlights the SSR motifs in B. distachyon and arrow indicates the primer sequences.

PIC of transferable SSR markers and genetic diversity analysis in M. sinensis

Polymorphic information content (PIC) describes discriminatory power of a polymorphic band by giving the frequency information of an allele or marker in a population. In the present study, all the 49 transferable markers were used to test a M. sinensis sample population consisting of 21 genotypes. The 49 transferable Brachypodium-derived SSR markers gave rise to 162, in total, discernible DNA fragments. Out of these 162 bands, 158 (97.53%) were polymorphic. As shown in Table 1, PIC values varied from 0.073 to 0.375 with a mean of 0.263 for the 49 transferable SSR markers, indicating a medium level and wide variation of PIC. The target SSR sequences are located in the exon, intron and gene spacer regions, respectively, in the Brachypodium genome (Table 1). Further analysis indicated that the average PIC of the exon SSRs (0.232 ± 0.090) was lower than that of both intron SSRs (0.249 ± 0.059) and gene spacer SSRs (0.279 ± 0.065).

Polymorphism information content values were also estimated for each of the seven re-sequenced markers shown in Figure 4. This polymorphism parameter was 0.351, 0.351, 0.201, 0.318, 0.208, 0.351 and, 0.146 for DBM22, DBM15, DBM5, DBM8, DBM18, DBM25 and DBM33, respectively. As shown in Figure 4, DBM22 and DBM15 are the perfect-matched SSR markers with identity of 100%, and other five are non-perfect matched markers with identity of 56–90% between M. sinensis and Brachypodium, and DBM8 is the poorest matched one with identity of 56%. PIC for both DBM22 and DBM15 is 0.351, and is quite variable among the other five non-perfect matched markers and the mean is 0.245. Therefore, there was some difference with respect to marker polymorphism between perfect-matched and non-perfect matched sequences of M. sinensis with Brachypodium.

The Nei's gene diversity (h) and Shannon index (I) were 0.320 0 and 0.486 1, respectively. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) cluster analysis based on Nei's genetic distance indicated that M. sinensis and Brachypodium could be unambiguously distinguished and the 21 M. sinensis genotypes were clustered into three groups. Group I consisted of four M. sinensis accessions, PMS232, PMS7, PMS364 and PMS427, most of which (except for PMS364) were collected from areas with relative high latitude ranging from 26°38.3′ to 30°47.7′N. Ten M. sinensis accessions, PMS295, PMS285, PMS308, PMS397, PMS339, PMS421, PMS278, PMS380, PMS249 and PMS314, were clustered into group II, which covered a large area with latitude ranging from 19°02.5′ to 31°14.9′N. The remaining seven accessions, PMS165, PMS161, PMS193, PMS144, PMS118, PMS129 and PMS90, were divided into group III and were collected from areas with high latitude, from 31°33.2′ to 37°20.2′ (Figure 5, Table 2). Based on the latitudes of place of origin of the M. sinensis accessions, both groups I and II are from South China, and group III is from North China. The 1st-year performance in Wuhan (central China) of the M. sinensis accessions (Table 2) showed that groups I and II belonged to an ecotype with features of late-/autumn-heading (mostly after 1 October) and tall stature (mean > 190 cm), and group III could be divided into an ecotype with features of early-/summer-heading (before 21 September) and short stature (mean = 158 cm). Therefore, phylogenetic cluster of the M. sinensis accessions thus is generally consistent with their geographical distribution and performance of ecotypic traits.


Figure 5. Neighbor-joining tree showing phylogenetic relationships among 21 Miscanthus sinensis accessions and two Brachypodium distachyon genotypes based on the 49 transferable simple sequence repeat (SSR)markers.

