Comparison of Anti-Invasive Activity of Parthenolide and 3-Isopropyl-2-Methyl-4-Methyleneisoxazolidin-5-One (MZ-6) – A New Compound with α-Methylene-γ-Lactone Motif – on Two Breast Cancer Cell Lines

Authors


Corresponding author: Anna Janecka, anna.janecka@umed.lodz.pl

Abstract

The biological activities of parthenolide, a sesquiterpene lactone isolated from feverfew, have been attributed to the presence of the α-methylene-γ-lactone skeleton. The lactone skeleton can react via the Michael type addition with sulfhydryl groups of enzymes and other functional proteins, interfering with key biological processes in the cell. In the present study, we describe an efficient method of preparation of 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one (MZ-6), a synthetic compound with α-methylene-γ-lactone ring, as in parthenolide, additionally modified by introduction of a nitrogen atom. Furthermore, we investigated the cytotoxic activity and anti-metastatic potential of MZ-6 in comparison with parthenolide. Both compounds showed considerable cytotoxicity against breast cancer MCF-7 and MDA-MB-231 adenocarcinoma cells in vitro and were then evaluated for their anti-metastatic potential. The experimental results showed that MZ-6 and parthenolide suppressed, to a similar degree, migration of MCF-7, but not more aggressive MDA-MB-231 cells. In both cell lines, tested compounds down-regulated mRNA and protein levels of metalloproteinase-9 and urokinase plasminogen activator, the key proteases involved in the degradation of extracellular matrix and dissemination of cancer cells. The obtained results indicate that simple analogs of α-methylene-γ-lactones can be good substitutes for more complex structures isolated from plants.

Sesquiterpene lactones (SLs) are a large and diverse group of natural products derived mostly from flowering plants of Compositae family. These compounds are known for the broad range of biological activities, including anti-inflammatory, phytotoxic, anti-microbial, and anti-tumor properties (1–4). Most SLs share the α-methylene-γ-lactone skeleton. Such skeleton can react with sulfhydryl groups of enzymes and other functional proteins (5–7) (Figure 1), interfering with key biological processes in the cell, such as cell signaling, mitochondrial respiration, proliferation, and apoptosis (8–10), all of which constitute the molecular basis for their diverse pharmmacologic activities. Parthenolide (PTL) (Figure 2) is the major SL present in feverfew (Tanacetum parthenium), a traditional herbal plant which has been used for the treatment of fever, migraine, and arthritis for centuries (6). More recently, the potential anticancer activity of PTL has been pursued in a number of laboratories (for review see 2).

Figure 1.

 Mode of action of α-methylene-γ-lactones.

Figure 2.

 Structure of parthenolide (PTL) and 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one (MZ-6).

The PTL was found to induce apoptosis in many types of human cancer cells. Several mechanisms were shown to be involved in PTL-induced apoptosis, such as depletion of intracellular GSH and protein thiols, and disruption of the redox balance (11), changes in pro-apoptotic Bcl-2 proteins via the mitochondrial apoptotic pathway (12), suppression of the NF-κB signaling pathway (13–16). The above pathways may act individually or synergistically, making PTL a potent apoptosis inducer in cancer cells.

In our search for new anti-cancer agents, we have concentrated on the synthesis of the heterocycles with the same as in PTL, α-methylene-γ-lactone motif. In our earlier report, (17) we have described the synthesis and cytotoxic activity of a series of 4-methyleneisoxazolidin-5-ones, which are α-methylene-γ-lactones containing a nitrogen atom in the lactone ring. These compounds showed significant cytotoxicity in vitro against three leukemia cell lines and were able to induce caspase 3 activity in leukemia HL-60 cells, in a concentration-dependent manner (18).

Herein, we report the anti-invasive activity of the best compound of this series, 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one (MZ-6), which we designated as MZ-6 (Figure 2). The anticancer potential of MZ-6 was explored on two breast cancer cell lines, hormone-dependent MCF-7 and invasive, hormone-independent MDA-MB-231. For comparison, PTL was included in the study. Furthermore, we elaborated a novel, much more efficient synthesis of this compound, using a two-step procedure.

