SEARCH

SEARCH BY CITATION

Keywords:

  • Stro-1-enriched;
  • mesenchymal stem cells;
  • immunosuppression;
  • mixed lymphocyte reaction

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References

Mesenchymal stem cells (MSCs) have an immunosuppressive effect and can inhibit the proliferation of alloreactive T cells in vitro and in vivo. Cotransplantation of MSCs and hematopoietic stem cells (HSCs) from HLA-identical siblings has been shown to reduce the incidence of acute graft-vs.-host disease. MSCs are heterogeneous and data on the inhibitory effects of different MSC subsets are lacking. The antigen Stro1 is a marker for a pure primitive MSC subset. We investigated whether Stro-1-enriched induce a more significant suppressive effect on lymphocytes in a mixed lymphocyte reaction (MLR), and whether this action is related to a specific gene expression profile in Stro-1-enriched compared to other MSCs. We demonstrated that the Stro-1-enriched population elicits a significantly more profound dose-dependent inhibition of lymphocyte proliferation in a MLR than MSCs. One thousand expanded Stro-1-enriched induced an inhibitory effect comparable to that of 10 times as many MSCs. Inhibition by Stro-1-enriched was more significant in contact-dependent cultures than in noncontact-dependant cultures at higher ratio. The Stro-1-enriched inhibitory effect in both culture types was linked to increased gene expression for soluble inhibitory factors such as interleukin-8 (IL-8), leukemia inhibitory factor (LIF), indoleamine oxidase (IDO), human leukocyte antigen-G (HLA-G), and vascular cell adhesion molecule (VCAM1). However, tumor growth factor-β1 (TGF-β) and IL-10 were only up-regulated in contact-dependant cultures. These results may support using a purified Stro-1-enriched population to augment the suppressive effect in allogeneic transplantation.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References

Bone marrow (BM) stromal cells; referred as mesenchymal stem cells (MSCs) have been shown to possess immunomodulatory properties. They are able to suppress allogeneic responses in a mixed lymphocyte reaction (MLR; Di Nicola et al., 2002; Bartholomew et al., 2002; Potian et al., 2003; Tse et al., 2003; Le Blanc et al., 2003, 2004a; Djouad et al., 2003; Maitra et al., 2004; Aggarwal & Pittenger, 2005) and modify antigen-presenting cell (APC) maturation in vitro (Zhang et al., 2004; Beyth et al., 2005; Jiang et al., 2005; Maccario et al., 2005). Their immune-inhibitory effects have been demonstrated in vitro and in vivo in primate (Bartholomew et al., 2002), murine (Djouad et al., 2003), and in human, where MSCs has been used to treat severe graft-vs.-host disease (GVHD; Le Blanc et al., 2004b).

Current methodologies for isolating MSCs are based on those first described by Friedenstein and colleagues, which depend on the rapid adhesion of stromal progenitor populations to plastic and their subsequent rapid proliferation in vitro (Friedenstein, Chailakhjan & Lalykina, 1970; Castro-Malaspina et al., 1980). However, MSCs obtained in this manner produce a heterogeneous starting population of adherent BM cells, only a minor proportion of which represent multipotent marrow stem cells. Several protocols have been used to select a purer population of MSCs in vitro and in vivo (Jones et al., 2006). Bol, Tucker, and Ekert isolated human BM stromal cell subpopulations with different effects on the maintenance and differentiation of myeloid progenitor cells (Bol, Tucker & Ekert, 1990). There are also specific selection protocols for isolating purified populations of MSCs with extensive proliferation potential. Clonal analysis has been used to demonstrate that individual MSC colonies differ in their capacity to form new bone in vivo (Gronthos et al., 2003). Negative depletion allows a homogeneous population of MSCs, with more than 90% SH2+ and SH3+ cells, to be obtained rapidly and in large quantities (Tondreau et al., 2004).

Expression of Stro1 and CD49a was limited to a subset of MSCs (Stewart et al., 2003). And, selection with anti-CD49a gave the greatest enrichment (19-fold) of colony-forming units (CFUs; Letchford et al., 2006).

Stro1 antigen is a marker for a pure primitive subset of MSCs. The cells in this subset differentiate into several lineages (Simmons & Torok-Storb, 1991; Dennis et al., 2002). Stro-1-enriched MSCs may be used as a universal and reproducible stromal feeder layer to expand and maintain human BM hematopoietic stem cells (HSCs) ex vivo. Bensidhoum et al. (2004) showed that the homing capabilities of expanded MSCs and their hematopoietic support function depend on the Stro1+ phenotype.

Based on all these findings, we hypothesized that MSCs may have different inhibitory effects on lymphocytes depending on Stro1+ phenotype expression.

Previously, we reported that MSCs inhibit allogeneic lymphocytes and that this inhibition is mediated by simultaneous gene expression for several factors, such as human leukocyte antigen-G (HLA-G), interleukin-10 (IL-10), leukemia inhibitory factor (LIF), indoleamine oxidase (IDO), and transforming growth factor-β (TGF-β; Nasef et al., 2007).

