SEARCH

SEARCH BY CITATION

Keywords:

  • Detachment;
  • senescence;
  • senescence associated gene;
  • stress;
  • wheat

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Leaf senescence is induced or accelerated when leaves are detached. However, the senescence process and expression pattern of senescence-associated genes (SAGs) when leaves are detached are not clearly understood. To detect senescence-associated physiological changes and SAG expression, wheat (Triticum aestivum L.) leaves were detached and treated with light, darkness, low temperature (4 °C), jasmonic acid (JA), abscisic acid (ABA), and salicylic acid (SA). The leaf phenotypes, chlorophyll content, delayed fluorescence (DF), and expression levels of two SAGs, namely, TaSAG3 and TaSAG5, were analyzed. Under these different treatments, the detached leaves turned yellow with different patterns and varying chlorophyll content. DF significantly decreased after the dark, ABA, JA and SA treatments. TaSAG3 and TaSAG5, which are expressed in natural senescent leaves, showed different expression patterns under various treatments. However, both TaSAG3 and TaSAG5 were upregulated after leaf detachment. Our results revealed senescence-associated physiological changes and molecular differences in leaves, which induced leaf senescence during different stress treatments.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Senescence is the last stage of plant development. During leaf senescence, chlorophyll and other macromolecules such as proteins, lipids, and nucleic acids are degraded, resulting in sharply decreased leaf photosynthetic activity (Gan and Amasino 1997; Lim et al. 2007). Based on this phenomenon, various physiological assays have been established to quantify leaf senescence, such as chlorophyll content, photochemical efficiency, associated enzyme activities, change in protein levels, membrane ion leakage, etc. (Ren et al. 2007; Zhou et al. 2009; Guo and Gan 2012).

Apart from age and developmental progress, leaf senescence and senescence-associated genes (SAGs) can be induced by other factors, such as plant hormones, pathogen infection, and environmental stresses (Guo and Gan 2012). Leaf development is a complex process that encompasses a larger number of gene expression changes. Transcription analysis of senescing leaves of Arabidopsis has revealed that the expression of numerous genes in senescent leaves is downregulated (CAB2, RPS and RBC). However, the expression of up to 2500 genes is also upregulated (Guo et al. 2004; van der Graaff et al. 2006).

Leaf senescence is usually controlled by various external and internal factors. External factors include light, temperature, drought, ozone, nutrient deficiency, pathogen infection, and more (Gan and Amasino 1997; Lim et al. 2007). These environmental factors have a distinct effect on plant growth and development (Lim et al. 2007). Various hormones act as internal factors that significantly affect leaf development, including abscisic acid (ABA), auxin, gibberellic acid (GA), jasmonic acid (JA) or methyl jasmonate (MJ), and salicylic acid (SA) (Hinderhofer and Zentgraf 2001; Zhou and Gan 2009).

Some plant hormones can promote leaf senescence. For example, previous studies have shown that mutants etr1-1 and ein2 involved in the ethylene-signaling pathway showed delayed leaf senescence (Grbic 1995; Oh et al. 1997). Exogenously-applied ethylene induces premature leaf senescence in Arabidopsis. Ethylene-induced leaf senescence depends on age-related changes and onset of leaf death genes (Jing et al. 2005). Recently, the network of plant responses to ethylene has been reported (An et al. 2010). SAG113, reportedly a negative regulator of ABA signal transduction, is expressed in senescing leaves and is induced by ABA in Arabidopsis. Furthermore, it is specifically involved in the control of water loss during leaf senescence (Zhang et al. 2012). AtSARK, an Arabidopsis homolog of a soybean dual-specificity, senescence-associated receptor-like kinase, was found to regulate leaf senescence via the synergistic actions of auxin and ethylene (Xu et al. 2011). ACS7, which encodes ACC synthase, acts as a negative regulator of ABA sensitivity and its accumulation under stress, and acts as a node in the crosstalk between ethylene and ABA (Dong et al. 2011).