Materials and Methods

Materials and general procedures

The PTL was purchased from Tocris Bioscience (Bristol, UK). Organic solvents and reagents were purified by the appropriate standard procedures. Column chromatography was performed on silica gel 60 (230–400 mesh; Fluka, Buchs, Switzerland). The IR spectra were recorded on a ST-IR ALPHA spectrometer (Bruker, Ettlington, Germany). 1H NMR (250 MHz), 13C NMR (62.9 MHz) and 31P NMR (101 MHz) spectra were recorded on a DPX-250 spectrometer (Bruker, Karlsruhe, Germany), with TMS as an internal standard for 1H NMR and 13C NMR, and 85% H3PO4 as an external standard for 31P NMR. 31P NMR spectra were recorded using broad-band proton decoupling. J values are given in Hz. 2-Diethoxyphosphoryl-4-methyl-2-pentenoic acid (1) was prepared according to the literature procedure (19).

Preparation of 2-methyl-4-diethoxyphosphorylisoxazolidin-5-one (4)

To a solution of (E)-2-(diethoxyphosphoryl)-3-isopropylacrylate (500 mg, 2 mm) in anhydrous CH2Cl2 (10 mL) cooled to 0 °C, anhydrous triethylamine (506 mg, 5 mm) and ethyl chloroformate (326 mg, 3 mm) were added. The mixture was stirred in this temperature for 15 min, followed by the addition of MeNHOH·HCl (184 mg, 2.2 mm). Stirring was continued for 2 h at room temperature, and the reaction mixture was quenched with water (15 mL). The mixture was extracted with CH2Cl2 (3 × 20 mL). The combined organic extracts were dried over MgSO4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluent: ethyl acetate/hexane 7/3) to give pure 4 (480 mg, 86%) as colorless oil. 1H, 13C and 31P NMR data of isoxazolidinone 4 were identical to those reported before (19).

Preparation of MZ-6

To a solution of 4 (340 mg, 1.22 mm) in THF (10 mL) an aqueous 36% solution of formaldehyde (0.66 mL, 8.6 mm) was added. The mixture was cooled to 0−5 °C and the solution of potassium carbonate (0.506 g, 3.66 mm) in H2O (4 mL) was added. The solution was stirred for 45 min at room temperature (monitored by TLC) and then was extracted with Et2O (3 × 25 mL). The organic layer was washed with brine and dried over MgSO4 and concentrated in vacuo. The remaining oil was purified by column chromatography on silica gel (eluent: CHCl3/hexane 1/1) to give pure MZ-6 (95 mg, 50%), as colorless oil.

Spectroscopic data: IR (film, /cm): 1764, 1664; 1H NMR (CDCl3): δ = 0.98 (d, 3H, 3JHH = 6.8 Hz, CH3CH); 0.99 (d, 3H, 3JHH = 6.8 Hz, CH3CH); 1.80–1.99 (m, 1H, (CH3)2CH); 2.86 (s, 3H, CH3N); 3.45 (ddd, 1H, 3JHH = 5.5 Hz, 4JHH = 2Hz, 4JHH = 2.0 Hz, CCH); 5.64 (d, 1H, 4JHH = 2.0 Hz, C=CHH); 5.64 (d, 1H, 4JHH = 2.0 Hz, C=CHH); 13C NMR (CDCl3): δ = 17.4 (s, CH3CH); 18.2 (s, CH3CH); 33.1 (s, (CH3)2CH); 49.2 (s, CH3N); 74.9 (s, CCH); 124.6 (s, C=CH2); 136.2 (s, C=CH2); 170.2 (s, C=O); Anal. Calcd for C8H13NO2: C 61.91; H 8.44; N 9.03. Found C 61.81; H 8.39; N 9.11.

Cell culture

The MCF-7 and MDA-MB-231 cell lines were purchased from the European Collection of Cell Cultures (ECACC). The cells were cultured in high glucose Dulbecco’s Modified Eagle Medium (DMEM; BioWhittaker, Lonza, Basel, Switzerland) supplemented with glutamine (2 mm) (Sigma-Aldrich, St Louis, MO, USA) gentamycin (5 μg/mL) and 10% heat-inactivated fetal bovine serum (FBS) (both from Biological Industries, Beit-Haemek, Israel). Cells were maintained at 37 °C in a 5% CO2 atmosphere and were grown until 80% confluent.

