SEARCH

SEARCH BY CITATION

Keywords:

  • EGFP;
  • protein transduction efficiency;
  • PTD;
  • TAT

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

To understand the protein transduction domain (PTD)-mediated protein transduction behavior and to explore its potential in delivering biopharmaceutic drugs, we prepared four TAT–EGFP conjugates: TAT(+)–EGFP, TAT(−)–EGFP, EGFP–TAT(+) and EGFP–TAT(−), where TAT(+) and TAT(−) represent the original and the reversed TAT sequence, respectively. These four TAT–EGFP conjugates were incubated with HeLa and PC12 cells for in vitro study as well as injected intraperitoneally to mice for in vivo study. Flow cytometric results showed that four TAT–EGFP conjugates were able to traverse HeLa and PC12 cells with almost equal transduction efficiency. The in vivo study showed that the TAT–EGFP conjugates could be delivered into different organs of mice with different transduction capabilities. Bioinformatic analyses and CD spectroscopic data revealed that the TAT peptide has no defined secondary structure, and conjugating the TAT peptide to the EGFP cargo protein would not alter the native structure and the function of the EGFP protein. These results conclude that the sequence orientation, the spatial structure, and the relative location of the TAT peptide have much less effect on the TAT-mediated protein transduction. Thus, the TAT-fused conjugates could be constructed in more convenient and flexible formats for a wide range of biopharmaceutical applications.

Abbreviation:
PTD

protein transduction domain

TAT

transactivator of transcription

CPP

cell-penetrating peptide

EGFP

enhanced green fluorescent protein

IPTG

isopropyl-l-d-thiogalactoside

PRDX6

peroxiredoxin-6

BH4

tetrahydrobiopterin

SOD

superoxide dismutase

6-OHDA

6-hydroxydopamine

ANTP

antennapedia

Bcl-xl

B-cell lymphoma/leukemia-x long

LRP

low-density lipoprotein receptor–related protein

Most of the biopharmaceutical molecules, such as peptides, proteins, enzymes, and oligonucleotides, have limited therapeutic effectiveness because they lack the intrinsic ability to traverse the plasma membrane. A number of short peptides called protein transduction domains (PTDs) or cell-penetrating peptides (CPPs) have demonstrated the ability to cross the plasma membranes effectively (1–5). The most extensively studied PTDs are from HIV-1 transactivator of transcription protein (TAT), drosophila homeodomain transcription factor antennapedia (ANTP), and herpes simplex virus structural protein VP22 (6–8). These peptides are rich in arginine or lysine, and it is proposed that interactions between the positively charged PTDs and the negatively charged proteoglycans and glycosaminoglycans on the cell surface play a key role in the PTD-mediated transduction process.

These PTDs have demonstrated a wide range of transduction behavior. Some studies observed that incubation at 4 °C did not abrogate PTD-mediated transduction nor change the intracellular distribution of the PTD-conjugated proteins (9–11). Other studies, however, reported controversial data that transduction at 4 °C was significantly reduced or even inhibited in comparison with that at 37 °C for TAT, ANTP, and VP22 peptides (12–18). Preincubation of cells with heparinase-III specifically digesting heparan sulfate chains decreased PTD-mediated protein uptake, revealing the role of heparan sulfate on the cell surface (19). Use of mutant cells defective in glycosaminoglycan synthesis provided further evidence to support the hypothesis of PTD binding with proteoglycans (16,20). However, inconsistent data were reported that although acidic proteoglycans formed a pool of charge for PTD binding, this binding had no correlation with the PTD-mediated protein transduction (21).

Experiments were also designed to differentiate these PTD-mediated protein transduction pathways. Mutant cells defective in expressing surface receptors and proteins (LRP, clathrin, caveolin, dynamin, and others) as well as inhibitors selectively blocking the protein uptake routes have been examined, and clathrin-dependent endocytosis (17,22), caveolae-dependent endocytosis (12), macropinocytosis (13,23), and direct penetration mechanism (10) have been concluded. It was also proposed that different cell lines might use different endocytic pathways (24). Simultaneous involvement of different endocytic pathways in one transduction event was also speculated (25). Furthermore, therapeutic applications of these PTD peptides have been examined because they demonstrated an enhanced delivery of functional proteins into cells in vivo and in vitro. Typical examples include PRDX6 protein protection against eye lens epithelial cell death and delaying lens opacity (26), BH4 domain of the anti-apoptotic protein Bcl-xl for protection against the radiation-induced cell death (1), tyrosine hydroxylase for curing 6-OHDA-induced Parkinson’s disease (2), α-synuclein for protection against oxidative stress (4), and SOD for healing ischemic brain injury (5).

