SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Levofloxacin (LVFX) is a broad spectrum third generation fluoroquinolone antibiotic, used in the treatment of severe or life-threatening bacterial infections. Photosensitizing mechanism of LVFX was investigated under the ambient environmental intensities of UV-A, UV-B and sunlight exposure. Phototoxic effects of LVFX were assessed on NIH-3T3 and HaCaT cell lines. Results identified first time three photoproducts of LVFX at ambient levels of UV-R by LC-MS/MS. The generation of reactive oxygen species (ROS) was investigated photochemically as well as intracellularly in HaCaT cell line. ROS were significantly quenched by specific quenchers like DABCO, NaN3, d-mannitol and NAC. Photosensitized LVFX caused lipid peroxidation at different concentrations. Quenching study with superoxide dismutase confirms the LVFX-induced lipid photoperoxidation. Further, photocytotoxicity of LVFX showed significant reduction in cell viability by MTT and neutral red uptake assays. LVFX caused cell arrest in G2/M phases as well as induced apoptosis through ROS-dependent pathway. In addition, photosensitized LVFX also induced upregulation of p21 and Bax/Bcl-2 genes ratio. India is a tropical country and most of the human activities such as agriculture, commerce, sports, etc. take place in bright sunlight; therefore, photosensitive LVFX may lead to skin/ocular disorders and immune suppression. Information is needed regarding the phototoxicity of LVFX for human safety.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Ozone concentration has been reduced significantly in the past 30 years due to the release of chlorofluorocarbons and nitrogen oxides in the stratosphere (1). Ozone depletion has enhanced the ultraviolet-radiation (UV-R) penetration, which leads to the higher risk of skin cancers (2). Levels of ambient UV-R intensities were found greater in tropical and high altitude regions than other areas (3), resulting in higher phototoxic effects (4). The increased UV-R intensity in sunlight is likely to induce phototoxic effects like skin cancers, cataracts, skin diseases and immune suppression (5). Levofloxacin (LVFX) is a third generation fluoroquinolone derivative (6), used in the treatment of severe or life-threatening bacterial infections when other antibiotics fail to respond (7). It is distributed throughout the body and penetrates into body tissues and fluids (8). It undergoes limited metabolism in human beings, ca 87% dose recovered as unchanged in urine within 48 h, whereas less than 4% recovered in feces within 72 h. The known metabolites of LVFX in human urine are desmethyl and N-oxide (9).

The phototoxic effects of UV-R with or without drug are related to the excessive generation of 1O2, O2˙ and ˙OH (ROS) (10). Although there is no direct correlation between the generation of 1O2 and the order of phototoxicity, there is some correlation between O2˙ production and phototoxicity (11). Photosensitive drugs may produce stable toxic photoproducts which may lead to in vivo phototoxicity (12). Pefloxacin and ciprofloxacin caused UV-A induced oedema and immune suppression in mice (13). Some drugs induce lipid peroxidation in erythrocyte membrane under UV-A irradiation (14). ROS have been implicated in many pathological conditions including skin cancer and other adverse effects caused by UV-R (15). Patients using drugs are generally unaware that UV-R penetrates through clouds, window glass and thin clothing and may produce phototoxic responses (16). Phototoxicity testing was recommended by the Organization for Economic Co-operation and Development (OECD), according to which in vitro tests should be carried out before animal testing (17). The phototoxic effects induced by fluoroquinolones are attributed to the generation of ROS (18). These radical reactions lead to oxidative damage of biomolecules resulting in the apoptotic or necrotic cell death. Apoptosis is morphologically a form of cell death distinct from necrosis. It includes cell shrinkage, loss of cell–cell junctions, nucleus fragmentation and membrane blebbing (19). Acute UV-R exposure results in apoptotic cells in vivo (20) and in vitro (21). Recently, the proto-oncogenes bcl-2 and bax have emerged as important regulators of apoptosis. The death-suppressing proto-oncogene bcl-2 has been implicated in UV-R induced apoptosis (22). The death-suppressing activity of bcl-2 is regulated by bax, which promotes cell death. The ratio of these two genes is considered to be important when determining whether the cell undergoes apoptosis after an appropriate stimulus (23). Earlier studies of different groups of drugs’ phototoxicity were performed at higher doses of UV-R (24,25).

We used immortalized human keratinocyte (HaCaT) and mouse fibroblast (NIH-3T3) cell lines for the following purposes: (1) to investigate the photodegradation and identification of photoproducts at ambient intensities of sunlight/UV-R, (2) to study the cellular mechanism of phototoxicity and (3) to determine cell cycle arrest and clarify the molecular mechanism of apoptosis.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Chemicals and culture wares. N,N-dimethyl-p-nitrosoaniline (RNO), superoxide dismutase (SOD), nitro-blue tetrazolium (NBT), levofloxacin (LVFX), fetal bovine serum (FBS), Dulbecco’s modified eagle’s medium (DMEM F-12), antibiotic and antimycotic solution (penicillin, streptomycin and amphotericin B), trypsin, l-histidine, 3-(4,5-dimethylthiozolyl-2)-2,5-diphenyl tetrazolium bromide (MTT), neutral red (NR), NAC (N-acetylcysteine), sodium azide (NaN3), 1,4-diazabicyclo 2-2-2-octane (DABCO), tricarboxylic acid (TCA), sodium chloride, ascorbic acid, 2′-7′-dichlorodihydrofluorescein diacetate (DCFH-DA), carbonate and phosphate buffers were procured from Sigma chemical company (St. Louis, MO). Acridine orange (AO) and ethidium bromide (EB) were purchased from Sigma chemical company. Linoleic acid and tween-20 were obtained from M.P. Biomedicals Inc. (Solon) and Hank’s Balanced Salt Solution (HBSS) was purchased from Invitrogen Corporation. Ferrous sulfate, ammonium acetate, acetylacetone and formaldehyde were procured from M/s Merck India and M/s Qualigens, India Ltd. Milli-Q double-distilled deionized water was used in the study. All plastic wares including 96-well plates and 25 cm2 (polystyrene coated) culture flasks were purchased from Nunc. Cell lines were procured from National Centre for Cell Sciences, Pune, India, since then maintained in our laboratory.

Radiation source and dosimetry.  The UV-irradiation system comprised an array of 1.2 m long UV-R emitting tubes manufactured by Vilber Lourmat (France). The intensity of emitted light was measured by a microprocessor-controlled RMX-3W radiometer (Vilber Lourmat) equipped with calibrated UV-A, UV-B and UV-C detecting probes. The spectral emission of UV-A source ranged from 320 to 400 nm with a peak at 365 nm, whereas the spectral emission of UV-B source ranged from 290 to 320 nm with a peak at 312 nm. The radiation dose was measured in J cm−2. Intensities selected for irradiation were based on dosimetry carried out at our laboratory’s roof top between 12.00 P.M. and 1.00 P.M. and were parallel to the ambient intensities of UV-A and UV-B reaching in sunlight at Lucknow (26°45′N latitude and 80°50′E longitude at 146 m above the mean sea level).

Radiation exposure.  Radiation (UV-A and UV-B) exposure was carried out in a temperature controlled (25 ± 2°C) radiation chamber. The samples were put at a minimum distance of 22 cm from the source. Glass petri dishes (60 × 15 mm) were used for photochemical reactions. Sunlight exposure was carried out during clear sunny days between 11.00 A.M. and 3.00 P.M. at 25 ± 2°C. Petri dishes/culture plates were kept on a platform surrounded by ice packs (Polar Tech Industries, Genova IL, Los Angeles) to prevent temperature increase.

UV–visible analysis of levofloxacin.  Levofloxacin (25 μg mL−1) was exposed under sunlight, UV-A and UV-B in 25 mL Milli-Q deionized double distilled water and aliquots were drawn at the intervals of 60 min, from 0 to 240 min. Photodegradation spectrum of the drug was recorded between 200 and 700 nm.