Cell viability assay (MTT)

Cell viability was determined by the mitochondrial reduction assay (MTT) (20,21). MCF-7 or MDA-MB-231 cells were grown to subconfluent levels in DMEM (10% FBS) and then plated onto 24-well culture plates (104 cells/well) in the final volume of 1 mL of culture medium. After 24 h, various concentrations of MZ-6 or PTL were added and the plates were incubated for 48 h. Afterwards, cells were incubated for 2 h at 37 °C with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 5 mg/mL in PBS) and the metabolically active cells reduced the dye to blue formazan product. The absorbance was measured at 540 nm and compared with control (untreated cells). All experiments were performed in triplicate.

Wound-healing assay

To evaluate the effect of MZ-6 and PTL on migration of MCF-7 and MDA-MB-231 cells, the wound-healing assay was performed according to the known procedure (22). A suspension of cells in DMEM (10% FBS) in exponential growth phase was seeded into six-well tissue culture plates at a density 5 × 105 in the final volume of 3 mL of culture medium. After 3 days, when the cells grew to confluence, medium was replaced by serum-free medium and the cells were incubated for additional 12 h. Then, a wound was made in the center of the cell monolayer with a sterile 200 μm disposable tip. The scratched place was washed gently twice with phosphate buffered saline (PBS) to remove cellular debris and then the medium was replaced by fresh DMEM (10% FBS) containing a tested compound (10 μm). The MCF-7 and MDA-MB-231 cells were incubated with the tested compounds for up to 24 h. The scratched area was photographed at the reference points with a phase-contrast microscope (OLYMPUS CKX41; Olympus, London, UK) for the first image, and the following images (after 0, 6, 12, 24 h) was taken. Assays were done in triplicate and repeated three times. The distances between two edges of the scratch were measured at the reference points and analyzed statistically.

Incubation of cells with PTL and MZ-6 for real-time PCR and Elisa assays

The MCF-7 or MDA-MB-231 breast cancer cells (5 × 104 cells/mL) were seeded in 25 mL cell culture flasks in 10 mL of standard growth medium. After 24 h, the growth medium was replaced by a fresh growth medium supplemented with the tested compounds in a desired concentration. Cells incubated without a tested compound were used as control. After 48 h incubation, the cells for mRNA isolation were washed twice with phosphate buffered saline (PBS; Gibco, Invitrogen, Carlsbad, CA, USA) to remove added compounds and were then harvested by trypsinization. The cells were frozen in RNA later (Sigma-Aldrich) and were kept at −80 °C awaiting further experiments. For metalloproteinase-9 (MMP-9) and urokinase plasminogen activator (uPA) secretion determination in medium, the culture supernatant was collected, cleared by centrifugation and stored at −20 °C.

Quantitative real-time PCR assay

Total RNA was extracted from the MCF-7 or MDA MB 231 cells using Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. The concentration and purity of isolated RNA were determined spectrophotometrically at 260 and 280 nm. The cDNA was synthesized using SuperScript™ II Reverse Transcriptase Kit (Invitrogen, Life Technologies) and oligo(dT)12–18 primers.

The expression of the MMP-9 and uPA genes, as well as glyceraldehyde 3-phosphate dehydrogenase (GAPDH), used as a house-keeping gene, was quantified by real-time PCR using an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions for the SYBR Green I Reagent System (Eurogentec S.A., Liege Science Park, Belgium). The cDNAs were amplified with forward and reverse primers that were specific for human MMP-9, uPA and GAPDH, and had been designed with PrimerExpress software (Applied Biosystems). The MMP-9 primer sequences were 5′ GACCAATCTCACCGACAGG 3′ (forward) and 5′ GCCACCCGAGTGTAACCATA 3′ (reverse). The uPA primer sequences were 5′ GACCCCCTCGTCTGTTCCCTCCAAG 3′ (forward) and 5′ CTCTTCCTTGGTGTGACTGCGG 3′ (reverse). As an internal control, (GAPDH) was amplified using primer sequences 5′-GTCGCTGTTGAAGTCAGAGGAG-3′ (forward) and 5′ CGTGTCAGTGGTGGACCTGAC-3′ (reverse).

