SEARCH

SEARCH BY CITATION

Supplementary Figure S1: Nucleotide sequence homology comparison of ITS1, 5.8S rRNA gene, and ITS2 sequences of fungal strain isolated from green coffee been using NCBI Blast; primers: ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′); polymerase chain reaction (PCR) conditions: initial denaturation temperature of 94 °C for 3 min, followed by 32 cycles of denaturation, annealing and extension (94 °C for 45 s, 56 °C for 1 min, and 72 °C for 1 min) and final extension at 72 °C for 10 min.

Supplementary Figure S2: Analysis of OTA production by different Aspergillus ochraceus strains by thin-layer chromatography (TLC); L1: OTA standard (200 ng); L2: A. ochraceus (isolated from coffee beans); L3: A. ochraceus (MTCC 1810); L4: A. ochraceus (MTCC 4893); L5: A. ochraceus (MTCC 4643); L6: A. ochraceus (MTCC 1877); L7: A. ochraceus (MTCC 6037); L8: A. ochraceus (MTCC 7476).

FilenameFormatSizeDescription
JFDS_2572_sm_figures1.doc26KSupporting info item
JFDS_2572_sm_figures2.doc50KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.