Download figure to PowerPoint

Table 2. The origin, geographical parameters and the 1st-year ecotypic traits of 21 Miscanthus sinensis accessions
   LatitudeLongitudeElevationPlant heightHeading date
CodeAcc.Place of origin(N)(E)(m)(cm)(month/day)
1PMS7Badong County, Hubei Province30°47.9′110°15.7′175819008/04
2PMS90Shenlongjia, Hubei Province31°33.2′110°20.8′167816409/08
3PMS118Hanzhong City, Shaanxi Province32°58.2′107°40.3′ 45823809/15
4PMS129Longnan City, Gansu Province33°04.0′104°42.8′173522409/04
5PMS144Baoji City, Shaanxi Province34°14.7′106°56.0′146717806/11
6PMS161Qingshui County, Shanxi Province35°43.3′112°19.5′ 72413409/10
7PMS165Xingtai City, Hebei Province37°20.2′114°16.8′ 34515809/08
8PMS193Xinyang City, Henan Province31°34.8′115°20.2′ 17924709/21
9PMS232Guiyang City, Guizhou Province26°38.3′106°37.2′130021510/19
10PMS249Wenshan County, Yunnan Province23°20.6′104°18.0′128919610/27
11PMS278Leping City, Jiangxi Province29°00.6′117°08.0′  2515710/06
12PMS285Huangshan City, Anhui Province29°38.6′118°09.5′ 17617710/01
13PMS295Suzhou City, Jiangsu Province31°14.9′120°24.1′  1420409/01
14PMS308Tonglu City, Zhejiang Province29°48.2′119°42.7′  2918409/30
15PMS314Ningde City, Fujian Province26°31.7′119°37.9′ 27921010/09
16PMS339Ruijin City, Jiangxi Province25°39.7′115°49.0′ 18017010/09
17PMS364Xinxing County, Guangdong Province22°30.8′112°11.8′ 42117210/18
18PMS380Qiongzhong City, Hainan Province19°02.5′109°46.6′ 307188Not flowering
19PMS397Liuzhou City, Guangxi Autonomous Region24°24.3′109°58.8′ 16431010/15
20PMS421Luxi County, Hunan Province28°14.0′109°52.5′ 15719710/08
21PMS427Chibi City, Hubei Province29°46.1′114°02.6′  7119010/01


  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Cross-transferability of SSR markers among gramineae species was extensively studied (Peng and Lapitan 2005; Wang et al. 2005). In the present study, we found that a high proportion (86.0%) of Brachypodium SSR markers is transferable and polymorphic in M. sinensis. These molecular markers will facilitate both the basic and applied researches including germplasm characterization and evaluation, breeding applications, and phylogenetic studies of Miscanthus species. It is a cost-effective way to develop molecular markers for new but important biomass crops, for example, M. sinensis, using the available genomic resources in model plant species like Brachypodium.

Theoretically, cross-species transferability of EST-SSRs is higher than that of genomic-SSRs because coding regions are more conserved than non-coding regions among related species (Chen et al. 2002; Chabane et al. 2005; Peng and Lapitan 2005). EST-SSRs are also expected to be less polymorphic within the species due to sequence conservatism (Varshney et al. 2005). In the present study, all the untransferable Brachypodium SSRs belonged to the category of genomic SSRs or located in the non-coding regions, and thus resulted in high transferability of EST-SSRs or coding SSRs (Table 1).

Simple sequence repeats are believed to be locus-specific, yet 49 of the 57 primer pairs gave multiple bands presumably due to amplification of more than one homoeolocus regardless of the kind of SSR markers, gSSR or eSSR in the present study (Holton et al. 2002). According to the analyzed sequence of nonallelic bands between Brachypodium and M. sinensis, the nature of most polymorphisms were found to be due to null alleles in one or more genotypes, rather than due to length difference caused by variation of a repeat number of SSR motif. The null alleles observed in the present study may be due to diverse sequence variation in the primer 3′-end binding sites in the genome of M. sinensis (Figure 3), which may result in failure of annealing and extension of PCR.

The fact that there is more than one dominant amplified fragment for almost all of the transferable SSRs, suggests that there are multiple sites identical to the two primers in the M. sinensis genome. Apart from this, other factors such as PCR reaction conditions may complicate the relationship of transferability (Dirlewanger et al. 2002). The annealing temperature is not identical between M. sinensis and Brachypodium as shown by several primer pairs in this study. For example, for DBM27, the annealing temperature of 62 °C is appropriate for Brachypodium while 50 °C is stringent for M. sinensis (Figure 1).

The tri-nucleotide SSRs are reported as the most abundant type of SSRs in the EST sequences in several crop species. Tri-nucleotide SSRs in coding regions could reduce frameshift mutations and escape mutation pressure and positive selection and it may be a reason for the predominance of tri-nucleotide SSR (Metzgar et al. 2000; Morgante et al. 2002; Varshney et al. 2002; Peng and Lapitan 2005). Therefore the tri-nucleotide SSRs are popular and conservative in coding regions across species during the evolution of species. The tri-nucleotide repeats SSRs markers harboring the code sequence were all transferable and in this study, while five out of eight non-transferable SSRs markers were tri-nucleotide repeats in gene spacer regions or UTR regions (Table 1).