Here, we report on the pattern of Stro1+ gene activation in a MLR during inhibition of peripheral blood mononuclear cells (PBMCs) proliferation, when compared to MSCs. Our data demonstrate that the suppressive effect of MSCs is primarily because of the Stro1+ subset.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References

Isolation and culture of bone marrow stromal cells (referred as MSCs) from adult human bone marrow

Following informed consent, BM samples (10–20 ml) were obtained from the femur of patients with normal hematopoietic function (median age: 55 years old) who were undergoing total hip replacement surgery. The samples were diluted 1 : 5 in Iscove medium (Biochrom, Berlin, Germany) and centrifuged at 200 g for 10 min to eliminate fat. Mononuclear cells (MNCs) were separated by centrifugation at 400 g for 20 min on a Ficoll gradient (density 1.077 g/ml; Biochrom) and washed with 1X phosphate-buffered saline (PBS). The cells were plated at a density of 2 × 107 MNCs/75 cm2 tissue culture flask (Falcon, BD Biosciences, Pont de claix, France) in Dexter medium, consisting of McCoy’s 5A medium supplemented with 12.5% heat-inactivated fetal calf serum (FCS), 12.5% heat-inactivated horse serum, 1% sodium bicarbonate, 1% sodium pyruvate, 0.4% MEM nonessential amino acids, 0.8% MEM essential amino acids, 1% MEM vitamin solution, 1%l-glutamine (200 mmol), and 1% penicillin-streptomycin solution, all from Invitrogen (Groningen, the Netherlands) and incubated at 37 °C and 5% CO2 in a humidified atmosphere as previously described (Simmons & Torok-Storb, 1991). After 72 h, nonadherent cells were removed, and the culture medium was completely replaced once a week. When 50% confluence was obtained, the cells were detached using 0.25% trypsin and 1 mmol EDTA IX (Invitrogen). Cells were also cultured, as described previously (Francois et al., 2006) in the specific media required for osteogenic, chondrogenic, and adipogenic differentiation. MSCs were routinely frozen in a medium containing 20% dimethyl sulfoxide (DMSO) and 80% FCS.

Immunomagnetic selection Stro-1-enriched and BM stromal cells

Mesenchymal stem cells at 50% confluence in passage-1 (P1) were detached using trypsin EDTA IX (Invitrogen) and Stro-1-enriched were isolated using magnetic immunobeads (Dynabead M450, Dynal Asa, Oslo, Norway) linked to the Stro1 antibody as previously described (Brouard et al., 2000; Dennis et al., 2002; Bensidhoum et al., 2004). Anti-Stro1-coated beads were briefly mixed with the MSC suspension and positive cells were recovered with a magnetic particle concentrator (MPC-1), then washed three times and replated in Dexter medium at a concentration of 2 × 107 MNCs/75 cm2 tissue culture flask (Falcon) and amplified for 10–15 days, until confluence. Stro1+ refers to those cells, taken from precursor cultures that adhered to the coated beads.

Phenotype of Stro-1-enriched and BM stromal cells (referred as MSCs)

Stro-1-enriched and BM stromal cells (MSCs) were harvested by treatment with trypsin-EDTA at P2. The detached cells were washed and resuspended in 1X PBS supplemented with 0.5% bovine serum albumin (BSA; Sigma Chemicals, St Louis, MO, USA) in aliquots of 2 × 105 cells. They were then stained with phycoerythrin-conjugated antibodies against CD105 (SH2), CD73 (SH3), Thy-1 (CD90), CD166, CD29, CD49a, CD49c, CD49e, CD44, HLA-DR, CD14, CD34, and CD45 (Becton-Dickinson, Pont de claix, France), respectively, for 30 min at 4 °C followed by two washes with PBS containing 0.5% BSA. At least 10 000 events per test were acquired using a 488-nm laser flow cytometer (FACScalibur, BD Biosciences, Pont de claix, France), and these data were then analyzed with cell questpro software (Becton-Dickinson).

Preparation of peripheral blood mononuclear cells

Human PBMCs from two allogeneic healthy volunteer’s donors were prepared by gradient centrifugation in a Ficoll solution (density 1.077 g/ml; Biochrom) at 400 g for 20 min at room temperature. Cell count and viability were assessed using trypan blue dye exclusion. PBMCs were incubated at 37 °C and 5% CO2 for 24 h in Iscove medium, supplemented with 10% FCS, 1%l-glutamine, and 2% antibiotic.

Responding cells

After 24 h of culture, PBMCs were washed by centrifugation and resuspended in modified RPMI-1640 medium (Invitrogen), supplemented with 10% FCS, 1%l-glutamine, and 2% antibiotic. The cells were then used directly for a MLR after assessment of viability using trypan blue dye and adjustment of concentration.