In previous studies, biotin or fluorescein has been linked to PTD-conjugated proteins to offer a great convenience in monitoring PTD-mediated transduction process (8). These methods, however, raised some concerns regarding the conjugation efficiency, linkage stability, chemical toxicity, fluorescence lifetime, and the integrity of the cargo proteins because chemical linkage might interrupt the cargo protein structures and interfere with biological functions of the cargo proteins. To overcome these drawbacks, we conjugated the TAT peptide directly to the EGFP protein in this study. Enhanced green fluorescent protein (EGFP) emits a strong and stable fluorescence detectable conveniently with a non-invasive approach in living cells and in paraformaldehyde-fixed cells and therefore has been widely used in cellular biology for imaging. In the current study, we used EGFP as a cargo mimic because its molecular size is compatible with the typical proteins of pharmaceutical potential and its highly fluorescent signal offers a good quality of data for measurement as well. We conjugated the TAT peptide to the EGFP protein in different ways and examined the effect of their intrinsic properties on the protein transduction capabilities.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Materials

Plasmids pET-28a and pEGFP-C1 were purchased from Merck (Darmstadt, Germany) and Clonetech (Mountain View, CA, USA), respectively. BL21 (DE3) was purchased from Chaoyan Biology Limited Company (Shanghai, China). Plasmid DNA extraction kit and PCR product purification kit were purchased from Biomed Co. Ltd. (Beijing, China). Agarose gel DNA purification kit, DNA ligation kit, PCR kit, and restriction enzymes (EcoRI, HindIII, NheI, XhoI) were purchased from TaKaRa Co. Ltd. (Dalian, China). Histidine tag protein purification column was purchased from GE Healthcare Companies (Fairfield, CT, USA). Antibodies for Western blot analysis were purchased from Genscript Technology Corporation (Nanjing, China) and Golden Bridge Biotechnology Company (Zhongshan, China). Kunming mice (8 weeks old, male, ∼22 g) were purchased from the Animal Laboratory Center of China Medical University. Primers were synthesized from Genscript Technology Corporation (Nanjing, Jiangsu, China).

Methods

Plasmid construction

Construction of plasmid pET-28a-TAT(+) The sense oligonucleotide having the sequence of 5′AAAGCTAGCGGCTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTGGCGAATTCAAA3′ and its complementary antisense oligonucleotide were synthesized. The underlined sequences are the NheI and EcoRI restriction sites, and the double-underlined sequences encode the amino acid sequence YGRKKRRQRRR of HIV-1 TAT domain (#47-#57).

The synthetic double-strand oligonucleotide and plasmid pET-28a were digested with NheI and EcoRI, respectively. The digested oligonucleotide and pET-28a were ligated and then transformed into competent cell DH5α. The selected transformants on a LB plate containing kanamycin were cultured in a LB medium containing kanamycin at 37 °C.

Construction of plasmid pET-28a-TAT–EGFP A 750-bp fragment of EGFP was amplified from pEGFP-C1. The PCR product and pET28a-TAT were digested with EcoRI and HindIII, respectively, and then ligated using DNA ligation kit. The ligated compound was then transformed into competent cell DH5α, and the selected colonies were cultured in a LB medium containing kanamycin at 37 °C.

Other plasmids were constructed using the same procedure, except that pET-28a-EGFP–TAT(+) and pET-28a-EGFP–TAT(−) used XhoI restriction site (Figure 1). All the pET-28a-TAT–EGFP plasmids were confirmed by DNA sequencing. TAT(−) represents the reversed amino acid sequence of the TAT(+): RRRQRRKKGRY.

image

Figure 1.  Structures of plasmids used to express EGFP protein and TAT–EGFP conjugates, respectively.