Wheat is one of the most important grain crops worldwide. With population growth and the reduction of land resources, the annual growth rate of wheat yield is becoming lower than its consumption. Therefore, wheat yield and the quality of this yield must be improved. Delayed leaf senescence and stay-green variants of maize, sorghum, and rice are currently used to increase the yield of these grain crops (Kajimura et al. 2010). NAM-B1 in wheat has been shown to be involved in leaf senescence. Reducing the expression of NAM-B1 homologs using RNAi delays senescence by more than 3 weeks and reduces wheat grain protein, zinc, and iron content by more than 30% (Uauy et al. 2006).

To date, dozens of SAGs have been identified in the model plant Arabidopsis (Quirino et al. 2000; Buchanan-Wollaston et al. 2003; Guo et al. 2004). The cysteine protease-encoding gene SAG12 is specifically activated during the later stages of developmentally-controlled senescence (Gan and Amasino 1997), and is widely used as a molecular marker for leaf senescence. The transcription factor gene WRKY53 is induced at the onset of leaf senescence (Hinderhofer and Zentgraf 2001), and is also used as a SAG marker (Ay et al. 2009; Zentgraf et al. 2010).

Chlorophyll breakdown is an integral process of senescence and is also the final part of leaf development. During leaf senescence, plants degrade chlorophyll to form colorless linear tetrapyrroles that are stored in the vacuoles of senescing cells (Ren et al. 2010; Sakuraba et al. 2012). The spontaneous fluorescence of chloroplasts can be used to measure the chlorophyll content of plant leaves and the efficiency of photosynthesis. Delayed fluorescence (DF), also called delayed chlorophyll fluorescence or delayed light emission, was discovered in 1951 (Strehler and Arnold 1951), and is used in plant photosynthetic research (Zhang et al. 2007; Goltsev et al. 2009).

There are two main experimental approaches to measuring DF: (a) recording DF decay in the dark after a single turnover flash or after continuous light excitation, and (b) recording DF intensity during the light adaptation of photosynthesizing samples (induction curves), followed by a period of darkness (Goltsev et al. 2009). In senescent leaves photosynthetic capacity is significantly reduced, but chlorophyll content alone cannot reliably predict photosynthesis level. In some cases, senescent leaves still contain chlorophyll, but the photosynthesis level is a direct reflection of the leaf senescence. However, studies on the relationship between DF and plant leaf senescence are very limited.

Most studies report specific gene expression patterns as related to specific biotic or abiotic stresses. However, there are many differences at the physiological and molecular levels between different stresses applied to Arabidopsis (van der Graaff et al. 2006). The differences of detached wheat leaves under various stresses at the physiological and molecular levels have not been elucidated, especially in hormone-induced leaf senescence. The wheat genome is very complex; thus, studies on mechanisms of SAGs are very difficult. Previous studies have suggested that nine wheat SAG cDNA clones, namely, TaSAG1 to TaSAG9, can be used as developmental markers in wheat (Kajimura et al. 2010). However, there are no more details on the use of these SAGs.

In this study, 30-d-old wheat leaves were detached and subjected to various treatments. Phenotypes were documented by photography, chlorophyll content was determined by Lambert-Beer's law, DF values were quantified using a Perkin Elmer TopCount NXT Microplate Scintillation and Luminescence Counter, and the expression patterns of two SAG genes, TaSAG3 and TaSAG5, were analyzed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Our results revealed senescence-associated physiological changes and molecular differences in leaves subjected to various stresses, which induced leaf senescence.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Identification and analysis of TaSAGs in wheat leaves