Relative standard curves for MMP-9 and uPA genes, and GAPDH were generated with serial 10-fold dilutions of MCF-7 and MDA-MB 231 cDNA sample. Real-time PCR reactions were run in triplicate using the following thermal cycling profile: 50 °C for 2 min, 95 °C for 10 min, followed by 40 steps of 95 °C for 30 seconds and 56 °C for 1 min and 72 °C for 1 min. After 40 cycles, samples were run for the dissociation protocol (i.e. melting curve analysis). SYBR Green I fluorescence emissions were captured and mRNA levels were quantified using the critical threshold (Ct) value. Controls with no cDNA template were included with each assay. The obtained values were analyzed by means of the ABI Prism 7000 sds software (version 1.1; Applied Biosystems, Foster City, CA, USA) and normalized relative to GAPDH transcript levels. All results are presented as means ± SD.

MMP-9 and uPA secretion

Supernatant collected after treatment of the cells with the tested compounds was subsequently analyzed for MMP-9 and uPA protein levels using MMP-9 ELISA Kit (RayBiotech, Norcross GA, USA) and AssayMax Human Urokinase (uPA) ELISA Kit (AssayPro, St Charles, MO, USA), respectively, according to the manufacturer’s instructions.

Zymography

The MCF-7 or MDA-MB-231 breast cancer cells were seeded into 96-well tissue culture plates at a density 104 and 3 × 10cells/well, respectively in the final volume of 200 μL of culture medium. After 24 h, the growth medium was replaced by a fresh serum free medium supplemented with the tested compounds in a desired concentration. Cells incubated without a tested compound were used as control. To increase the basal level of MMP-9, cells were additionally incubated with TNF-α. Yin et al. (23) used 20 ng/mL of TNF-α to induce the MMP-9 expression. In our study, the concentration of TNF-α was chosen experimentally (data not shown). The cells were treated with different concentrations of TNF-α ranging from 5 to 50 ng/mL. We have chosen the lowest concentration of TNF-α which was able to induce MMP-9 activity in each cell line; 5 and 25 ng/mL for MCF-7 and MDA-MB-231, respectively. After 48 h incubation, the culture supernatant was collected.

Gelatin zymography was performed as described previously (24). Briefly, the same volume of conditioned media (usually 20 μL) was dissolved in electrophoresis sample buffer containing sodium dodecyl sulfate (SDS) (Applichem, Darmstadt, Germany) and subjected to electrophoresis in 10% polyacrylamide gel embedded with 1.5 mg/mL gelatin (Sigma-Aldrich) in the absence of β-mercaptoethanol. After electrophoresis, the enzymes were renatured by incubation with 2.5% Triton X-100 (Sigma-Aldrich), and the enzyme reaction was allowed to proceed at 37 °C for 21 h. Thereafter, the gels were stained for 1.5 h with 0.0125% Amido Black (POCH, Gliwice, Poland) in 7% acetic acid and 20% ethanol. The MMP-9 was visualized without destaining as transparent bands against the dark blue background of Amido Black-stained slab gels. After staining, gels were photographed using Olympus camera and their densitometry was carried out using Quantity One® 4.4 software (Bio-Rad Laboratories, Hercules, CA, USA).

Statistical analysis

Statistical analyses were performed using Prism 4.0 (GraphPad Software Inc., San Diego, CA, USA). The data were expressed as means ± SD. Differences between groups were assessed by a one-way anova followed by a post-hoc multiple comparison Student-Newman–Keuls test. A probability level of 0.05 or lower was considered statistically significant.