Liquid chromatography-mass spectrometry  (LC-MS/MS) analysis.  Mass spectrometric detection was performed on an API 4000 mass spectrometer (Applied Biosystems, MDS Sciex, Toronto, Canada) equipped with an API electrospray ionization source. LVFX was optimized by continuous infusion at 10 μL min−1 using syringe pump (Model “11,” Harvard Apparatus). The molecular weight of LVFX is 361. The optimized precursor protonated form of analyte, M+H+ was m/z [RIGHTWARDS ARROW] 362. Zero air and nitrogen gas were used as source and curtain gas, respectively. The optimized Declustering Potential for LVFX was 120 Volt. At these optimized conditions, Q1 scan for control and test samples was performed.

Photochemical generation of reactive oxygen species. Determination of singlet oxygen (1O2): The generation of 1O2 under aerobic condition was measured in aqueous solution. RNO solution (0.35–0.4 × 10−5 m) was prepared in 0.025 m potassium phosphate buffer (pH = 7.0) and l-histidine (10−2 m) was added as a selective acceptor of 1O2. A 10 mL assay solution in a petri dish with or without drug was irradiated under UV-A (5.76–7.92 J cm−2), UV-B (2.16–3.24 J cm−2) and sunlight (60 min). The production of 1O2 was monitored by measuring the decrease in RNO absorbance at 440 nm. The generation of 1O2 was further substantiated by the administration of NaN3 (5 and 10 mm) and DABCO (10 and 25 mm) as specific quenchers (26).

Determination of superoxide anion radical (O2˙). The generation of O2˙ was monitored by recording the photosensitized reduction of NBT to nitroblue diformazan (NBF) spectrophotometrically. NBT solution (1.67 × 10−4 m) was prepared in 0.01 m sodium carbonate buffer (pH = 10). A 10 mL assay system containing drug (1–100 μg mL−1) was irradiated under UV-A (1.92–2.64 J cm−2), UV-B (0.72–1.08 J cm−2) and sunlight (20 min). The production of NBF was monitored by measuring the increase in absorbance at 560 nm. The generation of O2˙ was further confirmed by carrying out quenching study with SOD (10 and 25 Units mL−1) (27).

Determination of hydroxyl radical (˙OH). The generation of ˙OH was measured by ascorbic acid-iron-EDTA system. The iron-catalyzed oxidation of ascorbic acid at 37°C was used. The standard reaction mixture contains 100 mm potassium phosphate buffer pH 7.4, 167 μm iron-EDTA (1:2 mixture), 0.1 mm EDTA, 2 mm ascorbic acid and 33 mm dimethyl sulfoxide in a final volume of 3.0 mL and irradiated. Ascorbic acid was replaced by drug (1–100 μg mL−1). After the completion of irradiation, 1.0 mL of TCA (17.5%, wt/vol) was added. The samples were then assayed for formaldehyde formation. Ammonium acetate acetylacetone reagent was prepared by 2.0 m ammonium acetate, 0.05 m acetic acid and 0.02 m analytical grade redistilled acetylacetone. Equal volumes of aliquot (1.5 mL) and reagent (1.5 mL) were mixed and kept at 37°C for 40 min. The production of formaldehyde was monitored at 412 nm. Further the quenching of ˙OH was performed by adding mannitol (0.5 m) as a specific quencher (28).

Linoleic acid photoperoxidation assay.  Linoleic acid solution was freshly prepared in phosphate buffer saline (PBS) (0.01 m, pH = 7.2) using 0.05% tween-20 as an emulsifying agent. Linoleic acid (0.8 mm) with variable concentration of LVFX from 1 to 25 μg mL−1 was irradiated. Light-induced peroxidation of linoleic acid was measured through the increase in absorbance at 233 nm. Linoleic acid peroxidation was further confirmed by quenching with SOD (28).

Cell culture.  The mouse fibroblast (NIH-3T3) and human keratinocyte (HaCaT) cell lines were grown in DMEM F-12 HAM culture medium supplemented with 10% FBS, antibiotic and antimycotic solution (1.5%) at 5% CO2 and 95% relative humidity at 37°C.

Determination of intracellular ROS production.  Cells were grown in 96-multiwell black plates (2 × 104 cells per well) and treated with LVFX (1–100 μg mL−1). Cells were then incubated for 30 min at 37°C with 5 μm carboxy H2-DCFDA in HBSS and exposed under sunlight, UV-A and UV-B irradiation. After irradiation, the fluorescence of DCF was measured through spectrofluorimeter by using 480 nm excitation and 530 nm emission wavelengths. The generation of intracellular ROS was further substantiated by the administration of NAC (1, 10 and 100 μm) as a quencher (29).

Photocytotoxicity assay.  Cultured cells were seeded in 25 cm2 tissue culture flasks. The cells were trypsinized by trypsin-EDTA (0.25%) after 36 h at 80–90% confluency, mixed with equal volume of DMEM F-12 HAM and collected in 50 mL sterilized plastic tube. Cells were washed thrice with HBSS. Cells (2 × 104) were seeded per well in 96-well plates. After incubation for 48 h, the medium was aspirated and cells were washed with HBSS, prior to starting the experiment. A basal control (cells only), dark control (compound-treated cells without light) and light control (cells exposed to light only) were also run along with the experimental set simultaneously under identical conditions. Prior to exposure, cells were incubated for 30 min for the absorption of compound by cells. Cells were then exposed to the desired sunlight/UV-R intensities followed by 30 min incubation in CO2 incubator. HBSS was replaced by DMEM F-12 HAM and batches were processed further for photocytotoxicity assays.

Cell viability assay by MTT.  In brief, cells (2 × 104) were seeded per well in 96-well plates and kept in CO2 incubator for 48 h at 37°C prior to experiment for the proper attachment of the cells. The medium was replaced by HBSS containing various concentrations (1–100 μg mL−1) of LVFX for exposure. At the end of irradiation, HBSS was replaced by complete medium containing MTT (5 mg mL−1) with 200 μL complete medium. The culture plates were kept in the CO2 incubator for 4 h. After incubation, the culture plates were washed twice with HBSS and 200 μL DMSO was added to each well by pipetting up and down to dissolve the content. The absorbance was recorded at 530 nm by using multiwell micro plate reader (28).

Neutral red uptake (NRU) assay.  Briefly, after irradiation, 30 min incubation in CO2 incubator, the drug was removed and washed with HBSS. The culture well plates were allowed to incubate for 3 h in complete medium (DMEM F-12 HAM) containing NR dye (50 μg mL−1) followed by a quick wash with fixative (1% wt/vol CaCl2; 0.5% vol/vol formaldehyde) to remove the unbounded dye. The accumulated dye was extracted with 50% ethanol containing 1% (vol/vol) acetic acid and plates were kept for 20 min on a shaker. The absorbance was recorded at 540 nm (28).

Cell cycle analysis.  Levofloxacin (10–100 μg mL−1) treated cells were simultaneously kept in dark and exposed under UV-A, cells were washed twice with PBS and replaced with fresh culture medium. After 18 h, cells were harvested with trypsin and fixed in 70% ethanol. The fixed cells were then washed twice with PBS and treated with RNase (0.1 mg mL−1) for 30 min at 37°C. Finally, cells were stained with propidium iodide (5 μg mL−1) and incubated in dark for 60 min prior to analysis. Cellular DNA content was determined by flow cytometry (FACS Caliber BD) using the Cell Quest program and Mod Fit software.

Quantitiative real-time PCR analysis.  Total RNA was isolated by using TRIzol reagent (Life Technologies) according to manufacturer’s protocol and concentration of the isolated RNA was determined by nano-drop spectrophotometer (ND-1000 Thermo Scientific) at 260 nm. RNA samples were stored at −20°C. For real-time PCR, cDNA was synthesized by high-capacity cDNA Reverse Transcription Kit (30). Relative quantitation with real-time PCR (Applied Biosystems, 7900 HT Fast-Real-Time PCR system) was carried out for: p21 (CATGAGTGAACGCCTCAAGA, TAGGCACACTGCTTGGTGAG), Bcl-2 (GGATGCCTTTGTGGAACTGT, AGCCTGCAGCTTTGTTTCAT) and Bax (TCTGACGGCAACTTCAACTG, TTGAGGAGTCTCACCCAACC) genes using ABI—sequence detection system (PE Applied Biosystems, Foster City, CA). Real-Time PCR consists of initial denaturation for 10 min at 95°C, 40 cycles of 95°C for 15 s and 50°C for 1 min. Each sample was assayed in triplicates and cycle threshold (CT) values were normalized with housekeeping gene (GAPDH) and the fold change was calculated using 21ΔΔcT method (31).