To identify wheat SAG genes in the natural senescence process, we collected leaves at four different developmental stages (Figure 1A): young leaves with half the size of fully expanded mature leaves (Y), mature leaves (M), early senescent leaves with less than 15% of the leaf area yellowing (ES), and late senescent leaves with more than 50% of the leaf area yellowing (LS). Mature leaves had higher chlorophyll content than young ones, and the chlorophyll content gradually decreased with the senescence progress (Figure 1B). We selected four candidate SAG genes to investigate the expression profiles by semi-quantitative RT-PCR (Figure 1C). TaSAG3 increased and had the highest transcriptional level in the late senescent leaves. TaSAG5 was only expressed in the late senescent stage and was not detected in the other stages. TaSAG8 had a relatively high expression in all four stages and had much higher levels in mature and late senescent leaves. TaSAG9 was highly expressed in mature and early senescent leaves, but lowly expressed in young and late senescent leaves. These transcription level data indicated that TaSAG3 and TaSAG5 were better molecular markers than TaSAG8 and TaSAG9 in wheat leaf senescence analysis. Therefore, we used TaSAG3 and TaSAG5 in our experiment.

image

Figure 1. TaSAG expression profiles during natural leaf senescence.  (A) Leaves used in this study.  (B) Chlorophyll content of leaves during different developmental stages. The mean ±SE of four repeats are shown.  (C) Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis of TaSAG genes. β-Actin was amplified as an internal control.  ES, early senescent leaves; LS, late senescent leaves; M, mature leaves; Y, Young leaves.

Download figure to PowerPoint

Chlorophyll content analysis under various treatments

Plant hormones such as SA, ABA and JA can regulate plant senescence directly and indirectly. Each hormone has its own regulation mechanism of leaf senescence (van der Graaff et al. 2006); thus, physiological changes varied under different treatments. To elucidate these physiological changes and their molecular differences, 30-d-old wheat leaves were detached and subjected to various treatments. Chlorophyll content, DF, and SAG expression were analyzed. Figure 2 shows the phenotypes of the wheat leaves 0, 1, 2, 3, 5, and 7 d after various treatments. The hormone-induced leaf yellowing phenotypes (Figure 2B) were more obvious and significant. The chlorophyll content of all samples was determined by Lambert-Beer's law (Figure 3). The chlorophyll content was 1.5–2.0 mg/g fresh weight (FW) before treatment. When the leaves were treated using a normal light cycle for 1 d, the chlorophyll content increased to 2.65 mg/g FW (Figure 3). Under light, dark, ABA, and low temperature treatments, the chlorophyll content increased after 1 d or 2 d, and then decreased. The leaves had no senescent phenotypes under low temperature treatment (Figure 2A), and had a high chlorophyll level content after 1, 2, 3, and 5 d of treatment (Figure 3). The most obvious decline in chlorophyll content was observed in the JA and SA treatments. Under the JA treatment, the content declined to 0.8 mg/g FW only 1 d after treatment, and the leaf senescent phenotype was obvious (Figure 2B). After 2 d of treatment, the chlorophyll content was very significantly decreased, and was about half of that 1 d after SA treatment. Under ABA treatment, there was no obvious change after 1, 2, and 3 d of treatment. However, there was a very significant reduction in chlorophyll content and an obvious senescent phenotype after 5 and 7 d of ABA treatment (Figures 2B, 3).

image

Figure 2. Phenotypes of wheat leaves under various treatments.  Thirty-d-old wheat leaves were detached and subjected to various treatments.  (A) Phenotypes of leaves under light (16 h light/8 h dark), dark and low temperature (4 °C, LT) treatments.  (B) Phenotypes of leaves under abscisic acid (ABA), salicylic acid (SA), and jasmonic acid (JA) treatments.  Detached leaves were harvested 0, 1, 2, 3, 5, and 7 d after treatment, and photographed by an HD Smart Camera (Canon, Japan). DAT, day after treatment.

Download figure to PowerPoint

image

Figure 3. Chlorophyll contents of wheat leaves shown in Figure 2 under various treatments.  The means ±SE of four samples are shown. ABA, abscisic acid; DAT, day after treatment; JA, jasmonic acid; SA, salicylic acid.