One of the main objectives of the present study was to demonstrate the potential of the transferable Brachypodium SSR markers in polymorphism detection in M. sinensis. Our results showed that two Brachypodium genotypes as a control were clearly separated at the node based on the dendrogram generated by UPGMA cluster analysis. The PIC values, a reflection of allele diversity and frequency among the examined genotypes and a parameter indicating the degree of informativeness of a marker, obviously varied among the transferable SSR markers with a medium level of mean value (0.263). It is pointed out that markers ought to have many alleles to be considered useful for the evaluation of genetic diversity (Ribeiro-Carvalho et al. 2004). The multiple-locus amplification and medium PIC values (Table 1) indicated the effectiveness of the transferable Brachypodium SSR markers in germplasm evaluation, genetic analysis and molecular breeding in Miscanthus. For those re-sequenced loci (Figure 4), there was some difference for marker polymorphism between perfect-matched and non-perfect matched sequences of M. sinensis with Brachypodium, and perfect-matched SSRs generated higher polymorphism (mean PIC = 0.351) than the non-perfect matched ones (mean PIC = 0.245). This is perhaps because of the existence of SSR motifs amplified by the perfect-matched SSR markers. The result of phylogenetic analysis based on the transferable markers is basically in coincidence with the geographical distribution and ecotype classification of M. sinensis accessions (Figure 5, Table 2). Therefore, Brachypodium SSR-derived transferable markers are efficient to conduct phylogenetic analysis in M. sinensis, and a large scale of genetic diversity evaluation and phylogenetic analysis of M. sinensis using these transferable markers are under way in Wuhan Botanical Garden, the Chinese Academy of Sciences.

A recent study showed that the monosaccharide composition of Miscanthus is similar to that of Brachypodium, barley and wheat, while it is significantly different from that of Arabidopsis (Gomez et al. 2008). In particular, the molecular evolution research has proven that Brachypodium is more closely related to cool season grass crops that grow in temperate environments than rice, which implies the possibility that Brachypodium provides profound insights into the molecular functions as feedstock for conversion to biofuels such as ethanol (Draper et al. 2001). The high transferability of Brachypodium SSR markers to M. sinensis in this study confirms the significance of Brachypodium as a model plant for Miscanthus.

High SSR transferability also has been widely reported between Brachypodium and other gramineae species, wheat, barley, oat etc. (Kumar et al. 2009). The SSRs developed by comparative genomics approach could be effectively used in cross-species trait introgression breeding (Castillo et al. 2008). The SSR markers developed based on genomic resources of Brachypodium could be greatly useful for germplasm evaluation, genetics and breeding research in Miscanthus.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Development of Brachypodium SSR markers

A set of 57 SSR markers evenly distributed across the Brachypodium distachyon (Brachypodium) genome were deliberately designed using BatchPrimer3 (You et al. 2008) based on the available genomic sequence (Vogel et al. 2010). The SSR primer sequences and characteristics of the SSRs are listed in Table 1. Transferability of these SSR markers to Miscanthus sinensis are also shown in Table 1.

Plant materials

Rhizomes of 21 accessions of Miscanthus sinensis Anderss (2n= 2x= 38) were collected from the wild, which covered a large and diverse geographical region (19°02.5′-37°20.2′N for latitude, 104°42.8′–120°24.1′E for longtitude, and 14–1 758 m for altitude) in China (Table 2), and were planted in Wuhan Botanical Garden, the Chinese Academy of Sciences, in spring 2009. The places of origin of these samples included multiple types of climatic conditions, such as tropics, temperate zone, cold zone, alpine, plateau, forest and basin climate. Two Brachypodium accessions, Bd21 and ABR3, were also included in the experiment as positive controls. The 1st-year ecotypic traits of the 21 M. sinensis genotypes, heading date and plant height, were observed (Table 2).

DNA extraction and PCR amplification

Young leaf tissues were collected from the above-described plant materials and immediately grinded in liquid nitrogen into a fine powder. DNA was isolated using conventional CTAB method (Doyle and Doyle 1990). The DNA concentration was determined by comparing band intensity with λDNA standards of known concentration (Promega, Madison, WI, USA) under UV light using 1.0% (w/v) agarose gel electrophoresis and ethidium bromide staining.