Stimulating cells

After 24 h of culture, allogeneic PBMCs were washed by centrifugation and cultured in Iscove medium supplemented with 1% FCS, 1%l-glutamine, and 2% antibiotic, at a concentration of 4 × 106 cells/ml. Further, they were treated with mitomycin (25 μg/ml; Sigma, Isle d’Abeau, France), incubated for 30 min at 37 °C, washed three times by centrifugation at 400 g for 10 min and resuspended in 2 ml of RPMI medium supplemented with 10% FCS, 1%l-glutamine, and 2% antibiotic. Cells were used directly in a MLR after adjustment of concentration.

Mixed lymphocyte reaction

Cultures with cell contact

Human PBMCs and mitomycin-treated allogeneic PBMCs were co-cultured at a ratio of 1 : 1 separately or in the presence of either Stro-1-enriched or MSCs, in 200 μl of modified RPMI-1640 medium (Invitrogen), supplemented with 10% FCS, 1%l-glutamine, and 2% antibiotic. Human Stro-1-enriched or MSCs were plated in triplicate onto round-bottom 96-well plates (BD Biosciences) in decreasing numbers (3 × 104, 1 × 104, 3 × 103, and 1 × 103 cells/well) and allowed to adhere to the plate for 1–2 h. The ratios of expanded Stro-1-enriched or MSCs to PBMCs were 0.3, 0.1, 0.03, and 0.01 respectively. The positive control was PBMCs + PBMCs treated with mitomycin, and the negative controls were PBMCs alone, mitomycin-treated PBMCs alone, Stro-1-enriched alone, and MSCs alone. In assays of mitogen-induced proliferation, 1 × 105 PBMCs were cultured with phytohemagglutinin (PHA; 2 μg/ml) plus IL-2 (500 U/ml), with or without the presence of Stro-1-enriched and MSCs.

Cultures without cell contact

The same procedure was followed in transwell chambers (0.2 μm; Nunc, Roskilde, Denmark). Stro-1-enriched and MSCs were seeded in the lower chamber and allowed to adhere 1–2 h. Equal numbers of PBMCs and mitomycin-treated PBMCs were then cultured in the upper transwell chamber. The Stro-1-enriched/PBMC and MSC/PBMC ratios were 0.3 and 0.1, respectively.

On day 5 of culture, PBMC proliferative response was measured by thymidine incorporation after incubation with 1 μCi/well 3H-thymidine (3H-Tdr; Amersham, Buckingham, UK) for the last 18 h of culture. A liquid scintillation counter (LKB Wallac 1209 RackBeta, Gaithersburg, MD, USA) measured incorporated radioactivity in counts per minute (cpm).

Relative quantitative real-time RT-PCR

Stro-1-enriched and MSCs obtained from five different donors were cultured at P2 in a MLR as already described, at a ratio of 0.3 (corresponding to the highest level of inhibition observed, see Results section). On day 5, Stro-1-enriched and MSCs were harvested, washed, and analyzed for certain inhibitory genes (see Table 1). Total RNA was extracted with a Trizol reagent kit (Invitrogen) and gene expression in Stro-1-enriched and MSCs during PBMC inhibition in the MLR was compared to gene expression in Stro-1-enriched and MSCs alone in five parallel experiments.

Table 1.   Primer sequences and access numbers of genes studied
GeneAccess numberForward primer (5′–3′)Reverse primer (5′–3′)
  1. Amplification of interleukin (IL)-1α, IL-1β, and IL-8 was performed using TaqMan cytokine gene expression plate (ref. C6-4307265; Applera Corporation).

GAPDHNM_002046GAAGGTGAAGGTCGGAGTCGAAGATGGTGATGGGATTTC
IL-6NM_000600CTGGCCAAGAGGAGCAAGCAACCAGATGGGATGTCGGTG
IL-10NM_000572CTACGGCGCTGTCATCGATGGCATTCTTCACCTGCTCCA
LIFM6342ACCAGAAAGATCCTCAACCCCCAACGTGGTACTTGCTGCACAGG
IDOX17668GGCCTGCGGGAAGCTTATTTGGCTGCTGGCTTGCA
TGF-β1NM_000660CTCTCCGACCTGCCACAGATTAACCTAGATGGGCGCGATC
HGFX16323CCCACTTGTTTGTGAGCAACAAGGACGATTTGGAATGGCG
HLA-GX17273ACCATCCC CATCAGGTATCACCGCAGCTCCAGTGACTACA
VCAMM73255CACACACAGGTGGGACACAAAGACCATCTTCCCAGGCATTTT.
LFA-3Y14781-82GCTCGCAACCTCCTTACAAGCTGGCAAAAATTCTCGCTCCTT
SDF-1L36033GCCTGAGCTACAGATGCCCATTCGGGTCAAFGCACACTTGT

RNA concentration and purity were estimated using optical density measurements. RNA isolation was followed by DNAase digestion. Total RNA (1 μg) was reverse-transcribed to cDNA with 100 ng of random hexamers and 200 U of superscript II (Invitrogen) at 42 °C for 1 h. All reactions were performed with the ABI Prism 7700 Sequence Detector V 1.7 (Applera, Foster City, CA, USA). Reverse and forward primers were designed with its Primer ExpressTM program; these sequences are shown in Table 1.