Download figure to PowerPoint

Expression and purification of TAT–EGFP conjugates

The plasmid pET-28a-TAT(+)-EGFP was transformed into Escherichia coli BL21 (DE3) cells that grew on a LB plate containing kanamycin at 37 °C for 12 h. The selected colonies were cultured in 100 mL of LB medium. When the OD600 reading of cell culture was about 0.6, IPTG was added to the final concentration of 0.5 mm. Three hours later, cell culture was harvested with centrifugation. After sonication, the sample was centrifuged at 13 800 g for 10 min at 4 °C and the supernatant was then filtered through a 0.22-μm filter. The filtrant was loaded on a His-tag protein purification column. The fusion proteins were eluted with the elution buffer [20 mm PBS (16.2mM Na2HPO4, 3.8mM NaH2PO4), 0.5 m NaCl, 0.5 m imidazole, pH 7.4] and further desalted using a HiTrap IMAC Hp column (GE Healthcare). His-tag has been cleaved off after purification. The same procedure was also applied to purification of other TAT–EGFP conjugates.

SDS–PAGE and Western blot analyses

TAT-fused EGFP proteins were analyzed on 12% SDS–PAGE, respectively. The gel was then transferred to a nitrocellulose membrane. The membrane was blocked with 5% defatted milk solution and further incubated with rabbit anti-tagged histidine polyclonal antibody (dilution 1:1000) for 1 h at room temperature. After washing three times with TBST, the membrane was incubated with horseradish peroxidase-conjugated affinipure goat anti-rabbit IgG (dilution 1:5000) for 10 h. The membrane was washed three times with TBST and visualized with enhanced chemiluminescence.

In vitro transduction

HeLa cells were cultured in DMEM at 37 °C under a condition of 95% humidity and 5% CO2 for 4–6 h. When cells were grown to confluence on a 6-well plate, the medium was replaced with 1 mL of fresh DMEM, and 20 μg/mL of EGFP was added to the medium. The cells continued to grow for 1 h and then were washed with PBS three times, and fresh DMEM was added. HeLa cells were examined on an inverted fluorescent microscope (LX71, Olympus) with a 20× objective. HeLa cells were also treated using the same procedure with 20 μg/mL of four TAT-fused EGFP proteins, respectively.

In vivo transduction

Kunming mice (about 22 g) were housed in two cages at 22–25 °C on a 12-h light/dark cycle with food and water ad libitum. These mice were intraperitoneally injected with 25 μg of TAT(+)–EGFP in 0.5 mL of PBS. Two hours later, mice were anesthetized and perfused with 0.9% sodium chloride and 4% paraformaldehyde with heart perfusion. Heart, kidney, liver, and brain were then removed, and their frozen sections were made with a freezing microtome Leica CM1900 (Leica Microsystems, Berlin, Germany) at −20 °C (4). These slices (8.0 μm of thickness) were mounted on coverslips and fixed, and their fluorescent images were recorded under a fluorescent microscope. The same procedure was also applied to living mice treated with EGFP as a control. All animal protocols were approved by the institution’s Animal Care and Use Committee.

Flow cytometric analysis

The transduction efficiencies of TAT-fused EGFP proteins were quantified using fluorescent flow cytometry (FACSC Caliber, BD, San Jose, CA, USA) with FL1 filters (excitation, 488 nm; emission, 532 nm). HeLa cells treated with four TAT-fused EGFP proteins and EGFP described previously were trypsin-digested to avoid fake fluorescent signals. The flow cytometric results were analyzed with software Cellquest.

CD spectral analysis

CD spectra of EGFP protein and TAT–EGFP conjugates were collected on CD spectropolarimeter (J-810; Jasco, Easton, MD, USA) in the range of 190–240 nm. These samples were prepared in 5 mm phosphate-buffered solution (pH 7.4) at a final concentration of 20 μg/mL. A quartz sample cell with a path length of 1 mm was maintained at room temperature during measurements.

Bioinformatic analysis of TAT-fused EGFP and EGFP

The secondary structures and physicochemical properties (isoelectric point, hydrophilicity, solvent accessibility, antigenicity, and transmembranous regions) of EGFP and TAT-fused EGFPs were analyzed using software Antheprot.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Expression and purification of TAT–EGFP conjugates

To investigate the TAT-mediated protein transduction process, we constructed plasmids of pET-28a-TAT(+)-EGFP, pET-28a-TAT(−)-EGFP, pET-28a-EGFP–TAT(+), pET-28a-EGFP–TAT(−), and pET-28a-EGFP, respectively (Figure 1). Each of these plasmids was transduced to E. coli BL21 (DE3) cells separately, which grew on LB medium. After IPTG induction, TAT–EGFP conjugates and the EGFP protein expressed in a large quantity. Figure 2A compares the expression levels of five proteins before and after IPTG induction. After purification, the SDS–PAGE analyses of five proteins show a single band at ∼28KD or ∼29KD, consistent with the molecular weights of the EGFP protein and TAT–EGFP conjugates (Figure 2B). Western blot analyses verify the identity of each protein (Figure 2C).