Download figure to PowerPoint

DF measurement of detached leaves under various treatments

Spontaneous fluorescence directly reflects the photosynthetic rate of leaf chloroplasts. In our experiment, spontaneous fluorescence data were collected at 5, 35, 65, and 95 s after 5 min of illumination (56 μmol m–2 s–1) by LED light. The count per second of 30-d-old leaves was up to 40 000 at 5 s and rapidly decreased as time progressed (Figure S1). Low temperature did not seem to affect the chloroplast structure. Thus, there were no significant differences between 0 d and 7 d after treatment, and the photosynthesis rate remained high (Figure 4). The most sensitive changes in DF were detected in the SA and JA treatments. After 3 d of SA treatment, DF was close to 0 at 5 s. The leaves had certain differences under light and dark treatments; there was not much difference between 1 and 2 d of treatment, but DF after 3 d of dark treatment was only 5 000, which was about 20% of DF under light treatment. DF after ABA treatment was similar to that under dark treatment after 1 and 2 d. However, after 3 d of ABA treatment, DF was 25 000, which was higher than that after dark treatment. As in JA and SA treatments, DF was not detected after 7 d of ABA treatment (Figure 4).

image

Figure 4. Delayed fluorescence (DF) value analysis of wheat leaves shown in Figure 2.  Leaves were placed in an OptiPlate-96 microplate in which each well contained 100 μL of distilled water. DF data were collected 5, 35, 65, and 95 s after 5 min of illumination (56 μmol/m2 per s) by LED light. The means ±SE of three samples are shown. ABA, abscisic acid; DAT, day after treatment; JA, jasmonic acid; SA, salicylic acid.

Download figure to PowerPoint

TaSAG3 and TaSAG5 expression profiles under various treatments

Senescence-associated marker genes are good tools for revealing the extent of senescence (Zhou et al. 2009; Zhang et al. 2012). Based on our semi-quantitative RT-PCR results for natural senescence processes (Figure 1C), we further detected TaSAG3 and TaSAG5 expression under various treatments using the qRT-PCR method (Figure 5).

image

Figure 5. Relative expression levels of TaSAG3 and TaSAG5 under various treatments.  The transcript levels were determined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). β-Actin was used as an internal control for normalization. The means ±SE of four repeats are shown. ABA, abscisic acid; DAT, day after treatment; JA, jasmonic acid; SA, salicylic acid.

Download figure to PowerPoint

In our control treatment (detached leaves under normal conditions with 16 h light/8 h dark), TaSAG3 expression did not show differences at different time points, whereas TaSAG5 expression rapidly increased after 1 d and then decreased in the next few d. Under dark treatment, TaSAG3 expression was slightly higher than that under normal light conditions, but it did not exhibit differences at different time points. TaSAG5 transcription levels significantly increased after treatment, and remained high from 2 d to 7 d, i.e., about 20 times higher than in the untreated leaves. These results indicate that TaSAG5 was induced by dark treatment, and its expression was stable after 2 d. Interestingly, under low temperature treatment, TaSAG3 and TaSAG5 showed opposite expression patterns to those under dark treatment. TaSAG3 had higher transcription levels than TaSAG5. These data indicate that TaSAG3 is induced by low temperature, and TaSAG5 is not sensitive to low temperature.