Two Brachypodium (Bd21 and ABR3) DNA samples and two M. sinensis DNA pools (each consisted of 10 genotypes) and were amplified using the designed Brachypodium SSR markers (Table 1). The PCR amplifications were performed on an BIORAD-My Cycle Thermocyclers (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in 20 μL of a reaction system containing 1×PCR buffer, 1.8 mM MgCl2, 200 μM each dNTPs, 500 nM of each primer, 1 U of Taq DNA polymerase. A touchdown PCR program was used in this study. An initial denaturation step at 94 °C for 3 min was applied; 10 touchdown cycles were followed with 94 °C for 30 s, 62 °C (decreased 0.5 °C per cycle) for 30 s and 72 °C for 45 s; then 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 45 s were performed. The PCR was terminated with a final extension step at 72 °C for 10 min.

The PCR products were separated using agarose gel (2.5%) electrophoresis and visualized using EtBr staining. The successful amplification in M. sinensis means that the corresponding Brachypodium SSR is transferable (Figure 1, Table 1).

Confirmation of SSR sequences amplified in M. sinensis

Seven target bands amplified in M. sinensis using Brachypodium SSR markers were recycled as follows. Each of the seven fragments was excised from polyacrylamide gel and soaked in 12 μL of ddH2O in a 1.5 mL eppendorf tube. The gel was crushed using a clean pipette tip and incubated in a boiling water-bath for 10 min. After centrifugation, 4 μL of the supernatant was used as the template for PCR amplification with specific primer pairs, and the annealing temperature was optimized to produce clear target band. A fraction of the PCR product was separated on a 6% polyacrylamide gel to verify the presence of the target bands. The PCR products containing target bands were then sequenced in the Beijing Genomics Institute, and the results are presented in Figure 4.

Polymorphism test of the M. sinensis samples using transferable Brachypodium SSR markers

Forty-nine transferable SSR markers (Table 1) were used to amplify DNA samples of the 21 selected individual M. sinensis accessions (Table 2) and the above-mentioned two Brachypodium accessions. The PCR products were separated on a 6% denaturated polyacrylamide gel and visualized with silver staining.

Each of the PCR bands was scored as “1” for presence and “0” for absence. The polymorphism information content (PIC) was calculated for each SSR marker by the formula: inline image, where pi is the frequency of the ith allele; n is the total number of alleles (Anderson et al. 1993), which provides an estimate of the discriminating power of a locus by taking into account not only the number of alleles but also their relative frequencies in the studied population.

POPGENE software (Yeh and Yang 2000) was used to calculate the genetic diversity index and genetic distance among the M. sinensis accessions. Then the matrix of genetic distances was formatted with the neighbor PHYLIP program to generate outfile and outtree. Subsequently a phylogenetic neighbor-joining tree (Figure 5) was constructed based on the genetic distance matrix by UPMGA method (Sokal and Michener 1958) and TreeView was used to view the result (Page 1996).

(Co-Editor: Martin A. J. Parry)


  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

This study was supported in part by the Chinese Academy of Sciences under the Important Directional Program of Knowledge Innovation Project (KSCX2-YW-Z-0722 and KSCX2-YW-G-036), and the National Natural Science Foundation of China (30870233).