Amplification of IL-8 was performed using TaqMan cytokine gene expression plate (ref. C6-4307265, Applera Corporation, Foster city, CA, USA).

To determine amplification efficiency, we constructed calibration curves with a 0.99 correlation: efficiency exceeded 94% for both target genes and GAPDH, used as a reference (housekeeping) gene. Amplification products were detected with Sybr green I, a dye that binds to all double-stranded DNA. For relative quantification of the target gene product from the expanded Stro-1-enriched and MSCs in the MLR was normalized to target gene and GAPDH values in Stro-1-enriched and MSCs alone, used as the internal control. We used the 2−ΔΔCT formula to determine these values (Kenneth & Thomas, 2001).

  • image
  • image
  • image

.

2−ΔΔCT thus designates the variation in gene expression for Stro-1-enriched in the MLR, relative to control MSCs. Results are expressed as an x-fold increase in gene expression in Stro-1-enriched in the MLR compared to MSCs.

Statistical analysis

The statistical analysis was performed with the Statistical Package for the Social Sciences (spss), version 10. An anova test was used to compare gene expression. Statistical significance was calculated using the two-tailed Student’s t-test for paired data. The P-value was set at <0.05. Values are reported as mean ± SEM.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References

Characterization of Stro-1-enriched and BM stromal cells (MSCs)

Colonies of adherent cells began to appear in the culture flasks 3–7 days after BM MNCs were plated (Table 2). At P2, Stro-1-enriched and BM stromal cells (MSCs) were analyzed using flow cytometry, which revealed that both Stro-1-enriched and BM stromal cells (MSCs) were negative for the hematopoietic antigens CD45, CD34, CD14, and HLA-DR. And, they expressed antigens known to be present in MSCs: CD105, CD166, CD73, CD90, CD49a, CD49c, CD49e, CD44, and CD29 (Table 2).

Table 2.   Characterization of expanded Stro-1-enriched and mesenchymal stem cells (MSCs)
%CD29CD49aCD49cCD49eCD44CD105CD73CD90CD34CD45CD14HLA-DRCD166
  1. At least 5000 cells were analyzed for each antigen. Results are expressed as the percentage of positive cells.

  2. ND, not done.

MSC89 ± 235 ± 1079 ± 381 ± 1097 ± 436 ± 1982 ± 384 ± 5000096 ± 2
Stro1+84 ± 422 ± 569 ± 1749 ± 3196 ± 746 ± 1592 ± 791 ± 40000ND

Expression of the Stro1 antigen was evaluated using flow cytometry on cultures before and after Stro1+ selection. Before selection, MSCs contained a mean of 6% Stro1+ cells. Following selection, more than 90% of the cells detected were Stro1-positive; the remaining cells were Stro1-negative. After further expansion for 15 days, the proportion of Stro-1-enriched ranges from 18% to 35%. This result indicates that expression of the Stro1 antigen was partially conserved over time.

When cultured in the appropriate specific media, MSCs differentiated into osteogenic, chondrogenic, and adipogenic cells (data not shown).

Stro-1-enriched elicited a significantly more profound dose-dependent inhibition of PBMC proliferation than MSCs

Results are expressed as the mean ± SEM of the PBMC proliferation index in six separate experiments performed in triplicate (Figure 1). Addition of Stro-1-enriched and MSCs significantly inhibited the proliferative response. The 3H-Tdr incorporation test indicated that this inhibition was dose-dependent for expanded Stro-1-enriched and MSCs.

image

Figure 1.  Stro-1-enriched a significantly more profound dose-dependent inhibition of peripheral blood mononuclear cell (PBMC) proliferation in the mixed lymphocyte reaction (MLR) than mesenchymal stem cells (MSCs). Stro1+ and MSCs elicited dose-dependent inhibition of PBMC proliferation in the MLR (n = 6). The mean counts per minute of PBMC + PBMC pairs in the absence of Stro-1-enriched and MSCs is assigned a 100% value (±SEM; in grey on the histogram). The percentage of maximal proliferative response was calculated by dividing the mean of proliferation of (MSC/PBMC) or (Stro-1-enriched/PBMC) by the mean of (PBMC + PBMC) proliferation. A statistically significant inhibition of PBMC proliferation was observed at Stro-1-enriched/PBMC ratios of 0.3, 0.1, 0.03, and 0.01 (in black) compared to (PBMC + PBMC). For (MSC/PBMC), a statistically significant inhibition of PBMC proliferation was observed only at ratios of 0.3, 0.1, and 0.03 (in white).