Abscisic acid is a key hormone that plays important roles in leaf senescence. Previous studies have shown that ABA can promote senescence and induce the expression of several SAGs (Gepstein and Thimann 1980; Zhang et al. 2012). When the leaves were treated with ABA for 3 d, TaSAG5 expression increased and even reached about 60 times more than that of 0 d (Figure 5). However, TaSAG3 seemed to be more stable than TaSAG5. Therefore, TaSAG5 may be one of the ABA-regulating pathway genes in wheat. JA is also an important hormone for regulating leaf senescence, and many genes are involved in its signal pathways. Both TaSAG3 and TaSAG5 were upregulated after JA treatment, showed the highest expression after 2 d of treatment, and then decreased. These results indicate that TaSAG3 and TaSAG5 may be involved in JA aging signal pathways. SA functions in the mediation of plant stress responses and the induction of senescence. TaSAG3 and TaSAG5 were induced by SA treatment (Figure 5). TaSAG5 and TaSAG3 exhibited the highest levels after 1 and 2 d, respectively, and then decreased rapidly. They were activated by SA, and may participate in signal transduction in SA pathways.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Leaf senescence is a programmed cell death (PCD) process. Nutrients and degraded macromolecules are remobilized from senescent leaves to support active growth parts, such as flowers and seeds (Hortensteiner and Feller 2002). The wheat grain nutritional content depends on the remobilization of amino acids and nutrients from vegetative tissues to the grain during the senescence of the entire plant (Uauy et al. 2006; Waters et al. 2009). Thus, key regulation genes need to be identified and applied in wheat production. Over the past years, some reports have focused on leaf senescence in wheat (Uauy et al. 2006; Lim et al. 2007; Cantu et al. 2011). However, the senescence mechanisms in this plant still remain unknown. In this study, we attempted to elucidate the physiological changes and SAG expression patterns in detached leaves under various stress treatments.

To detect senescence-associated physiological changes and SAG expression, 30-d-old wheat leaves were detached and subjected to light, dark, low temperature (4 °C), JA, ABA, and SA treatments. The chlorophyll content of leaves can be used to assess senescence because chlorophyll is degraded during leaf senescence, which can be induced by internal and external factors. Like AtNYE1, FaNYE1, a key SAG gene from tall fescue (Festuca arundinacea Schreb), plays an important regulatory role in chlorophyll degradation during senescence (Ren et al. 2007; Wei et al. 2011). DF can directly reflect the photosynthetic rate of leaf chloroplasts (Goltsev et al. 2009). However, only a few studies have shown the relationship between DF and plant leaf senescence (Zhang et al. 2007). In this study, low temperature did not appear to affect the structure of the chloroplast, and the high photosynthesis rate of wheat leaves remained high even after 7 d of treatment (Figures 4, S2). Compared with the dark treatment, the ABA, JA, and SA treatments drastically reduced photosynthesis ability. There was no DF detected after 7 d of treatment (Figures 4, S2). All DF data were consistent with chlorophyll content data. Thus, DF can be used to assess chlorophyll photosynthesis in leaf senescence.

Leaf senescence is highly regulated, and depends on the modulated expression of many different genes (Buchanan-Wollaston et al. 2003; Gepstein et al. 2003; Guo and Gan 2012). Based on our results, in the natural leaf senescence process, TaSAG3 and TaSAG5 are expressed during the senescent period in wheat flag leaves (Figure 1). However, they showed different expression patterns under various treatments (Figure 5). Thus, they may be regulated by different signaling pathways and play different functions in regulating leaf senescence.

Light is a key element for plant growth and development. Plants absorb light energy and convert it to chemical energy. There are several factors that affect the influence of light on plant senescence. Dark-induced leaf senescence is widely used to induce synchronous senescence in the form of many typical senescence symptoms, including chlorophyll degradation (Zhang et al. 2010; Li et al. 2012). In previous studies, darkness has been shown to induce senescence in detached leaves (Weaver et al. 1998), and some TaSAGs can also be induced by darkness (van der Graaff et al. 2006). Generally, chlorophyll content gradually increases when leaves are placed in water, similar to our results (Figure 3). However, light- and dark-induced detached leaf senescence exhibited many differences. TaSAG5 had a high transcription level 1 d after treatment under normal light, and then rapidly decreased after 2 d of treatment. Under dark conditions, TaSAG5 had a high transcription level throughout the entire treatment period (Figure 5). These results suggest that light- and dark-induced leaf senescence have different regulating mechanisms.