  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  • Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrells ME (1993) Optimizing parental selection for genetic linkage maps. Genome 36, 181186.
  • Atienza G, Satovic Z, Petersen K, Dolstra O, Martín A (2002) Preliminary genetic linkage map of Miscanthus sinensis with RAPD markers. Theor. Appl. Genet. 105, 946952.
  • Bowers JE, Arias MA, Asher R, Avise JA, Ball RT, Brewer GA, Buss RW, Chen AH, Edwards TM, Estill JC et al. (2005) Comparative physical mapping links conservation of microsynteny to chromosome structure and recombination in grasses. Proc. Natl. Acad. Sci. USA 102, 1320613211.
  • Brown SW, Szewc-McFadden AK, Kresovichi S (1996) Development and application of simple sequence repeat (SSR) loci for plant genome analysis. In JauharPP, ed. Methods of Genome Analysis in Plants. CRC, Boca Raton , Fla . pp. 147159.
  • Castillo A, Budak H, Varshney RK, Dorado G, Graner A, Hernández P (2008) Transferability and polymorphism of barley EST-SSR markers used for phylogenetic analysis in Hordeum chilense. BMC Plant Biol. 8, 97.
  • Chabane K, Ablett GA, Cordeiro GM (2005) EST versus genomic derived microsatellite markers for genotyping wild and cultivated barley. Genet. Resour. Crop Evol. 52, 903909.
  • Chen X, Cho Y, McCouch S (2002) Sequence divergence of rice microsatellites in Oryza and other plant species. Mol. Genet. Genomics 268, 331343.
  • Chou CH, Chiang YC, Chiang TY (2000) Genetic variability and phytogeography of Miscanthus sinensis var. condensatus, an apomictic grass, based on RAPD fingerprints. Can. J. Bot. 78, 12621268.
  • Cho YG, Ishii T, Temnykh S, Chen X, Lipovich L, McCouch SR, Ayres N, Cartinhour S (2000) Diversity of microsatellites derived from genomic libraries and GenBank sequences in rice (Oryza sativa L.). Theor. Appl. Genet. 100, 713722.
  • Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ (2001) Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant Sci. 160, 11151123.
  • Hill J, Nelson E, Tilman D, Polasky S, Tiffany D (2006) Environmental, economic, and energetic costs and benefits of biodiesel and ethanol biofuels. Proc. Natl. Acad. Sci. USA 103, 1120611210.
  • Dirlewanger E, Cosson P, Tavaud M, Aranzana MJ, Poizat C, Zanetto A, Arús P, Laigret F (2002) Development of microsatellite markers in peach (Prunus persica (L.) Batsch) and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor. Appl. Genet. 105, 127138.
  • Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12, 1315.
  • Draper J, Mur LA, Jenkins G, Ghosh-Biswas GC, Bablak P, Hasterok R, Routledge APM (2001) Brachypodium distachyon. A new model system for functional genomics in grasses. Plant Physiol. 127, 15391555.
  • Gale MD, Devos KM (1998) Comparative genetics in the grasses. Proc. Natl. Acad. Sci. USA 95, 19711974.
  • Gomez LD, Bristow JK, Statham ER, McQueen-Mason SJ (2008) Analysis of saccharification in Brachypodium distachyon stems under mild conditions of hydrolysis. BMC Biotechnol. Biofuels 115.
  • Greef JM, Deuter M, Jung C, Schondelmaier J (1997) Genetic diversity of European Miscanthus species revealed by AFLP fingerprinting. Genet. Resour. Crop Evol. 44, 185195.
  • Guo WZ, Fang D, Yu WD, Zhang TZ (2005) Sequence divergence of microsatellites and phylogeny analysis in tetraploid cotton species and their putative diploid ancestors. J. Integr. Plant Biol. 50, 14181430.
  • Hernandez P, Dorado G, Laurie DA, Martin A, Snape JW (2001) Microsatellites and RFLP probes from maize are efficient sources of molecular markers for the biomass energy crop Miscanthus. Theor. Appl. Genet. 102, 616622.
  • Hodkinson TR, Chase MW, Renvoize SA (2002) Characterization of a genetic resource collection for Miscanthus (Saccharinae, Andropogoneae, Poaceae) using AFLP and ISSR-PCR. Ann Bot. 89, 627636.
  • Holton TA, Christopher JT, McClure L, Harker N, Henry RJ (2002) Identification and mapping of polymorphic SSR markers from expressed gene sequences of barley and wheat. Mol. Breed. 9, 6371.
  • Jørgensen U, Schwarz KU (2000) Why do basic research? A lesson from commercial exploitation of Miscanthus. New Phyt. 148, 190193.
  • Kellogg EA (1998) Relationships of cereal crops and other grasses. Proc. Natl. Acad. Sci. USA 95, 20052010.
  • Khanna M, Dhungana B, Clifton-Brown J (2008) Costs of producing Miscanthus and switchgrass for bioenergy in Illinois. Biom. Bioen. 32, 482493.