image

Figure 2.  (A) SDS–PAGE analysis of the expressed TAT–EGFP conjugates under IPTG induction. (B) SDS–PAGE analysis of the purified TAT–EGFP conjugates. M: protein marker. (C) Western blot analysis of TAT–EGFP conjugates.

Download figure to PowerPoint

Secondary structure evaluation of TAT–EGFP conjugates

Figure 3 shows that CD spectra of EGFP and four TAT–EGFP conjugates are almost identical in the region of 190–240 nm, indicating that they share very similar secondary structure. The negative curve in the region of 210–230 nm indicates that the secondary structure of EGFP and four TAT–EGFP conjugates is composed of β-pleated sheet dominantly with a minor contribution of α–helix and β-turn. These data also suggest that conjugation of TAT peptide with EGFP protein does not alter the native structure of EGFP very much.

image

Figure 3.  CD spectra of EGFP protein and four TAT–EGFP conjugates at the concentration of 20 μg/mL.

Download figure to PowerPoint

Transduction of TAT–EGFP conjugates into HeLa cells and PC12 cells

HeLa cells were incubated with TAT(+)–EGFP for 1 h. After treatment with trypsin and extensive wash, they were examined using flow cytometric analysis. Trypsin digestion has been recommend to remove TAT–EGFP conjugates adhered to the cell surface, ensuring that the observed fluorescent signals are from the TAT–EGFP conjugates penetrated inside cells (15,27). Flow cytometric results showed that HeLa cells treated with TAT(+)–EGFP had strong fluorescent signals, whereas the native HeLa cells without treatment had very low fluorescent signal (shaded peak with purple) (Figure 4). As the concentration of TAT(+)–EGFP increases, the fluorescent intensity of these HeLa cells increases proportionally and becomes saturated above 80 μg/mL.

image

Figure 4.  (A) Flow cytometric results of HeLa cells treated with 20, 40, 60, 80 and 100 μg/mL of TAT(+)–EGFP conjugate for 60 min. HeLa cells without TAT(+)–EGFP incubation are used as a control (shaded peak with purple). (B) Concentration-dependent behavior of TAT-mediated transduction. Data are an average of three independent measurements.

Download figure to PowerPoint

The transduction efficiencies of four TAT–EGFP conjugates were also compared. Figure 5A shows that HeLa cells treated with EGFP have a relatively low fluorescent intensity (light green peak), and the HeLa cells treated with each of four TAT–EGFP conjugates exhibit very high fluorescent signals. Again, the native HeLa cells show very low fluorescence (shaded peak with purple). Figure 5B shows that four TAT–EGFP conjugates have almost equal transduction efficiencies except TAT(−)–EGFP with a small decrease. The results are averaged data of at least three independent measurements.

image

Figure 5.  (A) Flow cytometric analysis of HeLa cells treated with EGFP protein and four TAT–EGFP conjugates. The concentration of EGFP protein and TAT–EGFP conjugates are 20 μg/mL. HeLa cells without incubation is used as a control (shaded peak with purple). (B) Histographic data showing the transduction efficiencies of different TAT–EGFP conjugates. Data are the mean ± SD of at least three independent measurements.

Download figure to PowerPoint

The TAT-mediated protein transduction was further examined with fluorescent microscope. Very high fluorescent signals are observed in HeLa cells and PC12 cells treated with TAT(+)–EGFP conjugate (Figure 6). In contrast, cells treated with EGFP exhibits very weak fluorescence. HeLa cells and PC12 cells treated with other three TAT–EGFP conjugates demonstrate a transduction behavior similar to TAT(+)–EGFP (Figure S1).

image

Figure 6.  Bright-light images and fluorescent images of the same viewfield of HeLa cells (A and B) and PC12 cells (C and D) after treatment with TAT(+)–EGFP and EGFP, respectively.