Temperature is an important factor affecting crop production. Thus, we performed low-temperature treatment in our research. The leaf phenotypes (Figure 2), chlorophyll contents (Figure 3), and DF values (Figure 4) did not show significant differences under 4 °C treatment, and TaSAG5 expression also remained low. These data indicate that low temperatures may inhibit chlorophyll degradation and the expression of some SAGs. However, the high expression of TaSAG3 suggested that it was more sensitive to a low temperature environment.

Abscisic acid has been implicated in the regulation of stress-induced senescence. The expression of several senescence-enhanced genes is induced upon treatment with ABA (Weaver et al. 1998). During Arabidopsis leaf natural senescence, four of 11 ABA-biosynthesis genes and eight of 30 ABA-signaling genes are upregulated (van der Graaff et al. 2006). After 3 d of ABA treatment, the chlorophyll content (Figure 3) and DF value (Figure 4) dramatically decreased, and the TaSAG5 levels increased after 1 d of treatment and decreased after 3 d (Figure 5). This result indicates that ABA is not a trigger factor but is rather an enhancer of leaf senescence.

Jasmonic acid is also involved in plant senescence and induces premature senescence. Various SAGs are expressed in response to JA (He et al. 2001). However, mutants affected by JA signaling do not show obvious alterations in the senescence phenotype (He et al. 2002). In this study, after 1 d of JA treatment, the chlorophyll content (Figure 3) and DF value (Figure 4) rapidly decreased, and DF was undetectable after 5 d. TaSAG3 and TaSAG5 had high transcription levels after JA treatment (Figure 5). Our observations of the JA responses of leaves were similar to those in an Arabidopsis study (He et al. 2002), which suggests that these two SAGs in wheat may play roles in JA-induced detached leaf senescence.

Salicylic acid is a key signaling molecule in plant pathogen responses, and the SA pathway is also involved in leaf senescence (Buchanan-Wollaston et al. 2005; An and Mou 2011). The levels of endogenous SA are fourfold higher in senescing leaves than in non-senescing leaves (Morris et al. 2000). Four of six genes involved in SA biosynthesis are regulated during natural leaf senescence in Arabidopsis (van der Graaff et al. 2006). Under SA treatment, DF was close to 0 after 3 d, which was the most significant finding observed in this study (Figure 4). The chlorophyll content also dramatically decreased (Figure 3). The TaSAG5 and TaSAG3 transcripts increased at early treatment periods and then decreased, indicating that they were induced by SA.

In summary, various treatments were performed on detached wheat leaves. Senescence-associated chlorophyll content changes, DF value differences, physiological changes, and SAG expression patterns were revealed. The observed DF values and chlorophyll content were consistent with the phenotypes of the detached leaves under treatments; thus, DF can be used as a biological marker in future studies on wheat. However, the functions and potential mechanisms of TaSAG3 and TaSAG5 in wheat leaf senescence need to be elucidated in future research.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Plant materials and stress treatments

Common wheat (Triticum aestivum L.) variety Shiluan 02-1, which is widely cultivated in northern China, was used in this experiment. Plants for semi-quantitative RT-PCR were grown in a field, and the flag leaves were excised in different growth stages. For the detachment experiments, the plants were grown in an environmentally-controlled growth room at 22 °C with a 16 h light/8 h dark cycle. All stress experiments were carried out using the fourth leaves of 30-d-old plants, which were about 0.3–0.5 cm wide and 20 cm long. The leaf samples were excised and placed on Petri dishes containing 30 mL of different solutions, including water, 0.2 mmol/L ABA, 3 mmol/L SA, and 0.25 mmol/L JA. The detached leaves were harvested 0, 1, 2, 3, 5, and 7 d after treatment, photographed by an HD Smart Camera (Canon, Japan), and further analyzed.