EB/AO morphology assay.  Determination of live, apoptotic and necrotic cells assay was performed as described by Ribble et al. (32). Cocktail of EB and AO (100 mg mL−1) was prepared in PBS. This assay is based on apoptosis induced characteristic nuclear condensation and fragmentation, whereas necrosis is characterized by the inability to exclude vital dye, leading to orange staining of nuclei. This procedure was used for qualitative analysis of apoptotic and necrotic cells after the treatment of LVFX and UV-A alone or LVFX with UV-A.

Statistical analysis.  Results were summarized as Mean ± SD and compared by one way analysis of variance (ANOVA) followed by Tukey’s post hoc test. Correlation and simple linear regression analysis were used to assess the cell viability, ROS generation and lipid peroxidation with different LVFX concentrations. A two-tailed (α) probability < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Absorption spectra of LVFX

The UV–visible absorption spectrum of LVFX in water at pH 7.0 showed a strong absorption maxima (λmax) in UV-A (331 nm), UV-B (288 nm) and UV-C (226 nm) regions. LVFX was photodegraded under sunlight, UV-A and UV-B irradiation. LVFX under sunlight exposure (0–240 min) led to time dependent photodegradation; similar pattern was obtained under UV-A and UV-B irradiations (Fig. S1).

Photoproduct identification by LC-MS/MS

In order to find out changes in the irradiated samples, LC-MS/MS (Q1 scan) analysis was performed with dark control and irradiated LVFX samples at different time periods as shown in Fig. 1a,b. Three photoproducts were formed in the irradiated samples of LVFX, i.e. P1 (m/z = 348, demethylated), P2 (m/z = 288, demethylated and decarboxylated) and P3 (m/z = 304, demethylated, decarboxylated and defluorinated) as shown in Scheme 1. In product ion spectra (Fig. 1a), the LVFX product ions formed at varying collision energy and found to be different from photoproducts (P1, P2 and P3) of irradiated samples (Fig. 1b).

image

Figure 1.  (a) Product ion spectrum of the Levofloxacin, (b) product ion spectrum of a sample irradiated for 60 min, photoproducts P1, P2 and P3 [M+H]+ with a mass of 348.4, 288.3 and 304.3 Da, respectively.

Download figure to PowerPoint

image

Figure Scheme 1..  Schematic representation of photoproducts P1, P2 and P3 of levofloxacin under sunlight which were identified by LC-MS/MS.

Download figure to PowerPoint

Photochemical generation of ROS

Generation and quenching of singlet oxygen (1O2)  The generation of 1O2 is reported in Table 1 at various concentrations of LVFX under ambient intensities of UV-A (1.6 and 2.2 mW cm−2), UV-B (0.6 and 0.9 mW cm−2) and sunlight (60 min). LVFX at 100 μg mL−1 generates the highest amount of 1O2 under sunlight followed by UV-A and UV-B. The formation of 1O2 was dependent on the drug concentration and the exposure of UV-R. LVFX (100 μg mL−1) did not produce 1O2 in dark control. The lowest yield of 1O2 was observed at 1 μg mL−1 drug concentration under sunlight (60 min) followed by UV-A (5.76 J cm−2) and UV-B (2.16 J cm−2). Similarly, the highest intensities of UV-A (2.2 mW cm−2 or 7.92 J cm−2), UV-B (0.9 mW cm−2 or 3.24 J cm−2) and sunlight (60 min) exposure produced high amount of 1O2 as compared with their respective lower doses. The generation of 1O2 was found highest under sunlight exposure followed by UV-A and UV-B irradiations. The order of 1O2 was following: sunlight > UV-A > UV-B. The regression β coefficient which indicates the rate of change also revealed highest generation of 1O2 under sunlight (b = 0.008) followed by UV-A (b = 0.005) and UV-B (b = 0.002) and were found to be 4- and 2.5-folds higher, respectively, as compared with UV-B.

Table 1.   Photochemical generation of singlet oxygen (1O2) at various concentrations of levofloxacin (1–100 μg mL−1) under the ambient intensities of UV-A (1.6 and 2.2 mW cm−2), UV-B (0.6 and 0.9 mW cm−2) and sunlight (60 min).
Drug conc. (μg mL−1)Radiation exposure
UV-AUV-BSunlight
Intensity mW cm−2Dose J cm−2ΔA at 440 nmIntensity mW cm−2Dose J cm−2ΔA at 440 nmTime (min)ΔA at 440 nm
11.65.760.045 ± 0.0440.62.160.047 ± 0.033 0.0125 ± 0.005
10  0.262 ± 0.029  0.177 ± 0.0380.553 ± 0.116
25  0.375 ± 0.031  0.235 ± 0.0340.868 ± 0.102
50  0.455 ± 0.050  0.300 ± 0.0550.910 ± 0.124
100  0.597 ± 0.040  0.362 ± 0.020601.067 ± 0.053
12.27.920.217 ± 0.0620.93.240.195 ± 0.055  
10  0.365 ± 0.017  0.285 ± 0.023 
25  0.518 ± 0.047  0.437 ± 0.073 
50  0.637 ± 0.080  0.487 ± 0.060 
100  0.755 ± 0.048  0.515 ± 0.058 

Further, the generation of 1O2 by LVFX was confirmed through its specific quenchers like sodium azide and DABCO. Two concentrations of sodium azide (5 and 10 mm) and DABCO (10 and 25 mm) were used for quenching of 1O2 generated by 50 μg mL−1 LVFX (Figure S2). Quenching of 1O2 generated by LVFX was carried out under the exposure of UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). The scavenging effects at higher concentrations of sodium azide (10 mm) and DABCO (25 mm) under UV-A, UV-B and sunlight were 70.2%, 81.4%, 78.45% and 41.4%, 54.5%, 55.5%, respectively.

Generation and quenching of superoxide  anion  radical (O2˙).  The photochemical generation of O2˙ is summarized in Table 2, at various concentrations (1–100 μg mL−1) of LVFX under ambient intensities of UV-A (1.6 and 2.2 mW cm−2), UV-B (0.6 and 0.9 mW cm−2) and sunlight (20 min) exposures. The highest yield of O2˙ was observed under UV-A (2.64 J cm−2) at 100 μg mL−1 concentration while lowest yield under UV-B (0.72 J cm−2) at 1 μg mL−1 drug concentration. The order of O2˙ generating potential of LVFX at various concentrations was the following: UV-A > sunlight > UV-B. UV-A, UV-B and sunlight exposures did not generate O2˙ in sample without drug. LVFX did not generate O2˙ from 1 to 100 μg mL−1 drug concentrations in dark control. The production of O2˙ was concentration and dose dependent under UV-A, UV-B and sunlight exposures. The regression β coefficient which indicates the rate of change also revealed highest generation of O2˙ under UV-A (b = 0.015) followed by sunlight (b = 0.013) and UV-B (b = 0.008) and were found to be 1.87- and 1.625-folds higher, respectively, as compared with UV-B.

Table 2.   Photochemical generation of superoxide generation (O2˙) at various concentrations of levofloxacin (1–100 μg mL−1) under the exposure of ambient intensities of UV-A (1.6 and 2.2 mW cm−2), UV-B (0.6 and 0.9 mW cm−2) and sunlight (20 min).
Drug conc. (μg mL−1)Radiation exposure
UV-AUV-BSunlight
Intensity mW cm−2Dose J cm−2ΔA at 560 nmIntensity mW cm−2Dose J cm−2ΔA at 560 nmTime (min)ΔA at 560 nm
  11.61.920.211 ± 0.0030.60.720.167 ± 0.004 0.222 ± 0.022
 10  0.530 ± 0.005  0.426 ± 0.0120.823 ± 0.175
 25  0.830 ± 0.007  0.662 ± 0.0031.253 ± 0.206
 50  1.028 ± 0.050  0.755 ± 0.0041.508 ± 0.286
100  1.211 ± 0.015  0.950 ± 0.004201.733 ± 0.225
  12.22.640.205 ± 0.0140.91.080.176 ± 0.032  
 10  0.565 ± 0.007  0.473 ± 0.064 
 25  1.236 ± 0.011  0.734 ± 0.016 
 50  1.600 ± 0.026  0.848 ± 0.019 
100  1.780 ± 0.034  1.165 ± 0.037 

Additional evidence for the production of O2˙ was obtained by examining the reduction of NBT and concomitantly carrying out O2˙ quenching studies (Fig. S3) with SOD (10 and 25 U mL−1). Result showed the highest quenching of O2˙ by SOD under UV-A, UV-B and sunlight were 43.5%, 70.8% and 61.5%, respectively.