Download figure to PowerPoint

Transduction of TAT(+)–EGFP into organs of living mice

Pictures A1–D1 in Figure 7 are the fluorescent images of tissue slice of liver, brain, kidney, and heart with amplification of ×100, and pictures A2–D2 are the images of these tissue slices with ×400 amplification. All images of A1–D1 and A2–D2 exhibit strong fluorescent intensity. In contrast, thin tissue slices of these mice injected with EGFP show very low fluorescent intensity (A3–D3), suggesting that EGFP protein cannot penetrate into these organs without TAT transduction.

image

Figure 7.  Fluorescent microscopic images of TAT-mediated EGFP transduction in vivo. A–D are fluorescent images of liver, brain, kidney, and heart tissue slides of living mice injected intraperitoneally with TAT(+)–EGFP (amplification: 100×). A2–D2 are the same images as A1–D1 with 400× amplification. A3–D3 are fluorescent images of these organs of living mice injected intraperitoneally with EGFP.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Delivering biopharmaceutical drugs to the targeted cells has been a great challenge because the impermeable plasma membrane presents a natural barrier for these bulky biomolecules to traverse. Protein transduction domain (PTD) or cell-penetrating peptide (CPP) sheds light on the enhancement of biopharmaceutical molecule delivery (6–8). Many previous studies have examined the interactions of the PTD peptides with surface receptors and proteoglycans on cell membrane and have differentiated the PTD-mediated transduction pathways using different mutant cell lines as well as different inhibitors. To improve the utility of the PTD-protein conjugates for practical applications, we focused our attention to the intrinsic properties of the PTD peptide to examine the effect of the amino acid sequence, the secondary structure, and the relative positions of the TAT peptide with respect to the cargo protein on the TAT-mediated transduction efficiency.

Figure 3 shows that the CD spectra of EGFP and four TAT–EGFP conjugates in the region of 190–240 nm are almost identical. A broad wave trough indicates that β-sheet is the major component of their secondary structures, which is consistent with the crystallographic data of EGFP (28). In addition, we have used bioinformatic analysis to predict that four TAT–EGFP conjugates should have a similar secondary structure (Table S1). These experimental and calculated data suggested that conjugating the TAT peptide to cargo proteins did not alter the native structure of the cargo proteins, and consequently, it could be expected that the TAT-conjugated cargo proteins would demonstrate same biological functions. Flow cytometric results (Figures 4 and 5) showed clearly that the TAT–EGFP conjugates could be delivered into HeLa cells effectively whereas EGFP could not. This comparison proved the utility of the TAT peptide as an effective vehicle to deliver bulky proteins into cells. Furthermore, the TAT-mediated transduction showed a concentration-dependent behavior (Figure 4), being consistent with other observations (4,29). Figure 5 shows that four TAT–EGFP conjugates have been delivered into cells with almost equal efficiency at 37 °C after 60 min of incubation, which leads to an important conclusion that the TAT-mediated transduction does not depend on the sequence orientation of the TAT peptide as well as its relative position. Our results reached a good consistence with previous reports. Ryu et al. have constructed TAT–GFP fusion proteins in which the TAT sequence was fused with the N- and/or C-termini of GFP and observed that the GFP fusion protein with TAT sequence at its C-terminus was taken up as efficiently as the GFP fusion protein with TAT sequence at its N-terminus. When the protein was conjugated to PTDs at its both termini, delivering the fusion proteins was even more efficient (18).

In the current study, incubation of these TAT–EGFP conjugates with HeLa and PC12 cells for 5 days did not show any sign of cell death, offering an experimental evidence of therapeutic feasibility. Previously, Tsutsumi et al. have evaluated the cytotoxicity of four major PTDs (Tat, Antp, Rev, and VP22) in various cell lines (HeLa, HaCaT, A431, Jurkat, MOLT-4, and HL60 cells) and found that the TAT-conjugated protein was the least toxic among the four PTDs (13). Although the reason for this phenomenon is not clear, it has been speculated that the primary structure of the individual PTDs or the cell surface proteins that interact with the individual PTDs might be responsible for the differences in their transduction efficiency and cytotoxicity (13). Recently, Holm et al. have constructed retro-inversion of the two most commonly used CPPs (RI-CPPs) using D-amino acids and examined their cytotoxicity in comparison with their parent peptides in different cell lines (30). Interestingly, treatment of cells with these RI-CPPs induced trypsin insensitivity and rapid severe toxicity in contrast to l-peptides. The reduced metabolic activity, condensed cell nuclei, and the induced apoptosis were evidenced at 20 μm concentration of RI-CPPs within 4 h while parent l-peptides had negligible effects.