Results

Chemistry

Novel, efficient synthesis of MZ-6 is presented in Scheme 1. Mixed anhydride 2 was generated in situ from 2-diethoxyphosphoryl-4-methyl-2-pentanoic acid (1) and ethyl chloroformate in the presence of Et3N at 0 °C. N-Methylhydroxylamine hydrochloride was then added and the reaction mixture was stirred for 24 h at room temperature. Initially formed adduct 3 was not isolated and lactonized spontaneously. After standard work-up of the reaction mixture, crude product was purified by column chromatography on silica gel to give trans-4-diethoxyphosphoryl-3-isopropyl-2-methylisoxazolidin-5-one (4) in excellent, 86% yield. Described here synthesis of isoxazolidinone 4, via mixed anhydride approach, is much more efficient than that reported by us before (17), where ethyl 2-diethoxyphosphoryl-4-methyl-2-pentenoate was reacted with N-methylhydroxylamine hydrochloride to give 4 in 24% yield.

Figure Scheme 1:.

 Synthesis of 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one. (i) ClCOOEt, NEt3, CH2Cl2, 0 °C to rt, 15 min; (ii) MeNHOH × HCl, rt, 2 h; (iii) K2CO3, 36% formalin, H2O, THF, 0 °C to rt, 45 min.

Having efficient synthesis of isoxazolidinone 4 in hand we used this reagent in Horner-Wadsworth-Emmons olefination of formaldehyde. Reaction was performed in the presence of K2CO3 as a base and gave after purification by column chromatography on silica gel, the expected MZ-6 in 50% yield.

Biology

Inhibition of cell viability

The cytotoxic effect of MZ-6 and PTL was studied against MCF-7 and MDA-MB-231 breast cancer cells, using the MTT assay (20,21). The principle of this assay is the cellular reduction of MTT by the mitochondrial dehydrogenase of viable cells. A blue formazan that is formed can be measured spectrophotometrically. Cells were exposed to a broad range of drug concentrations (1, 1.5, 2, 5 and 10 μm) for 48 h. The MZ-6 exhibited high and similar cytotoxic activity against both tested cell lines. IC50 values, which represent 50% inhibitory concentration of the drug, were in a low micromolar range (4.5 ± 0.7 μm for MCF-7 and 3.5 ± 0.6 μm for MDA-MB-231). Cytotoxic effect of PTL on both cell lines was similar, but the IC50 values were two to threefold higher as compared with MZ-6 (9.5 ± 0.7 μm for MCF-7 and 8.0 ± 0.5 μm for MDA-MB-231).

Wound-healing assay

Migration of MCF-7 and MDA-MB-231 cells was assessed by a well-established ‘wound-healing assay’ (22). In these experiments, a wound gap of similar size was created in the confluent monolayers of MCF-7 or MDA-MB-231 cells at 0 h. The gaps were filled gradually with migrating cells of both cell lines, and closed almost completely in control groups after 24 h. The MCF-7 cells treated with MZ-6 (10 μm) or PTL (10 μm) for 6, 12, 24 h were migrating slower than control cells and after 24 h, the gaps were still visible (Figure 3A). Migration was not affected either by MZ-6 or PTL in the MDA-MB-231 cell line (Figure 3B). The results indicated that MZ-6 and PTL treatment inhibited to a similar degree the migration of MCF-7 cells, but neither of these compounds influenced the migration of more aggressive MDA-MB-231 cancer cells.

Figure 3.

 Effect of 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one (MZ-6) and parthenolide (PTL) on breast cancer cell migration as determined by the wound healing assay. Wounds were made by pipette tip in confluent (A) MCF-7 or (B) MDA-MB-231 cell monolayers. Phase contrast microphotographs were taken immediately after creation of the wounds (0 h) and after 6, 12, 24 h incubation of wounded cultures with MZ-6 or PTL.

MMP-9 mRNA levels

The MMP-9 mRNA expression levels were measured using quantitative RT-PCR. The MCF-7 and MDA MB 231 cells were treated for 48 h with MZ-6 or PTL at a concentration of 0.1 μm. Both compounds caused a significant down-regulation of MMP-9 mRNA in the tested cell lines, but the effect produced by PTL was stronger (Figure 4A).

Figure 4.