Download figure to PowerPoint

Peripheral blood mononuclear cell proliferation was significantly more inhibited by Stro-1-enriched than by MSCs (P < 0.05). For the ratios 0.3, 0.1, 0.03, and 0.01, the percentage of PBMC proliferation in the presence of Stro-1-enriched was, respectively, 11.0%, 13.7%, 31%, and 63.7%. For MSCs, the percentages were 35.5%, 66.6%, 81.9%, and 106%, respectively.

.

Stro-1-enriched elicited a significantly more profound dose-dependent inhibition of PBMC proliferation in mitogen cultures than MSCs

Results are expressed as the mean ± SEM of the PBMC proliferation index in three separate experiments performed in triplicate (Figure 2). Addition of Stro-1-enriched and MSCs significantly inhibited the proliferative response (P < 0.05). The 3H-Tdr incorporation test indicates that this inhibition was dose-dependent for expanded Stro-1-enriched and MSCs. For expanded Stro-1-enriched cells the proliferation percentages were 7.5%, 18.5%, 32.6%, and 38.4%, for the 0.3, 0.1, 0.03, and 0.01 ratios, respectively. For MSCs, proliferation percentages were 25.5%, 40.1%, 53.9%, and 80.1%, for the 0.3, 0.1, 0.03, and 0.01 ratios, respectively.

image

Figure 2.  In response to the mitogen, Stro-1-enriched elicited a significantly more profound dose-dependent inhibition of peripheral blood mononuclear cell (PBMC) proliferation than mesenchymal stem cells (MSCs). Stro-1-enriched and MSCs elicited dose-dependent inhibition of PBMC proliferation in response to the mitogen (n = 3). The mean counts per minute of PBMC + IL-2 + PHA in the absence of MSCs is assigned a 100% value (±SEM; in grey on the histogram). The percentage of maximal proliferative response was calculated by dividing the mean of proliferation of (MSC/PBMC + IL-2 + PHA) or (Stro-1-enriched/PBMC + IL-2 + PHA) by the mean of proliferation of (PBMC + IL-2 + PHA). A statistically significant inhibition of PBMC proliferation was observed for (Stro-1-enriched/PBMC + IL-2 + PHA) in black on the histogram, and (MSC/PBMC + IL-2 + PHA) in white, at ratios of 0.3, 0.1, 0.03, and 0.01, compared to (PBMC + IL-2 + PHA).

Download figure to PowerPoint

Furthermore, the results indicated that as few as 1000 Stro-1-enriched (ratio 0.01) could induce inhibition of lymphocyte proliferation comparable to that of 10 000 MSCs (ratio 0.1; Figures 1 and 2).

The significant difference in the suppressive effects of Stro-1-enriched could be mediated by contact at high ratio

We investigated whether the difference in the suppressive effects observed for Stro-1-enriched and MSCs still exists when PBMCs are separated physically from both types of cells in three separate experiments performed in triplicate (Figure 3).

image

Figure 3.  Stro-1-enriched elicited more significant suppression of peripheral blood mononuclear cell (PBMC) proliferation in the mixed lymphocyte reaction in cultures with direct contact, compared to transwell cultures. The mean counts per minute of PBMC + PBMC pairs in the absence of Stro-1-enriched and mesenchymal stem cells (MSCs) is assigned a 100% value (±SEM; in grey on the histogram, n = 3). The percentage of maximal proliferative response was calculated by dividing the mean of proliferation of (Stro-1-enriched) or (MSC/PBMC + PBMC) by the mean of (PBMC + PBMC) proliferation. (a) Cultures with direct cell contact. (b) Cultures without cell contact (transwell). A statistically significant inhibition of PBMC proliferation was observed for (Stro-1-enriched in black) and (MSC/PBMC + PBMC) in white at ratios of 0.3 and 0.1, compared to (PBMC + PBMC) in grey.

Download figure to PowerPoint

Using Stro1+ cells, PBMC proliferation was lower in the cultures with cell contact (Figure 3a) than in cultures without cell contact (Figure 3b): 11.8%vs. 35.2% at a ratio of 0.3 (P = 0.002), and 25%vs. 38.3% at a ratio of 0.1 (P = 0.27).

Using MSCs, PBMC proliferation was lower in the cultures with cell contact compared to cultures without cell contact: 24%vs. 42.7% at a ratio of 0.3 (P = 0.024) and 42%vs. 51% at a ratio of 0.1 (P = 0.018).