Generation and quenching of hydroxyl radical (˙OH) Table 3 shows the photochemical generation of ˙OH at various concentrations of LVFX (1–100 μg mL−1) under UV-A (5.76 and 7.92 J cm−2), UV-B (2.16 and 3.24 J cm−2) and sunlight (60 min) exposures. LVFX-induced ˙OH generation in a concentration-dependent manner. The maximum generation of ˙OH was observed under sunlight followed by UV-A and UV-B irradiations. The regression β coefficient indicates the rate of change which revealed highest generation of ˙OH under UV-A (b = 2.0) followed by sunlight (b = 1.997) and UV-B (b = 0.76) and were found 2.63- and 2.62-folds higher as compared with UV-B.

Table 3.   Photochemical generation of hydroxyl radical (˙OH) at various concentrations of levofloxacin (1–100 μg mL−1) under the exposure of ambient intensities of UV-A (1.6 and 2.2 mW cm−2), UV-B (0.6 and 0.9 mW cm−2) and sunlight (60 min).
Drug conc. (μg mL−1)Radiation exposure
UV-AUV-BSunlight
Intensity mW cm−2Dose J cm−2nmole mL−1 of HCHO at 412 nmIntensity mW cm−2Dose J cm−2nmole mL−1 of HCHO at 412 nmTime (min)nmole mL−1 of HCHO at 412 nm
11.65.761.957 ± 1.1340.62.162.747 ± 1.279604.373 ± 1.975
10  18.830 ± 1.590  5.173 ± 1.63230.167 ± 1.230
25  46.707 ± 1.198  8.700 ± 1.81958.123 ± 1.589
50  73.873 ± 1.997  30.040 ± 2.226101.790 ± 1.258
100  135.500 ± 1.155  48.625 ± 1.251206.723 ± 1.288
12.27.928.210 ± 1.8430.93.242.372 ± 1.992 
10  20.972 ± 5.319  15.405 ± 1.482 
25  63.560 ± 1.540  28.778 ± 1.708 
50  95.875 ± 1.678  55.530 ± 1.414 
100  206.500 ± 1.561  78.661 ± 1.256 

Figure S4 shows the percent quenching of ˙OH under UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min) at 50 μg mL−1 LVFX by mannitol (0.5 m). Result shows 57.9%, 46.9% and 51.5% quenching by mannitol under UV-A, UV-B and sunlight, respectively.

Photosensitized peroxidation of linoleic acid

Table 4 shows the photoperoxidation of linoleic acid by LVFX under aerobic condition in aqueous buffer (pH 7.2) under UV-A (7.92 and 5.76 J cm−2), UV-B (2.16 and 3.24 J cm−2) and sunlight (60 min) exposures. Different LVFX concentrations from 1 to 25 μg mL−1 were selected for lipid peroxidation. Highest lipid peroxidation was recorded under sunlight followed by UV-A and UV-B. Lipid peroxidation was dose and concentration dependent under all experimental conditions. The regression β coefficient indicates the rate of change that revealed highest lipid peroxidation under sunlight (b = 0.047) followed by UV-A (b = 0.033), UV-B (b = 0.031) and were found to be 2.23- and 1.33-folds higher as compared with UV-B.

Table 4.   Photoperoxidation of linoleic acid by levofloxacin (1–25 μg mL−1) under the exposure of ambient intensities UV-A (1.6 and 2.2 mW cm−2), UV-B (0.6 and 0.9 mW cm−2) and sunlight (60 min).
Drug conc. (μg mL−1)Radiation exposure
UV-AUV-BSunlight
Intensity mW cm−2Dose J cm−2ΔA at 233 nmIntensity mW cm−2Dose J cm−2ΔA at 233 nmTime (min)ΔA at 233 nm
11.65.760.186 ± 0.0080.62.160.108 ± 0.003 0.507 ± 0.016
10  0.556 ± 0.041  0.440 ± 0.0261.520 ± 0.036
25  0.890 ± 0.026  0.653 ± 0.025601.730 ± 0.032
12.27.920.451 ± 0.0850.93.240.259 ± 0.015  
10  1.176 ± 0.030  0.910 ± 0.052 
25  1.310 ± 0.036  1.07 ± 0.050 

Figure 2 shows the percent photochemical quenching of linoleic acid peroxidation caused by photoilluminated LVFX (10 μg mL−1) through SOD (25 and 50 U mL−1) under UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). The percent quenching of linoleic acid peroxidation by SOD (25 U mL−1) were 21%, 30.3% and 32.3% under UV-A, UV-B and sunlight exposures, respectively. The percent quenching of linoleic acid peroxidation by SOD (50 U mL−1) were 30%, 36% and 40.6% under UV-A, UV-B and sunlight exposures, respectively. The highest quenching was observed under sunlight exposure.

image

Figure 2.  Photochemical quenching of linoleic acid (0.8 mm) peroxidation by superoxide dismutase (SOD) (25 and 50 U mL−1) under UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight exposure (60 min). Values presented are mean of three observations ± SD.

Download figure to PowerPoint

Generation and quenching of intracellular ROS

The ROS levels generated by LVFX under UV-A, UV-B and sunlight exposures were measured by using DCF fluorescence assay (Fig. 3a). Intracellular ROS generation was recorded at various concentrations of LVFX (1–100 μg mL−1) under dark control, UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). Photosensitized LVFX-induced ROS generation in a concentration dependent manner. The maximum generation of ROS was observed under sunlight followed by UV-A and UV-B irradiations. Figure 3b shows the percent quenching of intracellular ROS generation under UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min) at 100 μg mL−1 LVFX by different concentrations of NAC (1, 10 and 100 μm). Results show that DCF fluorescence was decreased as the concentration of NAC increased. Maximum inhibition was achieved by NAC at 100 μm concentration.

image

Figure 3.  (a) DCF-Fluorescence intensity at different concentrations of levofloxacin (LVFX) (1–100 μg mL−1) under dark control, UV-A (2.2 mW cm−2), UV-B (0.9 mW cm−2) and sunlight (60 min) exposure on HaCaT cell line. (b) Percent quenching DCF-Fluorescence intensity by different concentrations of N-acetyl-l-cysteine (1–100 μm) under UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight exposure (60 min) at 100 μg mL−1 LVFX. Values presented are mean of three observations ± SD.

Download figure to PowerPoint

Photocytotoxicity of LVFX

Photosensitizing effect of LVFX was observed at various concentrations from 1 to 100 μg mL−1 on NIH-3T3 by recording percent cell viability through MTT assay under the exposure of UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min) (Fig. 4a). 100% cell viability was observed in dark control, i.e. remains similar (P > 0.05) in positive and negative controls as well as in all drug concentrations. In contrast, the cell viability under UV-A and UV-B at higher and lower intensities and sunlight exposure showed significant (P < 0.05 or P < 0.001) reduction as compare with negative control. Further, the reduction in cell viabilities at 25, 50 and 100 μg mL−1 under sunlight, UV-A and UV-B exposures were found to be 34.6%, 42.3% and 52.7%, 25.7%, 37.7% and 47.4%, and 22.8%, 32.6% and 42.6%, respectively. In conclusion, the decrease in cell viability was found highest under sunlight followed by UV-A and UV-B irradiations. The regression β coefficient which indicates the rate of change also revealed highest reduction in cell viability under sunlight (b = −0.458) followed by UV-A (b = −0.436) and UV-B (b = −0.408) were found 91.6-, 87.2- and 81.6-folds higher, respectively, as compared with dark control (b = −0.005). The same trend of UV-A and UV-B induced LVFX photosensitization was observed in higher intensity (Fig. 4b).

image

Figure 4.  (a) Photosensitizing effect of levofloxacin at various concentrations (1–100 μg mL−1) on mouse fibroblast cell line (NIH-3T3) as percent cell viability by recording mitochondrial dehydrogenase activity (MTT assay) under exposure of dark control, UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). (b) UV-A (5.76 J cm−2) and UV-B (2.16 J cm−2). Chlorpromazine (5 μg mL−1) and l-histidine (25 μg mL−1) were used as positive and negative photosensitizers, respectively. Three independent experimental data were summarized as mean ± SD. nsP > 0.05 or **P < 0.01 as compared with chlorpromazine control.