  • Kuleung C, Baenziger PS, Dweikat I (2004) Transferability of SSR markers among wheat, rye, and triticale. Theor. Appl. Genet. 108, 11471150.
  • Kumar S, Mohan A, Balyan HS, Gupta PK (2009) Orthology between genomes of Brachypodium, wheat and rice. BMC Res. Notes. 2, 93.
  • Lewandowski I, Clifton-Brown JC, Andersson B, Basch G., Christian DG, Jørgensen U, Jones MB, Riche AB, Schwarz KU, Tayebi K, Teixeira F (2003) Biofuels: Environment and harvest time affects the combustion qualities of Miscanthus genotypes. Agron. J. 95, 12741280.
  • Lewandowski I, Clifton-Brown JC, Scurlock JMO, Huisman W (2000) Miscanthus: European experience with a novel energy crop. Biom. Bioen. 19, 209227.
  • Metzgar D, Bytof J, Wills C (2000) Selection against frameshift mutations limits microsatellite expansion in coding DNA. Genome Res. 10, 7280.
  • Morgante M, Hanafey M, Powell W (2002) Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nat. Genet. 30, 194200.
  • Page RDM (1996) TreeView: An application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357358.
  • Peakall R, Gilmore S, Keys W, Morgante M, Rafalski A (1998) Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the Genus and other legume genera: Implications for the transferability of SSRs in plants. Mol. Biol. Evol. 15, 12751287.
  • Peng JH, Korol AB, Fahima T, Röder MS, Ronin YI, Li YC, Nevo E (2000) Molecular genetic maps in wild emmer wheat, Triticum dicoccoides: genome-wide coverage, massive negative interference, and putative quasi-linkage. Genome Res. 10, 5091531.
  • Peng JH, Ronin YI, Fahima T, Röder MS, Li YC, Nevo E, Korol AB (2003) Domestication quantitative trait loci in Triticum dicoccoides, the progenitor of wheat. Proc. Natl. Acad. Sci. USA 100, 24892494.
  • Peng JH, Lapitan NLV (2005) Characterization of EST-derived microsatellites in the wheat genome and development of eSSR markers. Funct. Integr. Genomics. 5, 8096.
  • Price L, Bullard M, Lyons H, Anthony S, Nixon P (2004) Identifying the yield potential of Miscanthus×giganteus: an assessment of the spatial and temporal variability of M.×giganteus biomass productivity across England and Wales. Biom. Bioen. 26, 313.
  • Ribeiro-Carvalho C, Guedes-Pinto H, Igrejas G, Stephenson P, Schwarzacher T, Heslop-Harrison JS (2004) High levels of genetic diversity throughout the range of the Portuguese wheat landrace ‘Barbela’. Ann. Bot. 94, 699705.
  • Sokal RR, Michener CD (1958) A statistical method for evaluating systematic relationships. Univ. Kans. Sci. Bull. 28, 14091438.
  • The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature. 408, 796815.
  • The International Rice Genome Sequencing Project (2005) The map-based sequence of the rice genome. Nature 436, 793800.
  • Thiel T, Michalek W, Varshney RK, Graner A (2003) Exploiting EST database for the development and characterization of gene-derived SSR-rnarkers in barley (Hordeum vulgare L.). Theor. Appl. Genet. 106, 411422.
  • Vogel JP, Garvin DF, Mockler TC, Schmutz J, Rokhsar D, Bevan MW, Barry K, Lucas S, Harmon-Smith M, Lail K et al. (2010) The International Brachypodium Initiative Genome sequencing and analysis of the model grass Brachypodium distachyon. Nature 463, 763768.
  • Varshney RK, Sigmund R, Borner A, Korzun V, Stein N, Sorrells ME, Langridge P, Graner A (2005) Interspecific transferability and comparative mapping of barley EST-SSR markers in wheat, rye and rice. Plant Sci. 168, 195202.
  • Varshney RK, Thiel T, Stein N, Langridge P, Graner A (2002) In silico analysis on frequency and distribution of microsatellites in ESTs of some cereal species. Cell Mol. Biol. Lett. 7, 537546.
  • Wang ML, Barkley NA, Yu JK, Dean RE, Newman ML, Sorrells ME, Pederson GA (2005) Transfer of simple sequence repeat (SSR) markers from major cereal crops to minor grass species for germplasm characterization and evaluation. Plant Genet. Resour. 3, 4557.
  • Yeh FC, Yang RC (2000) POPGENE Version 1.32. University of Alberta and Center for International Research,*fyeh/
  • You FM, Huo N, Gu YQ, Luo MC, Ma Y, Hane D, Lazo GR, Dvorak J, Anderson O (2008) BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinformatics 9, 253.
  • Yu J, Hu S, Wang J, Wong GK, Li S, Liu B, Deng YJ, Dai L, Zhou Y, Zhang XQ et al. (2002) A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, 7992.
  • Zhong ZL, Jiang JX, Yang L, Yi ZL (2009) Genetic diversity analysis of Miscanthus species by maize SSR primers. Prog. Mod. Biomed. 9, 20762079.