Stro-1-enriched vs. MSC gene expression patterns in the MLR

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References

To study involvement of soluble factors we used semiquantitative real-time RT-PCR to compare Stro-1-enriched and MSC gene expression during modulation of PBMC proliferation in cultures with and without cell contact of five different donors (Figure 4a–c). We investigated the transcript levels of potential inhibitors (IL-6, IL-8, IL-10, LIF, IDO, TGF-β, HGF, and HLA-G), and gene expression of the homing molecule Stroma Derived Factor-1 (SDF-1) and the adhesion molecules VCAM and Leukocyte Function Antigen-3 (LFA-3).

image

Figure 4.  Stro-1-enriched gene expression patterns of inhibitory molecules, adhesion molecules, and SDF-1 in the mixed lymphocyte reaction in comparison to mesenchymal stem cells (MSC). Values >1 indicate up-regulation of the target genes, while values <1 indicate their down-regulation. The white histograms indicate cultures without cell contact. Gray histograms indicate cultures with cell contact. We compared the gene expression levels of Stro-1-enriched and MSC by using anova test. The data were expressed as fold increase in the mRNA level of Stro-1-enriched compared to MSC. Data from five different experiments from five different donors performed in duplicate are presented as mean ± SEM, and considered significant if *P < 0.05, **P < 0.01. (a) Down-regulated gene expression independent of contact, (b) up-regulated gene expression with or without contact, (c) gene expression of inhibitory molecules modulated dependent on contact.

Download figure to PowerPoint

  •  IL-6 (P < 0.01), SDF-1 (P < 0.05), and HGF (P < 0.05) transcripts were significantly down-regulated in comparison to MSCs under the same conditions (Figure 4a).
  •  IL-8, LIF, IDO, VCAM, and HLA-G transcripts were significantly up-regulated in comparison to MSCs (P < 0.01; Figure 4b).

However, expression of the cytokines listed below varied as a function of cell contact.

  •  IL-10, TGF-β transcripts were significantly up-regulated only in contact-dependant cultures, compared to MSCs (P < 0.01; Figure 4c).
  •  LFA-3 was significantly up-regulated (P < 0.05) without contact (in comparison to MSCs under the same conditions; Figure 4c).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References

Mesenchymal stem cells have the potential to reconstitute BM stroma and produce cytokines which may speed up hematopoietic reconstitution (Verfaillie, 1998; Arroyo et al., 1999). Another unique characteristic of MSCs is their ability to induce allograft tolerance (Bartholomew et al., 2002; Le Blanc et al., 2004b). There is considerable interest in using MSCs therapeutically in HSC transplantation (HSCT). We investigated whether a pure primitive subpopulation of BM stromal cells is primarily responsible for inhibiting the allogeneic response in vitro.

Stro1+ is a minor primitive subpopulation of adult human BM MSCs enriched in CFU-F progenitors (Dennis et al., 2002). It has been demonstrated that hematopoietic support and homing capabilities depend on the Stro1+ phenotype (Bensidhoum et al., 2004). Human Stro-1-enriched are more successful at crossing the xenogeneic barrier and at widespread homing in NOD/SCID target tissues (Bensidhoum et al., 2004).

MSCs had immunosuppressive properties in a MLR (Bartholomew et al., 2002; Di Nicola et al., 2002; Djouad et al., 2003; Krampera et al., 2003; Nasef et al., 2007). This inhibitory effect was more significant in cultures with direct contact than in transwell cultures (Nasef et al., 2007), using human cells. In murine model, there was an equal inhibitory effect of MSCs in both type of cultures (Djouad et al., 2003). Krampera et al. (2003) found no inhibitory effect of MSCs in transwell cultures in the same model. In contrast, allogeneic and transgenic MSCs were immune rejected by mismatched recipient mice (Grinnemo et al., 2004; Eliopoulos et al., 2005; Coyne et al., 2006).

In this study, Stro-1-enriched were positively isolated from adult human BM MSCs and expanded, then added to MLR and to mitogen response assays with PHA plus IL-2. With both Stro-1-enriched and MSCs, we observed a dose-dependent reduction of lymphocyte proliferation.

In this paper, we have shown that Stro-1-enriched have an inhibitory effect in a MLR. This is the first report demonstrating the immunosuppressive properties of Stro1+ cells. This finding supports previous reports on the immunosuppressive properties of stromal cells derived from adult human BM (Di Nicola et al., 2002; Le Blanc et al., 2004b; Aggarwal & Pittenger, 2005).

The suppressive effects of Stro-1-enriched were much more powerful than those of MSCs. As few as 1000 Stro-1-enriched inhibited lymphocyte proliferation as effectively as 10 000 MSCs.

At present, the mechanisms underlying the MSC suppressive effect are not well defined. The findings are contradictory; it is not known whether MSCs induce T-cell inhibition directly through cell contact, or indirectly through production of soluble factor(s) (Di Nicola et al., 2002; Djouad et al., 2003; Beyth et al., 2005; Nasef et al., 2007). Stro-1-enriched had a more inhibitory effect in cultures with direct contact than in transwell cultures. The present findings are in accordance with the observations of Di Nicola et al. (2002) and our previous paper, in which we reported on a marked inhibitory effect of MSCs in cultures with direct cell contact (Di Nicola et al., 2002; Nasef et al., 2007). On the other hand, our results contrast with the equal inhibitory effect observed in both types of culture (Djouad et al., 2003) and the inhibitory effects observed only in cultures with direct contact by Krampera et al. (2003). Both studies involved murine models which, along with the difference in experimental design, may explain the dissimilar outcomes.