Download figure to PowerPoint

The photosensitizing effect of LVFX at various concentrations from 1 to 100 μg mL−1 on NIH-3T3 was recorded as percent cell viability through NRU assay under the exposure of UV-A (7.92 J cm−2), UV-B (3.24 J cm−2), sunlight (60 min) and dark control (Fig. 5a). Cytotoxicity was not observed at different drug concentrations in dark control. No significant reduction in cell viability was detected at 1 and 10 μg mL−1 drug concentrations under UV-A, UV-B and sunlight exposures. Higher drug concentrations under UV-A exposure at 25, 50 and 100 μg mL−1 showed a significant reduction in cell viability of 28.98%, 44.67% and 49.8%, respectively. Similarly, reduction in cell viability under sunlight exposure at 25, 50 and 100 μg mL−1 showed 33.6%, 44.4% and 50.79%, respectively. Reduction in cell viability under UV-B exposure at 25, 50 and 100 μg mL−1 drug concentrations showed 25.3%, 36.9% and 47.6%, respectively.

image

Figure 5.  (a) Photosensitizing effect of levofloxacin (LVFX) at various concentrations (1–100 μg mL−1) on mouse fibroblast cell line (NIH-3T3) by recording NRU in lysosomes as percent cell viability under exposure of dark control, UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). (b) UV-A (5.76 J cm−2) and UV-B (2.16 J cm−2). Chlorpromazine (5 μg mL−1) and l-histidine (25 μg mL−1) were used as positive and negative photosensitizers, respectively. Three independent experimental data were summarized as mean ± SD. ns> 0.05 or **P < 0.01 as compared with chlorpromazine control.

Download figure to PowerPoint

The photosensitizing effects of LVFX at various concentrations from 1 to 100 μg mL−1 on HaCaT was recorded as percent cell viability through MTT assay under the exposure of UV-A (7.92 J cm−2), UV-B (3.24 J cm−2), sunlight (60 min) and dark control (Fig. 6a). Cytotoxicity was not observed at different drug concentrations in dark control. No significant reduction in cell viability was detected at 1 and 10 μg mL−1 drug concentrations under UV-A, UV-B and sunlight exposures. The significant reductions in cell viability under UV-A exposure were 19.63%, 31.24% and 40.27% at 25, 50 and 100 μg mL−1 drug concentrations, respectively. Similarly reduction in cell viability under sunlight exposure showed 29.78%, 35.59% and 43.28% at 25, 50 and 100 μg mL−1 drug concentrations, respectively. Reduction in cell viability under UV-B exposure showed 13.28%, 23.9% and 32.14% at 25, 50 and 100 μg mL−1 drug concentration, respectively. In conclusion, the decrease in cell viability was found highest under sunlight followed by UV-A and UV-B irradiations. The regression β coefficient which indicates the rate of change also revealed highest reduction in cell viability under sunlight (b = −0.377) followed by UV-A (b = −0.376) and UV-B (b = −0.340) and were found to 41.88-, 41.7- and 37.76-folds higher, respectively, as compared with dark control (b = −0.009).

image

Figure 6.  (a) Photosensitizing effect of various concentrations of LVFX (1–100 μg mL−1) on HaCaT cell line as percent cell viability by recording mitochondrial dehydrogenase activity (MTT assay) under exposure of dark control, UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). (b) Photosensitizing effect of LVFX at various concentrations (1–100 μg mL−1) on HaCaT cell line by recording NRU in lysosomes as percent cell viability under exposure of dark, UV-A (7.92 J cm−2), UV-B (3.24 J cm−2) and sunlight (60 min). Chlorpromazine (5 μg mL−1) and l-histidine (25 μg mL−1) were used as positive and negative photosensitizers, respectively. Three independent experimental data were summarized as mean ± SD. ns> 0.05 or **P < 0.01 as compared with chlorpromazine control.

Download figure to PowerPoint

Photosensitizing effect of LVFX at various concentrations from 1 to 100 μg mL−1 on HaCaT was recorded as percent cell viability through NRU assay under the exposure of UV-A (7.92 J cm−2), UV-B (3.24 J cm−2), sunlight (60 min) and dark control (Fig. 6b). Cytotoxicity was not observed in dark control. Higher drug concentrations 25, 50 and 100 μg mL−1 showed significant viability reduction under UV-A exposure and were 15.15%, 30.7% and 39.97%, respectively. Similarly reduction in cell viability at 25, 50 and 100 μg mL−1 drug concentrations was recorded under sunlight exposure showing 22.21%, 32.3% and 39.78%, respectively. Reduction in cell viability under UV-B exposure showed 14.2%, 24.38% and 31.56% at 25, 50 and 100 μg mL−1 concentrations, respectively. The regression β coefficient which indicates the rate of change also revealed highest reduction in cell viabilities under sunlight (b = −0.377), UV-A (b = −0.376) and UV-B (b = −0.340) and were found 41.88-, 41.7- and 37.76-folds higher, respectively, as compared with dark control (b = −0.009). Results of NRU assay accord with MTT assay.

Cell cycle arrest

Cell cycle study was examined at different concentrations of LVFX under UV-A irradiation on HaCaT cell line (Fig. 7). Cells were treated with different concentrations of LVFX in the dark (Fig. 7a). Increase in cell cycle arrest was observed at G2 phase as compared with control. UV-A exposed cells with different LVFX concentrations (10, 25 and 100 μg mL−1), showed increase in number of cells at the G2 phase significantly higher than dark control. Higher concentration of LVFX (100 μg mL−1) showed (Fig. 7b) the striking decrease in the number of cells in G2 phase and increase in number of cells in sub-G1 population. The higher concentration of LVFX suggests the initiation of apoptosis.

image

Figure 7.  Levofloxacin (LVFX) enhances UV-A mediated cell cycle arrest in G2/M phase. HaCaT cells were treated with LVFX (10, 25 and 100 μg mL−1) and irradiated with UV-A (2.16 J cm−2) and incubated for 18 h: (a) sample dark control in presence of LVFX and (b) sample UV-A irradiated in presence of LVFX.

Download figure to PowerPoint

Gene expression of p21, Bcl-2 and Bax mRNAs

The expressions of p21, antiapoptotic gene Bcl-2 versus proapoptotic gene Bax were analyzed by quantitative RT-PCR (Fig. 8). Significant upregulation of p21 gene was observed in combined treatment of UV-A with LVFX as compared with LVFX alone (Fig. 8a). Further, the gene expression of Bcl-2 (Fig. 8c) and Bax (Fig. 8b) were analyzed under UV-A or LVFX alone and UV-A with LVFX. Results showed significant downregulation of Bcl-2 under UV-A with LVFX than LVFX or UV-A alone. No significant change was observed in the expression of Bax (Fig. 8b).

image

Figure 8.  Effect of levofloxacin (LVFX) and UV-A (2.16 J cm−2) on expression of (a) p21, (b) Bcl-2 and (c) Bax. HaCaT cells were treated with different concentration of LVFX (10, 25 and 100 μg mL−1) with and without UV-A irradiation and incubated for 18 h. Using quantitative RT-PCR, we examined the effect of LVFX and UV-A on p21, Bcl-2 and Bax mRNA expression. Values represented an average (±SEM) ns> 0.05 or **P < 0.01.