 (A) The quantitative real-time PCR analysis of metalloproteinase-9 (MMP-9) mRNA levels in MCF-7 and MDA-MB-231 cells incubated for 48 h with 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one (MZ-6) or parthenolide (PTL) (0.1 μm). Data represent mean ± SD of three independent experiments. Statistical significance was assessed using one-way anova and a post hoc multiple comparison Student-Newman-Keuls test. **p < 0.01, ***p < 0.001 was considered as significantly different from untreated cells regarded as control. (B) The protein levels of MMP-9 (ng/mL) released into the culture medium of MCF-7 and MDA-MB-231 cells incubated for 48 h with MZ-6 or PTL (0.1 μm). Data represent mean ± SD of three independent experiments performed in duplicate. Statistical significance was assessed using one-way anova and a post hoc multiple comparison Student-Newman-Keuls. **p < 0.01, ***p < 0.001 was considered as significantly different from untreated cells regarded as control.

MMP-9 secretion

The levels of MMP-9 protein in the culture medium, collected after 48 h incubation of MCF-7 or MDA-MB-231 cells with MZ-6 or PTL in 0.1 μm concentration, measured by ELISA assay, are shown in Figure 4B. The MZ-6 and PTL decreased the MMP-9 levels in both cell lines to the similar degree, PTL exerted stronger attenuation than MZ-6.

Gelatin zymography

The activity of MMP-9 in MCF-7 and MDA-MB-231 cells was observed by gelatin zymography. The identity of this activity was based on its co-migration with standard human MMP-9. The basal levels of MMP-9 were increased by stimulation of the cells with TNF-α.

Incubation with both compounds produced a dose-dependent effect. The MZ-6 showed a U-shaped function in both cell lines (with the strongest inhibition at 0.1 μm). Both compounds produced about 90% inhibition at concentrations ≥10 μm (Figure 5).

Figure 5.

 Zymographic analysis of TNF-α-induced metalloproteinase-9 (MMP-9) activity in culture medium of MCF-7 (A) and MDA-MB-231 (B) cells incubated for 48 h with 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one or parthenolide in concentrations ranging from 0.01 to 100 μm. Data represent mean ± SD of three independent experiments. Statistical significance was assessed using one-way anova and a post hoc multiple comparison Student-Newman-Keuls test. *p < 0.05, **p < 0.01, ***p < 0.001 was considered as significantly different from untreated cells regarded as control.

uPA mRNA expression

The uPA mRNA expression was measured using quantitative RT-PCR. The mRNA levels in MCF-7 and MDA-MB-231 cells treated with MZ-6 or PTL (0.1 μm) were down-regulated significantly compared with control (Figure 6A). However, the effect produced by PTL was in both cell lines greater than that caused by MZ-6.

Figure 6.

 (A) The quantitative real-time PCR analysis of urokinase plasminogen activator (uPA) mRNA levels in MCF-7 and MDA-MB-231 cells incubated for 48 h with 3-isopropyl-2-methyl-4-methyleneisoxazolidin-5-one (MZ-6) or parthenolide (PTL) (0.1 μm). Data represent mean ± SD of three independent experiments. Statistical significance was assessed using one-way anova and a post hoc multiple comparison Student-Newman-Keuls test. **p < 0.01, ***p < 0.001 was considered as significantly different from untreated cells regarded as control. (B) The protein levels of uPA (ng/mL) released into the culture medium of MCF-7 and MDA-MB-231 cells incubated for 48 h with MZ-6 or PTL (0.1 μm). Data represent mean ± SD of three independent experiments performed in duplicate. Statistical significance was assessed using one-way anova and a post hoc multiple comparison Student-Newman-Keuls. **p < 0.01, ***p < 0.001 was considered as significantly different from untreated cells regarded as control.

uPA secretion

The levels of uPA protein in the culture medium of MCF-7 and MDA-MB-231 cells, measured by ELISA assay, were approximately 0.2 and 0.3 ng/mL, respectively, which correlates well with the uPA levels reported by others (6). Incubation of both types of cells with MZ-6 or PTL caused a decrease of uPA protein levels, but the effect was stronger in case of PTL (Figure 6B).

Discussion

As a result of the biological importance of natural products with α-methylene-γ-lactone skeleton, the synthesis of their derivatives, has been of interest to synthetic chemists for many years and has resulted in the development of some new synthetic methods which have been described in the recent reviews (25,26).