The involvement of soluble factors such as TGF-β, HGF, IDO, and IL-10 has been demonstrated previously (Di Nicola et al., 2002; Meisel et al., 2004; Beyth et al., 2005). In earlier work, we showed that several factors were simultaneously involved in the MSC-mediated inhibitory effect, including IDO, IL-10, TGF-β, LIF, and HLA-G (Nasef et al., 2007). These molecules were selected for their inhibitory properties in feto-maternal and transplantation tolerance (Roth et al., 1996; Rouas-Freiss et al., 1997; Steckel et al., 2003). In the present study, we investigated the implication of previously studied genes along with IL-6, IL-8, VCAM, and LFA-3 in the Stro-1-enriched-mediated inhibitory effect.

Previously, we demonstrated the implication of IL-10 and TGF-β in inducing more profound inhibition of immunoreactivity by MSCs in contact-dependant cultures, compared to noncontact-dependant cultures (Nasef et al., 2007). In this study, we found a significant increase in gene expression for IL-10 and TGF-β in Stro-1-enriched from contact-dependant cultures compared to MSCs. This indicates that these factors play a role in the greater inhibitory effects of Stro-1-enriched on PBMCs and confirm that in cultures with direct contact, the enhanced inhibitory effect of Stro-1-enriched is primarily due to these cytokines.

LFA-3 was significantly up-regulated in noncontact-dependant cultures. This could indicate that there are two different inhibitory mechanisms acting simultaneously.

We also found that IDO, LIF, IL-8, VCAM, and HLA-G were significantly up-regulated in both cases when compared to MSCs. The fact that the Stro-1-enriched in our experiments expressed a higher level of the genes studied than the MSCs may indicate that the inhibitory effect is mainly mediated by Stro1+ cells.

The known involvement of these factors in inducing tolerance reinforces the potential of Stro-1-enriched as a tool in transplantation management.

Graft-vs.-host disease remains a significant cause of morbidity and mortality following allogeneic HSCT. Recently, MSCs were harnessed to reduce GVHD (Le Blanc et al., 2004b) and well tolerated in a multicenter trial (Lazarus et al., 2005) which opens the way to MSC clinical applications.