Download figure to PowerPoint

Apoptosis and necrosis

UV-A and LVFX induced apoptosis or necrosis were performed by EB/AO morphologic assays in HaCaT cell line (Fig. S5). This assay is based on nuclear morphology detection which is characteristically specific for apoptosis and necrosis. The staining characteristics are: live cells have normal nuclei staining, which present green chromatin with organized structures; apoptotic cells contain condensed or fragmented chromatin (green or orange); and necrotic cells have similar normal nuclei staining as live cells except chromatin is orange instead of green. In dark control condition (1) HBSS and (2) 100 μg mL−1 LVFX, cell showed normal morphology. Further UV-A (2.16 J cm−2) treatment in the presence of (3) HBSS showed no morphological change but in (4) 25 μg mL−1 LVFX in the presence of UV-A showed predominant cells in apoptosis and higher drug concentrations (5) 100 μg mL−1 showed both apoptotic and necrotic cells.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

The cutaneous phototoxicity is a common health problem caused by the interaction of sunlight and drugs are absorbed either locally into the skin or via the systemic circulation and become the substrate for photochemical reactions in the skin (33). Previous studies have shown that low to moderately pigmented human skin may be vulnerable to phototoxic effects (34,35). Fluoroquinolones are considered relatively tolerant in comparison to other routinely used antibiotics (36). Fluoroquinolones are associated with different adverse effects including phototoxicity and photogenotoxicity (37). The aim of the present study was to gain more insight into the process of photodegradation: identification of photoproducts, involvement of UV-R induced oxidative stress, cell-cycle arrest as well as apoptotic cell death. We have demonstrated the first report of LVFX phototoxicity and its mechanism under ambient environmental intensities of UV-A, UV-B encountered in sunlight at Lucknow. Photosensitization may appear the main cause of phototoxicity of quinolones, particularly in older patients with long-term use (38). Quinolone and UV-A irradiation for 4 h induced auricular skin inflammation in BALB/c-mice (39). Double-blind placebo and skin phototesting are investigated by systemically administered fluoroquinolones in human beings, but these studies did not offer any mechanistic approach (40). Due to the complexity of biological system, it is difficult to demonstrate clearly the specific role of ROS in the manifestation of phototoxicity in in vivo studies. Drug induced phototoxicity is associated with the formation of toxic photoproducts or the generation of short-lived intermediates, increased levels of ROS within the skin and may induced skin diseases (41), earlier study of a photosensitive drug under sunlight revealed direct photolysis as well as self-sensitized photolysis via˙OH and 1O2 (42). Our results demonstrate that LVFX generates 1O2 under UV-R/sunlight exposure which is responsible for photodegradation and photoproducts formation. Photodegradation of LVFX shows generation of three major photoproducts (P1, P2 and P3) which were identified by LC-MS/MS as illustrated in Scheme 1. LVFX generates 1O2, O2˙ and ˙OH through photosensitized mechanism, in which the photoexcited LVFX (triplet state) transfers its energy to O2 and generates energy-rich 1O2 (Type II photodynamic reaction), an active oxidizing agent. Another oxygen-dependent reaction involves the photoreaction of an electronically active photosensitizer, reduced the electron or by hydrogen transfer from a compound to O2 and produced O2˙ and ˙OH (Type I photodynamic reaction). Sodium azide and DABCO were able to quench the generation of 1O2 whereas mannitol was able to quench ˙OH. Quenching study with specific quenchers of 1O2 and ˙OH showed that 1O2 and ˙OH are predominant in LVFX phototoxicity. Quenching with SOD confirms the generation of O2˙ by LVFX. These reactive forms of O2 may be responsible for linoleic acid peroxidation (43). Our study at ambient levels of UV-R generates ROS through photodynamic action. Sunlight (60 min) exposure was producing higher effects than UV-R irradiation. Sunlight is a natural source of different wavelengths containing UV-A, UV-B and many other radiations; therefore, the effect of sunlight may be cumulative and higher. Further, the DCF fluorescence in the cells was increased in a concentration-dependent manner which indicates the generation of ROS by photosensitive LVFX. The UV-R/sunlight increased dose dependent ROS generation in LVFX treated cells. The quenching with a specific quencher NAC reduced the fluorescence intensity of DCF, which proved the involvement of ROS in LVFX phototoxicity. Earlier studies have shown that the ROS generation is an important factor in phototoxicity (26,27). It is clear that 1O2 is an important ROS in DNA damage under in vitro conditions (44). Few fluoroquinolones induced DNA damage and lead to photogenotoxicity under UV-A irradiation (45). Quinolone antibacterial agents show in vitro photochemical clastogenicity following light irradiation (46). Commonly used antibiotics such as cephaloridine, cephalexin and cephradine are generating significant amounts of 1O2 under UV-R (26). Antibiotics like lomefloxacin and enoxacin generate 1O2 and O2˙ under UV-R/sunlight exposure, caused lipid peroxidation in human blood and photodegraded 2-dGuO in vitro (27). However, Levofloxacin is able to photosensitize red blood cell lysis in an oxygen independent way and decrease cell viability under UV-A irradiation (47). Photoirradiated neuroleptic drugs released lactate dehydrogenase and caused the loss of mitochondrial NADH dehydrogenase, indicating that plasma membrane and mitochondria are the targets of phototoxicity (25).

Photocytotoxicity assays of LVFX under different intensities of UV-A, UV-B and sunlight have been carried out through OECD recommended NIH-3T3 cell line. The 3T3 NRU test was validated in 1998 for phototoxicity assessment of chemicals including fluoroquinolones (48). LVFX significantly reduced the cell viability of NIH-3T3 cell line. The selection of different intensities of UV-R irradiation prove our viewpoint that higher intensities of UV-R irradiation in the sunlight (in view of ozone depletion) would be more deleterious. The results of photocytotoxicity were moreover confirmed in human keratinocyte (HaCaT) cell line under UV-A, UV-B and sunlight exposure. High reduction of cell viability under sunlight exposure had demonstrated that the damaging potential of sunlight was higher. Therefore, the measurement of ambient intensity and a total dose is an important factor for phototoxicity. The phototoxicity of drugs on cell lines and lipid peroxidation of linoleic acid suggest that ROS might initiate cellular lipid peroxidation, which finally leads to cell death. To examine the validity of this hypothesis, linoleic acid photoperoxidation was used as a model system (49). Percent quenching of linoleic acid peroxidation by SOD accorded the involvement of ROS in LVFX phototoxicity (28). The production of ROS and photodamage in cell lines (in vitro) appear to be the possible mechanism of LVFX phototoxicity. The ability of LVFX to induced photodynamic lipid peroxidation and cell damage may be expected in vivo. Photosensitize quinolones induced in vitro phototoxicity by the production of active oxygen species and lipid peroxidation (50).

Genotoxic stress induced by UV-R arrest HaCaT cell line in different phases of cell cycle, depending on their p53 status (51). LVFX with UV-A irradiation caused appreciable G2 phase arrest and apoptosis in HaCaT cell line. Normal keratinocytes exhibit a p53-dependent delay in G1 phase, whereas HaCaT cells are arrested in G2/M phase because their p53 gene is mutated (52). The p21 gene is able to regulate DNA damage-induced G2 arrest by preventing the activation of cyclin B1-cdc2 complexes or by blocking inhibitory phosphorylations of pocket proteins by CDKs (53). The upregulation of p21 by photosensitive LVFX plays a pivotal role in G2/M cell arrest and in the induction of apoptotic pathway. Homo- and/or heterodimerization of anti- and proapoptotic genes of Bcl-2 family decide apoptotic or survival pathway (54). The treatment of nonsteroidal anti-inflammatory drugs in some colorectal cancer cell lines showed no change in Bax gene expression but substantial increases in the ratio of Bax/Bcl-2, due to the downregulation of Bcl-2 gene expression (55). The downregulation of Bcl-2 gene constitutes a mechanism of potential importance in UV-R induced apoptosis in human epidermis (56).