Measurement of chlorophyll content

Total chlorophyll was extracted and quantified as previously described with minor modifications (He et al. 2002). The leaves were cut into about 1 cm fragments and placed in a test tube containing 5 mL of 80% acetone for 12 h. The chlorophyll content was quantified by Lambert-Beer's method using a UV-vis spectrophotometer (Spectrum, Shanghai, China).

DF measurements

For DF measurements, 30-d-old wheat leaves were cut and placed in an OptiPlate-96 microplate whose wells contained 100 μL of distilled water each. The DF analysis system was a TopCount NXT Microplate Scintillation and Luminescence Counter (PerkinElmer, Waltham, MA, USA). Spontaneous fluorescence values were collected 5, 35, 65, and 95 s after 5 min of illumination by an RB LED array (56 μmol/m2 per s). The experiments were carried out at 22 °C and repeated three times.

Semi-quantitative RT-PCR and quantitative RT-PCR analysis

Total RNAs were isolated from leaf tissues using a TRIzol Max Bacterial RNA Isolation Kit (Invitrogen, Carlsbad, CA, USA), and then pretreated with RNase-free DNaseI (Fermentas, Glen Burnie, MD, USA) to remove any contaminating genomic DNA. cDNA was synthesized using a PrimeScriptRT Reagent Kit (Takara, Dalian, China). The primers for the semi-quantitative RT-PCR are listed in Table 1. qRT-PCR was performed in 96-well blocks with an Applied Biosystems 7500 Real-Time PCR System (ABI, Foster City, CA, USA) using a SYBR Green I master mix (Takara). The PCR primers are summarized in Table 2. The fold changes in gene expression were calculated using the comparative CT method. All experiments were repeated four times.

Table 1.  Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR)primers used in this study
GeneForward primerReverse primer
TaSAG3 TGTTCTTGACGACGATGGTG TGAGCAC TAAGCGCAGCA
TaSAG5 GGCAAGGGGATGAGAATAG CTTCTGATGCCTTCTTTGT
TaSAG8 CACCTCCTCCCCTCCGCATC TTGATTCCAGTTTTGTCCAG
TaSAG9 ACAAGTTCAACCCCGT CAAG CCATCAGCTTCATCAGACCC
β-ACTIN CCAAGGCTAACAGGGAGA AGCGAGGTCAAGACG AAG
Table 2.  Quantitative real-time polymerase chain reaction (PCR) primers used in this study
GeneForward primerReverse primer
TaSAG3 CGACATCCGACGATTCAAC TCGCACCACCATCCATTC
TaSAG5 CGGCTGCGAAGTTGGTTAC ACCTGCTCCTGAGATAATGGC
β-ACTIN TGCTATCCTTCGTTTGGACCTT AGCGGTTGTTGTGAGGGAGT

(Co-Editor: Hai-Chun Jing)

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

This work was supported by the National Natural Science Foundation of China (30971767), the Research Fund for the Doctoral Program of Higher Education of China (20091303120004), and the Natural Science Foundation of Hebei Province (C2010000386).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and Methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Figure S1. Delayed fluorescence (DF) values of untreated wheat leaves. The fourth leaves of 30 d-old plants were cut and placed in an OptiPlate-96 microplate whose wells contained 100 μL of distilled water each. DF data were collected 5, 35, 65, and 95 s after 5 min of illumination (56 μmol/m2 per s) by LED light. The means ± SE of three samples are shown.

Figure S2. Delayed fluorescence (DF) values of wheat leaves shown in Figure 2. Detached leaves were placed in an OptiPlate-96 microplate whose wells contained 100 μL of distilled water each. DF data were collected 5, 35, 65, and 95 s after 5 min of illumination (56 μmol/m2 per s) by LED light. The means ± SE of three samples are shown.

FilenameFormatSizeDescription
JIPB_1139_sm_SuppMat.doc1322KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.