To prove the utility of PTD peptides in pharmaceutical applications, an in vivo experiment was conducted where EGFP and the TAT(+)–EGFP conjugate solution were injected intraperitoneally into live mice, respectively. Only the TAT(+)–EGFP conjugate was tested in this experiment because four TAT–EGFP conjugates have already shown an almost equal transduction efficiency in vitro. The intraperitoneal injection of PTD-conjugated functional proteins has shown to be an effective delivery system to the different organs and successful treatment of protection against oxidative stress (4) and against ischemic brain injury (5). Slides of liver, heart, brain, and kidney of these mice were obtained and their fluorescent images were compared. The total fluorescent intensity of images A2–D2 in Figure 7 exhibited at least tenfold increases in comparison with A3–D3 in Figure 7, proving a successful delivery of the TAT–EGFP conjugates to these organs. Fluorescent images A2–D2 were quantified to be 22 000, 24 000, 35 000, and 51 000, respectively. These variations suggested that the TAT-mediated delivery efficiency might be tissue dependent. In a previous study, the TAT peptide was linked to different proteins (β-galactosidase, horseradish peroxidase, and RNase A) and injected intravenously via the tail vein of mice. Staining showed that TAT-β-galactosidase had a high delivery efficiency to heart, liver, and spleen, a low-to-moderate delivery efficiency to lung and skeletal muscle, and little or no delivery to kidney and brain (31). Another study showed that after s.c. injection into mice, a 12-mer peptide (HN-1) was able to cross plasma membranes in a cell-specific manner, recognizing only human head and neck squamous cell cancer (HNSCC) (32).

Our study furnished a valuable and important opinion for the biopharmaceutical agent development and therapeutic applications. Previous studies have showed that PTD peptides were fused with the cargo proteins at its N-terminus and that the PTD sequences were adapted directly from their original sequence in most PTD–protein conjugates. Such conjugates, however, need to be optimized to accomplish desired biological functions. For example, to exert the expected therapeutic purpose in the targeted cells, a protein/peptide-based biopharmaceutical agent needs to recognize the targeted cells correctly, to traverse cellular membrane effectively, and to interact with targeted molecules (DNAs, RNAs, or proteins) in cytoplasm domain or nuclei or mitochondria. Thus, these biopharmaceutical agents should conjugate a cell-recognition sequence, a PTD sequence, and functional proteins or peptides in one construct in a more well-designed manner. Our current data proved that the TAT peptide could be conjugated with functional peptides or proteins in a more flexible way, either in original or in reversed sequence, or in either the N-terminus or the C-terminus of the functional peptide or protein, without scarifying the transduction efficiencies.

The mechanism of PTD-mediated cellular entry has been proposed to be the ionic interaction between the PTDs and the plasma membrane constituents. Most PTDs are rich in basic amino acids, and their isoelectric points are close to each other with a small margin. In the current study, bioinformatic analysis showed that the isoelectric points of TAT–EGFP conjugates were elevated from 5.505 of EGFP protein to 6.885, although the extra eight basic residues of the TAT sequence (YGRKKRRQRRR) accounted for only 5.3% of the total amino acid residues of the TAT–EGFP conjugates. The increased pI values could be used to elucidate the protein transduction mediated by this basic peptide. The high binding affinity between PTD peptides and sulfated glycans on cell membrane has been considered as a driving force to initiate this transduction, and deletion or substitution of a single basic amino acid residue could reduce the transduction efficiency of the PTD peptides (21). Other studies have shown transduction efficiency variations from PTD to PTD, which have been attributed to the differences in the charge distribution, the amphipathicity, the unfolding degree, the polarity, and the molecular shape of the peptides (4,13).

In summary, four TAT-conjugated proteins of TAT(+)–EGFP, TAT(−)–EGFP, EGFP–TAT(+), and EGFP–TAT(−) demonstrate almost identical transduction efficiencies to traverse the cell membrane in vitro, and a capability of delivering into different organs of living mice in vivo. Experimental results and bioinformatic analyses suggest that the TAT-mediated protein transduction is independent of the secondary structure, the amino acid sequence, and the relative location of the TAT peptide. These data conclude that PTD peptide and cargo proteins can be conjugated in more convenient arrangements to meet the requirement for biopharmaceutical applications.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Y. Guan thanks the National Natural Science Foundation of China for the financial support (31070705).