Photosensitive LVFX exhibits no change in Bax gene expression in HaCaT cell line but increases the ratio of Bax/Bcl-2, due to the downregulation of Bcl-2 gene expression. Expression of Bcl-2 reduced after UV irradiation in rat and mouse skin (23), but, in contrast, the expression of Bax is not changed (57). The death-suppressing activity of Bcl-2 is regulated by Bax, which promotes cell death. The ratio of these two proteins is considered to be important when a cell undergoes apoptosis (23). The upregulation of p21 and substantial increase in the ratio of Bax/Bcl-2 revealed LVFX and UV-A induced cell cycle arrest and induction of apoptosis. Further the results of apoptosis were confirmed by EB/AO morphologic assay which supports the photosensitized LVFX induced apoptosis. Results provide strong evidence that excess exposure of LVFX under sunlight may contribute to LVFX mediated skin phototoxicity/photomutagenesis in vivo. As LVFX degrades in sunlight/UV-R exposure to its photoproducts, it is essential to investigate the phototoxic response of its photoproducts to understand the total health hazards posed by the joint exposure of LVFX and sunlight. In conclusion, the photosensitized LVFX exhibits the photodegradation, generation of 1O2, O2˙ and ˙OH at ambient UV-R/sunlight exposure with potential to initiate phototoxic responses like lipid peroxidation. Our biological studies have shown that photosensitized LVFX possesses significant photocytotoxic activity; suppresses cell growth by arresting the cell cycle at G2 phase and is a potent inducer of programmed cell death in human keratinocyte skin cell line through free radical generation. In addition, the present study has also made us aware that phototoxic reactions of LVFX could be clinically minimized through avoiding UV-R exposure by drug users, especially at peak hours.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Acknowledgements— The authors are thankful to the Director, IITR, for his keen interest in the study. This study was financially supported by the Council of Scientific & Industrial Research, New Delhi, under the Network Project (NWP-0034).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information
  • 1
    Solomon, K. R. (2008) Effects of ozone depletion and UV-B radiation on humans and the environment. Atmos. Ocean 46, 185202.
  • 2
    De Fabo, E. C. (2005) Arctic stratospheric ozone depletion and increased UVB radiation: Potential impacts to human health. Int. J. Circumpolar Health 64, 509522.
  • 3
    Bachelet, D., P. W. Barnes, D. Brown and M. Brown (1991) Latitudinal and seasonal variation in calculated ultraviolet-B irradiance for rice growing regions of Asia. Photochem. Photobiol. 54, 411422.
  • 4
    Davidson, A. T. and H. J. Marchant (1994) Comparative impact of in situ UV exposure on productivity, growth and survival of Antarctic phaeocystis and diatoms. Proc. NIPR Symp. Polar Biol. 7, 5369.
  • 5
    World Health Organization (1994) Environmental health criteria, ultraviolet radiations, report number, 160.
  • 6
    Melhus, A. (2005) Fluoroquinolones and tendon disorders. Expert. Opin. Drug Safety 4, 299309.
  • 7
    Liu, H. and S. G. Mulholland (2005) Appropriate antibiotic treatment of genitourinary infections in hospitalized patients. Am. J. Med. 118(Suppl 7A), 14S20S.
  • 8
    Fish, D. N. and A. T. Chow (1997) The clinical pharmacokinetics of levofloxacin. Clin. Pharmacokinet. 32(2), 101119.
  • 9
    Nakashima, M., T. Uematsu, M. Kanamaru, O. Okazaki and H. Hakusui (1992) Phase I study of levofloxacin, (S)-(-)-ofloxacin. Jpn. J. Clin. Pharmacol. Ther. 23, 515520.
  • 10
    Wagai, N. and K. Tawara (1992) Possible direct role of reactive oxygens in the cause of cutaneous phototoxicity induced by five quinolones in mice. Arch. Toxicol. 66, 392397.
  • 11
    Martinez, L. J., R. H. Sik and C. F. Chignell (1998) Fluoroquinolone antimicrobials: Singlet oxygen, superoxide and phototoxicity. Photochem. Photobiol. 67, 399403.
  • 12
    Ferguson, J. and R. Dawe (1997) Phototoxicity in quinolones: Comparison of ciprofloxacin and grepafloxacin. J. Antimicrob. Chemother. 40(Suppl A), 9398.
  • 13
    Sun, Y. W., E. P. Heo, Y. H. Cho, K. M. Bark, T. J. Yoon and T. H. Kim (2001) Pefloxacin and ciprofloxacin increase UV-A-induced edema and immune suppression. Photodermatol. Photoimmunol. Photomed. 17, 172177.
  • 14
    Fujita, H. and I. Matsuo (1994) In vitro phototoxic activities of new quinolone antibacterial agents: Lipid peroxidative potentials. Photodermatol. Photoimmunol. Photomed. 10, 202205.
  • 15
    Nishigori, A., Y. Hattori and S. Toyokuni (2004) Role of ROS in skin carcinogenesis. Anitoxid. Redox Signal. 6, 561570.
  • 16
    Ferguson, J. (2002) Photosensitivity due to drugs. Photodermatol. Photoimmunol. Photomed. 18, 262269.
  • 17
    Nilsson, R., T. Maurer and N. A. Redmont (1993) Standard protocol for phototoxicity testing. Results from an inter-laboratory study. Contact Dermatitis 28, 285290.
  • 18
    Martinez, L. J., G. Li and C. F. Chignell (1997) Photogeneration of fluoride by fluoroquinolone antimicrobial agents lomefloxacin and fleroxacin. Photochem. Photobiol. 65(3), 599602.
  • 19
    Wyllie, A. H. (1993) Apoptosis (the Frank Rose memorial lecture). Br. J. Cancer 67, 205208.
  • 20
    Young, A. R. (1987) The sunburn cell. Photodermatology 4, 127134.
  • 21
    Gniadecki, R., M. Hansen and H. C. Wulf (1997) Two pathways for induction of apoptosis by ultraviolet radiation in cultured human keratinocytes. J. Invest. Dermatol. 109, 163169.
  • 22
    Pourzand, C., G. Rossier, O. Reelfs, C. Borner and R. M. Tyrrell (1997) Overxpression of Bcl-2 inhibits UVA-mediated immediate apoptosis in rat 6 fibroblasts: Evidence for the involvement of Bcl-2 as an antioxidant. Cancer Res. 57, 14051411.
  • 23
    Oltvai, Z. N., C. L. Milliman and S. J. Korsmeyer (1993) Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609619.
  • 24
    Maisch, T., C. Bosl, R. M. Szeimies, N. Lehn and C. Abels (2005) Photodynamic effects of noval XF porphyrin derivatives on prokaryotic and eukaryotic cells. Antimicrob. Agents Chemother. 49, 15421552.
  • 25
    Bastianon, C., R. Zanoni, G. Miolo, S. Caffieri and E. Reddi (2005) Mitochondria and plasma membrane as targets of UV-A induced toxicity of neuroleptic drugs fluphenazine, perphenazine and thioridazine. Int. J. Biochem. Cell Biol. 37, 901908.
  • 26
    Ray, R. S., R. B. Misra, M. Farooq and R. K. Hans (2002) Effect of UV-B radiation on some common antibiotics. Toxicol. In Vitro 16, 123127.
  • 27
    Ray, R. S., N. Agrawal, R. B. Misra, M. Farooq and R. K. Hans (2006) Radiation-induced in vitro phototoxic potential of some fluoroquinolones. Drug Chem. Toxicol. 29, 2538.
  • 28
    Agrawal, N., R. S. Ray, M. Farooq, A. B. Pant and R. K. Hans (2007) Photosensitizing potential of ciprofloxacin at ambient level of UV radiation. Photochem. Photobiol. 83, 12261236.
  • 29
    Valencia, A. and I. E. Kochevar (2006) UV-A induces apoptosis via reactive oxygen species in a model for Smith Lemli Opitz syndrome. Free Radic. Biol. Med. 40, 641650.
  • 30
    Shah, P. P., K. Saurabh, M. C. Pant, N. Mathur and D. Parmar (2009) Evidence for increased cytochrome P450 1A1 expression in blood lymphocytes of lung cancer patients. Mutant Res. 670, 7478.
  • 31
    Livak, K. J. and T. D. Schmittgen (2001) Analysis of relative gene expression data using real time quantitative PCR and the (2ΔΔCT) method. Methods 25, 402408.
  • 32
    Ribble, D., N. B. Goldstein, D. A. Norris and Y. G. Shellman (2005) A simple technique for quantifying apoptosis in 96-well plates. BMC Biotechnol. 10, 512.
  • 33
    Lhiaubet, V., N. Paillous and N. Chouini-Lalanne (2001) Comparison of DNA damage photoinduced by ketoprofen, fenofibric acid and benzophenone via electron and energy transfer. Photochem. Photobiol. 74, 670678.
  • 34
    Huselton, C. A. and H. Z. Hill (1990) Melanin photosensitizes ultraviolet light (UV-C) DNA damage in pigmented cells. Environ. Mol. Mutagen. 16, 3743.
  • 35
    Bamane, V. S., P. N. Trivedi, S. S. Ranade and V. J. Daoo (1992) Solar UV irradiance and some biological consequences: Bombay, India. Sci. Total Environ. 121, 195201.
  • 36
    Lietman, P. S. (1995) Fluoroquinolone toxicities. An update. Drugs 49, 794850.
  • 37
    Marrot, L. and C. Agapakis-Causse (2000) Differences in the photogenotoxic potential of two fluoroquinolones as shown in diploid yeast strain (Saccharomyces cerevisae) and supercoiled DNA. Mutat. Res. 468, 19.
  • 38
    Oliveira, H. S., M. Goncalo and A. C. Figueiredo (2000) Photo-sensitivity to lomefloxacin. A clinical and photobiological study. Photodermatol. Photoimmunol. Photomed. 16, 116120.
  • 39
    Shimoda, K. (1998) Mechanisms of quinolone phototoxicity. Toxicol. Lett. 28, 369373.
  • 40
    Traynor, N. J., M. D. Barratt, W. W. Lovell, J. Ferguson and N. K. Gibbs (2000) Comparison of an in vitro cellular phototoxicity model against controlled clinical trails of fluoroquinolones skin phototoxicity. Toxicol. In Vitro 14(3), 275283.
  • 41
    Bagheri, H., V. Lhiaubet, J. L. Montastruc and N. Chouini-Lalanne (2000) Photosensitivity to ketoprofen: Mechanisms and pharmacoepidemiological data. Drug Safety 22, 339349.
  • 42
    Ge, L. K., J. W. Chen, S. Y. Zhang, X. Y. Cai, Z. Wang and C. L. Wang (2010) Photodegradation of fluoroquinolone antibiotic gatifloxacin in aqueous solutions. Environ. Chem. 55(15), 14951500.
  • 43
    Castell, J. V., M. J. Gomez-Lechon, C. Grassa, L. A. Martinez, M. A. Miranda and P. Tarrega (1994) Photodynamic lipid peroxidation by the photosensitizing nonsteroidal anti-inflammatory drugs suprofen and tiaprofenic acid. Photochem. Photobiol. 59, 3539.
  • 44
    Ravanat, J. L., S. Sauvaigo, S. Caillat, G. R. Martinez, M. H. Medeiros, P. D. Mascio, A. Favier and J. Cadet (2004) Singlet oxygen-mediated damage to cellular DNA determined by the comet assay associated with DNA repair enzymes. Biol. Chem. 385, 1720.
  • 45
    Zhang, T., J. L. Li, J. Xin, X. C. Ma and Z. H. Tu (2004) Compare two methods of measuring DNA damage induced by photogenotoxicity of fluoroquinolones. Acta Pharmacol. Sin. 25, 171175.
  • 46
    Itoh, S., S. Nakayama and H. Shimada (2002) In vitro photochemical clastogenicity of quinolone antibacterial agents studied by a chromosomal aberration test with light irradiation. Mutat. Res. 517, 113121.
  • 47
    Viola, G., L. Facciolo, M. Canton, D. Vedaldi, F. Dall’Acqua, G. G. Aloisi, M. Amelia, A. Barbafina, F. Elisei and L. Latterini (2004) Photophysical and phototoxic properties of the antibacterial fluoroquinolones levofloxacin and moxifloxacin. Chem. Biodivers. 1, 782801.
  • 48
    Spielmann, H., M. Balls, J. Dupuis, W. J. Papa, G. Pechovitch, O. deSilva, H. G. Holzhutter, R. Clothier, P. Desolle, F. Gerberick, M. Liebsch, W. W. Lovell, T. Maurer, U. Pfannenbecker, J. M. Ptthast, M. Csato, D. Slodowski, W. Steiling and P. Brantom (1998) The International EU/COLIPA in vitro phototoxicity validation study: Results of phase II (blind trial). Part I: The 3T3 NRU phototoxicity test. Toxicol. In Vitro 12, 305327.
  • 49
    Recknagel, R. O. and E. A. Clende (1984) Spectrophotometric detection of lipid conjugated dienes. In Oxygen Radicals in Biological Systems, Methods in Enzymology, Vol. 105 (Edited by L. Pakcer), pp. 331337. Academic Press, New York.
  • 50
    Kawada, A., K. Hatanaka, H. Gomi and I. Matsuo (1999) In vitro phototoxicity of new quinolones: Production of active oxygen species and photosensitized lipid peroxidation. Photodermatol. Photoimmunol. Photomed. 15, 226230.
  • 51
    Zhan, Q., M. J. Antinore, X. W. Wang, F. Carrier, M. L. Smith, C. C. Harris and A. J. Fornace Jr. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene 18, 28922900.
  • 52
    Shicheng, L., M. Hideo and Y. Hitoshi (2007) Molecular response to phototoxic stress of UVB-irradiated ketoprofen through arresting cell cycle in G2/M phase and inducing apoptosis. Biochem. Biophys. Res. Commun. 3, 650655.
  • 53
    Charrier-Savournin, F. B., M. T. Chateau, V. Gire, J. Sedivy, J. Piette and V. Dulic (2004) p21-Mediated nuclear retention of cyclin B1-Cdk1 in response to genotoxic stress. Mol. Biol. Cell 15, 39653976.
  • 54
    Cory, S. and J. M. Adams (2002) The bcl-2 family: Regulators of the cellular life-or-death switch. Nature Rev. Cancer 2, 647656.
  • 55
    Zhang, L., J. Yu, B. H. Park, K. W. Kinzler and B. Vogelstein (2000) Role of BAX in the apoptotic response to anticancer agents. Science 290, 989992.
  • 56
    Isoherranen, K., I. Sauroja, J. Christer and K. Punnonen (1999) UV irradiation induces downregulation of bcl-2 expression in vitro and in vivo. Arch. Dermatol. Res. 291, 212216.
  • 57
    Gillardon, F., C. Eschenfelder, E. Uhlmann, W. Hartschuh and M. Zimmermann (1994) Differential regulation of c-fos, fosB, c-jun, bcl-2 and bax expression in rat skin following single or chronic ultraviolet irradiation and in vivo modulation by antisense oligodeoxynucleotide superfusion. Oncogene 9, 32193225.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Figure S1. Photodegradation spectra of LVFX (25& μg mL−1) under sunlight (60–240& min).