A large number of studies focused on the effect of different SLs, including PTL, costunolide, helenalin, and others on their inhibitory effect on cancer cell proliferation and induction of apoptosis in cancer cells (2). Much less data can be found concerning the influence of SLs on cancer dissemination.

Methastasis is responsible for 90% of cancer deaths and remains a major problem in cancer treatment (27). Metastasizing is a multi-step biochemical process which includes detachment of cancer cells from primary tumor, migration, adhesion, and invasion of cancer cells into the blood vessels, extravasation out of the vessel, and finally growth of a secondary tumor (28). The critical step of cancer dissemination is migration of cancer cells through the extracellular matrix (ECM), surrounding the endothelium and creating the basement membrane of epithelial tissue in different organs. Indispensable in this process is the activation of proteolytic enzymes capable of degrading the ECM. The key proteases involved in the ECM degradation are plasmin, uPA, and matrix metalloproteinases (MMPs) (29,30), especially MMP-2 (gelatinase A) and MMP-9 (gelatinase B), which possess the ability to degrade type IV collagen, a major component of basement membranes. Expression and activity of all these enzymes changes in many pathological conditions including inflammation, degenerative disorders, and cancer. A simple relationship has been established between overproduction of MMPs in tumor cells and cancer progression (31,32). Similarly, uPA is believed to mediate cancer dissemination by catalyzing ECM degradation, thus allowing malignant cells to spread in an uncontrollable way to distant sites. The uPA levels have been shown to be up-regulated in most types of cancer (33,34) and correlate well with adverse prognosis. These observations prompted different studies with various inhibitors designed to block the proteolytic activity of these enzymes.

In this report we tested the ability of SL, PTL, and a simple synthetic α-methylene-γ-lactone to inhibit cancer cell invasiveness by making use of a scratch wound assay. The assay was conducted in vitro against two breast cancer cell lines, estrogen dependent MCF-7 cell line, and the more aggressive estrogen-independent MDA-MB-231 cell line. The synthetic analog and PTL were both selected for this study on the basis of their high cytotoxic activity against MCF-7 and MDA-MB-231 cells. We have shown that cytotoxicity of MZ-6 against both cell lines was two to threefold higher compared with PTL. Both compounds to a similar degree inhibited migration of MCF-7 cells in the scratched wound assay, but had no effect on the migration of the more aggressive MDA-MB-231 cells. To further investigate the effect of MZ-6 and PTL on cancer cell invasiveness, we have chosen two enzymes, MMP-9 and uPA, which are known to play a major role in ECM degradation. Inhibitors of these enzymes may appear to be of value as future therapeutic leads. Results obtained from real-time RT-PCR have shown that both compounds down-regulated MMP-9 and uPA mRNA and protein levels. Gelatin zymography confirmed that MZ-6 and PTL attenuated activity of MMP-9.

The results obtained here and in our earlier article (18) demonstrated that simple 4-methyleneisoxazolidinone such as MZ-6 have comparable pro-apoptotic and anti-metastatic properties to PTL. Therefore, simple analogs of α-methylene-γ-lactones can be good substitutes for more complex structures isolated from plants. In addition, simple and efficient preparation of MZ-6 and potential for further functionalizations may enable selective modulation of its reactivity with biological nucleophiles, thus allowing for more specific interactions and better selectivity as drug candidates.

Conclusions

Anticancer activity and molecular mechanisms of action of various SLs isolated from plants have been extensively studied, especially in the last decade. A number of new synthetic compounds with α-methylene-γ-lactone skeleton have also been published. However, biological evaluation of these potentially anti-cancer agents is limited mostly to assessing their cytotoxic activity against selected cancer cell lines. In this study, we compared anti-metastatic activity of a new synthetic α, β-unsaturated isooxasolidinone MZ-6, and PTL on two breast cancer cell lines, MCF-7 and MDA-MB-231. The MZ-6 was more cytotoxic for the cells of both cell lines. Both compounds inhibited migration of MCF-7 cells, but not more aggressive MDA-MB-231 cells and down-regulated MMP-9 and uPA mRNA and protein levels.

Acknowledgments

This work was supported by the grant from the Medical University of Lodz (No 503/1-156-02/503-01).

Ancillary