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information
  • 1
    McConnell K.W., Muenzer J.T., Chang K.C., Davis C.G., McDunn J.E., Coopersmith C.M., Hilliard C.A., Hotchkiss R.S., Grigsby P.W., Hunt C.R. (2007) Anti-apoptotic peptides protect against radiation-induced cell death. Biochem Biophys Res Commun;355:501507.
  • 2
    Wu S.P., Fu A.L., Wang Y.X., Yu L.P., Jia P.Y., Li Q., Jin G.Z., Sun M.J. (2006) A novel therapeutic approach to 6-OHDA-induced Parkinson’s disease in rats via supplementation of PTD-conjugated tyrosine hydroxylase. Biochem Biophys Res Commun;346:16.
  • 3
    Fu A.L., Wu S.P., Dong Z.H., Sun M.J. (2006) A novel therapeutic approach to depression via supplement with tyrosine hydroxylase. Biochem Biophys Res Commun;351:140145.
  • 4
    Choi H.S., Lee S.H., Kim S.Y., An J.J., Hwang S.I., Kim D.W., Yoo K.Y. et al. (2006) Transduced Tat-α-Synuclein protects against oxidative stress in vitro and in vivo. J Biochem Mol Biol;39:253262.
  • 5
    Kim D.W., Eum W.S., Jang S.H., Kim S.Y., Choi H.S., Choi S.H., An J.J. et al. (2005) Transduced Tat-SOD fusion protein protects against ischemic brain injury. Mol Cell;19:8896.
  • 6
    Derossi D., Joliot A.H., Chassaing G., Prochiantz A. (1994) The third helix of the Antennapedia homeodomain translocates through biological membranes. J Biol Chem;269:1044410450.
  • 7
    Derossi D., Chassaing G., Prochiantz A. (1998) Trojan peptides: the penetratin system for intracellular delivery. Trends Cell Biol;8:8487.
  • 8
    Derossi D., Calvet S., Trembleau A., Brunissen A., Chassaing G., Prochiantz A. (1996) Cell Internalization of the third helix of the antennapedia homeodomain is receptor-independent. J Biol Chem;271:1818818193.
  • 9
    Futaki S., Suzuki T., Ohashi W., Yagami T., Tanaka S., Ueda K., Sugiura Y. (2001) Arginine-rich peptides. An abundant source of membrane-permeable peptides having potential as carriers for intracellular protein delivery. J Biol Chem;276:58365840.
  • 10
    Ter-Avetisyan G., Tunnemann G., Nowak D., Nitschke D., Herrmann A., Drab M., Cardoso M.C. (2009) Cell entry of arginine-rich peptides is independent of endocytosis. J Biol Chem;284:33703378.
  • 11
    Torchilin V.P., Rammohan R., Weissig V., Levchenko T.S. (2001) TAT peptide on the surface of liposomes affords their efficient intracellular delivery even at low temperature and in the presence of metabolic inhibitors. Proc Natl Acad Sci USA;98:87868791.
  • 12
    Ferrari A., Pellegrini V., Arcangeli C., Fittipaldi A., Giacca M., Beltram F. (2003) Caveolae-mediated internalization of extracellular HIV-1 Tat fusion proteins visualized in real time. Mol Ther;8:284294.
  • 13
    Sugita T., Yoshikawa T., Mukai Y., Yamanada N., Imai S., Nagano K., Yoshida Y., Shibata H., Yoshioka Y., Nakagawa S., Kamada H., Tsunoda S.I., Tsutsumi Y. (2008) Comparative study on transduction and toxicity of protein transduction domains. Br J Pharmacol;153:11431152.
  • 14
    Vives E. (2003) Cellular uptake of the Tat peptide: an endocytosis mechanism following ionic interactions. J Mol Recognit;16:265271.
  • 15
    Richard J.P., Melikov K., Vives E., Ramos C., Verbeure B., Gait M.J., Chernomordik L.V., Lebleu B. (2003) Cell-penetrating peptides. A reevaluation of the mechanism of cellular uptake. J Biol Chem;278:585590.
  • 16
    Liu Y., Jones M., Hingtgen C.M., Bu G., Laribee N., Tanzi R.E., Moir R.D., Nath A., He J.J. (2000) Uptake of HIV-1 tat protein mediated by low-density lipoprotein receptor-related protein disrupts the neuronal metabolic balance of the receptor ligands. Nat Med;6:13801387.
  • 17