Figure S2. Percent photochemical quenching of 1O2 at 50& μg mL−1 LVFX by DABCO and NaN3 under UV-A (7.92& J cm−2), UV-B (3.24& J cm−2) and sunlight exposure (60& min). Values are mean of three observations ±SD.

Figure S3. Percent quenching of O2•− at 50& μg mL−1 LVFX by superoxide dismutase (SOD), under UV-A (2.64& J cm−2), UV-B (1.08& J cm−2 and sunlight (20& min). Values presented are mean of three observations ±SD.

Figure S4. Percent photochemical quenching of OH at 50& μg mL−1 LVFX by mannitol under UV-A (7.92& J cm−2), UV-B (3.24& J cm−2) and sunlight exposure (60& min). Values are mean of three observations ±SD.

Figure S5. The EB/AO staining method was used to assess the cell status after the treatment with LVFX alone or in combination with UV-A (2.16& J cm−2) and incubated for 18& hrs (a) Dark control presence of HBSS alone (b) Dark control presence of LVFX (100& μg/mL), (c) Sample UV-A irradiated in presence of HBSS (d) Sample UV-A irradiated in presence of LVFX (25& μg mL−1) and (e) Sample UV-A irradiated in presence of LVFX (100& μg mL−1).

FilenameFormatSizeDescription
PHP_1068_sm_FigS1.tif2087KSupporting info item
PHP_1068_sm_FigS2.tif1081KSupporting info item
PHP_1068_sm_FigS3.tif1081KSupporting info item
PHP_1068_sm_FigS4.tif1081KSupporting info item
PHP_1068_sm_FigS5.tif2087KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.