    Richard J.P., Melikov K., Brooks H., Prevot P., Lebleu B., Chernomordik L.V. (2005) Cellular uptake of unconjugated TAT peptide involves clathrin-dependent endocytosis and heparin sulfate receptors. J Biol Chem;280:1530015306.
  • 18
    Ryu J.,  Han K.,  Park J.,  Choi S.Y. (2003) Enhanced uptake of a heterologous protein with an HIV-1 Tat protein transduction domains (PTD) at both termini. Mol Cell;16:385391.
  • 19
    Tyagi M., Rusnati M., Presta M., Giacca M. (2001) Internalization of HIV-1 tat requires cell surface heparan sulfate proteoglycans. J Biol Chem;276:32543261.
  • 20
    Console S., Marty C., García-Echeverría C., Schwendener R., Ballmer-Hofer K. (2003) Antennapedia and HIV transactivator of transcription (TAT) “protein transduction domains” promote endocytosis of high molecular weight cargo upon binding to cell surface glycosaminoglycans. J Biol Chem;278:3510935114.
  • 21
    Gump J.M., June R.K., Dowdy S.F. (2010) Revised role of glycosaminoglycans in TAT protein transduction domain-mediated cellular transduction. J Biol Chem;285:15001507.
  • 22
    Fotin-Mleczek M., Welte S., Mader O., Duchardt F., Fischer R., Hufnagel H., Scheurich P., Brock R. (2005) Cationic cell-penetrating peptides interfere with TNF signaling by induction of TNF receptor internalization. J Cell Sci;118:33393351.
  • 23
    Wadia J.S., Stan R.V., Dowdy S.F. (2004) Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat Med;10:310315.
  • 24
    Ignatovich I.A., Dizhe E.B., Pavlotskaya A.V., Akifiev B.N., Burov S.V., Orlov S.V., Perevozchikov A.P. (2003) Complexes of plasmid DNA with basic domain 47-57 of the HIV-1 Tat protein are transferred to mammalian cells by endocytosis-mediated pathways. J Biol Chem;278:4262542636.
  • 25
    Duchardt F., Fotin-Mleczek M., Schwarz H., Fischer R., Brock R. (2007) A comprehensive model for the cellular uptake of cationic cell-penetrating peptides. Traffic;8:848866.
  • 26
    Kubo E., Fatma N., Akagi Y., Beier D.R., Singh S.P., Singh D.P. (2008) TAT-mediated PRDX6 protein transduction protects against eye lens epithelial cell death and delays lens opacity. Am J Physiol Cell Physiol;294:C842C855.
  • 27
    Vivès E., Brodin P., Lebleu B. (1997) A truncated HIV-1 tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J Biol Chem;272:1601016017.
  • 28
    Yang F., Moss L.G., Phillips G.N. (1996) The molecular structure of green fluorescent protein. Nat Biotech;14:12461251.
  • 29
    Park J., Ryu J., Kim K.A., Lee H.J., Bahn J.H., Han K., Choi E.Y., Lee K.S., Kwon H.Y., Choi S.Y. (2002) Mutational analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery of an exogenous protein into mammalian cells. J Gen Virol;83:11731181.
  • 30
    Holm T., Räägel H., Andaloussi S.E., Hein M., Mäe M., Pooga M., Langel Ü. (2011) Retro-inversion of certain cell-penetrating peptides causes severe cellular toxicity. Biochim Biophys Acta;1808:15441551.
  • 31
    Fawell S., Seery J., Daikh Y., Moore C., Chen L.L., Pepinsky B., Barsoum J. (1994) Tat-mediated delivery of heterologous proteins into cells. Proc Natl Acad Sci USA;91:664668.
  • 32
    Hong F.D., Clayman G.L. (2008) Isolation of a peptide for targeted drug delivery into human head and neck solid tumors. Cancer Res;60:65516556.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgment
  7. References
  8. Supporting Information

Figure S1. Microscopic analysis of HeLa cells treated with differentTAT-EGFP conjugates.

Table S1.Predicted secondary structures of TAT, EGFP and TATEGFPconjugates.

FilenameFormatSizeDescription
CBDD_1315_sm_FigS1-TableS1.docx1395KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.