Up-regulation of these inhibitory genes observed in Stro-1-enriched supports the tolerogenic role observed for MSCs in allogeneic HSCT. Selection of the Stro1+ subset is an easy method of obtaining MSCs rapidly from BM with the aim of potential therapeutic use. In addition, the enhanced immunosuppressive and hematopoietic support properties of Stro1+ cells, compared to MSCs, may be useful in the management of GVHD and solid organ transplantation.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Stro-1-enriched vs. MSC gene expression patterns in the MLR
  7. Discussion
  8. Acknowledgement
  9. References
  • Aggarwal S. & Pittenger M.F. (2005) Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105, 18151822.
  • Arroyo A.G., Yang J.T., Rayburn H. & Hynes R.O. (1999) Alpha4 integrins regulate the proliferation/differentiation balance of multilineage hematopoietic progenitors in vivo. Immunity 11, 555566.
  • Bartholomew A., Sturgeon C., Siatskas M., Ferrer K., McIntosh K., Patil S., Hardy W., Devine S., Ucker D., Deans R., Moseley A. & Hoffman R. (2002) Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Experimental Hematology 30, 4248.
  • Bensidhoum M., Chapel A., Francois S., Demarquay C., Mazurier C., Fouillard L., Bouchet S., Bertho J.M., Gourmelon P., Aigueperse J., Charbord P., Gorin N.C., Thierry D. & Lopez M. (2004) Homing of in vitro expanded Stro-1- or Stro-1 +  human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 103, 33133319.
  • Beyth S., Borovsky Z., Mevorach D., Liebergall M., Gazit Z., Aslan H., Galun E. & Rachmilewitz J. (2005) Human mesenchymal stem cells alter antigen-presenting cell maturation and induce T-cell unresponsiveness. Blood 105, 22142219.
  • Bol S.J., Tucker D.P. & Ekert H. (1990) Selection of two human bone marrow stromal cell subpopulations with different effects on the maintenance and differentiation of myeloid progenitor cells. Experimental Hematology 18, 764769.
  • Brouard N., Chapel A., Thierry D., Charbord P. & Peault B. (2000) Transplantation of gene-modified human bone marrow stromal cells into mouse-human bone chimeras. Journal of Hematotherapy and Stem Cell Research 9, 175181.
  • Castro-Malaspina H., Gay R.E., Resnick G., Kapoor N., Meyers P., Chiarieri D., McKenzie S., Broxmeyer H.E. & Moore M.A. (1980) Characterization of human bone marrow fibroblast colony-forming cells (CFU-F) and their progeny. Blood 56, 289301.
  • Coyne T.M., Marcus A.J., Woodbury D. & Black I.B. (2006) Marrow stromal cells transplanted to the adult brain are rejected by an inflammatory response and transfer donor labels to host neurons and glia. Stem Cells 24, 24832492.
  • Dennis J.E., Carbillet J.P., Caplan A.I. & Charbord P. (2002) The STRO-1 +  marrow cell population is multipotential. Cells Tissues Organs 170, 7382.
  • Di Nicola M., Carlo-Stella C., Magni M., Milanesi M., Longoni P.D., Matteucci P., Grisanti S. & Gianni A.M. (2002) Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 99, 38383843.
  • Djouad F., Plence P., Bony C., Tropel P., Apparailly F., Sany J., Noel D. & Jorgensen C. (2003) Immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals. Blood 102, 38373844.
  • Eliopoulos N., Stagg J., Lejeune L., Pommey S. & Galipeau J. (2005) Allogeneic marrow stromal cells are immune rejected by MHC class I- and class II-mismatched recipient mice. Blood 106, 40574065.
  • Francois S., Bensidhoum M., Mouiseddine M., Mazurier C., Allenet B., Semont A., Frick J., Sache A., Bouchet S., Thierry D., Gourmelon P., Gorin N.C. & Chapel A. (2006) Local irradiation not only induces homing of human mesenchymal stem cells at exposed sites but promotes their widespread engraftment to multiple organs: a study of their quantitative distribution after irradiation damage. Stem Cells 24, 10201029.
  • Friedenstein A.J., Chailakhjan R.K. & Lalykina K.S. (1970) The development of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell and Tissue Kinetica 3, 393403.
  • Grinnemo K.H., Mansson A., Dellgren G., Klingberg D., Wardell E., Drvota V., Tammik C., Holgersson J., Ringden O., Sylven C. & Le Blanc K. (2004) Xenoreactivity and engraftment of human mesenchymal stem cells transplanted into infarcted rat myocardium. Journal of Thoracic and Cardiovascular Surgery 127, 12931300.
  • Gronthos S., Zannettino A.C., Hay S.J., Shi S., Graves S.E., Kortesidis A. & Simmons P.J. (2003) Molecular and cellular characterisation of highly purified stromal stem cells derived from human bone marrow. Journal of Cell Science 116, 18271835.
  • Jiang X.X., Zhang Y., Liu B., Zhang S.X., Wu Y., Yu X.D. & Mao N. (2005) Human mesenchymal stem cells inhibit differentiation and function of monocyte-derived dendritic cells. Blood 105, 41204126.
  • Jones E.A., English A., Kinsey S.E., Straszynski L., Emery P., Ponchel F. & McGonagle D. (2006) Optimization of a flow cytometry-based protocol for detection and phenotypic characterization of multipotent mesenchymal stromal cells from human bone marrow. Cytometry. Part B, Clinical Cytometry 70, 391399.
  • Kenneth J.L. & Thomas D.S. (2001) Analysis of relative gene expression data using relative time quantitative PCR and 2DDCt. Methods 25, 402408.
  • Krampera M., Glennie S., Dyson J., Scott D., Laylor R., Simpson E. & Dazzi F. (2003) Bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide. Blood 101, 37223729.
  • Lazarus H.M., Koc O.N., Devine S.M., Curtin P., Maziarz R.T., Holland H.K., Shpall E.J., McCarthy P., Atkinson K., Cooper B.W., Gerson S.L., Laughlin M.J., Loberiza F.R. Jr, Moseley A.B. & Bacigalupo A. (2005) Cotransplantation of HLA-identical sibling culture-expanded mesenchymal stem cells and hematopoietic stem cells in hematologic malignancy patients. Biology of Blood and Marrow Transplantation 11, 389398.
  • Le Blanc K., Tammik L., Sundberg B., Haynesworth S.E. & Ringden O. (2003) Mesenchymal stem cells inhibit and stimulate mixed lymphocyte cultures and mitogenic responses independently of the major histocompatibility complex. Scandinavian Journal of Immunology 57, 1120.
  • Le Blanc K., Rasmusson I., Gotherstrom C., Seidel C., Sundberg B., Sundin M., Rosendahl K., Tammik C. & Ringden O. (2004a) Mesenchymal stem cells inhibit the expression of CD25 (interleukin-2 receptor) and CD38 on phytohaemagglutinin-activated lymphocytes. Scandinavian Journal of Immunology 60, 307315.
  • Le Blanc K., Rasmusson I., Sundberg B., Gotherstrom C., Hassan M., Uzunel M. & Ringden O. (2004b) Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 363, 14391441.
  • Letchford J., Cardwell A.M., Stewart K., Coogans K.K., Cox J.P., Lee M., Beresford J.N., Perry M.J. & Welham M.J. (2006) Isolation of C15: a novel antibody generated by phage display against mesenchymal stem cell-enriched fractions of adult human marrow. Journal of Immunological Methods 308, 124137.
  • Maccario R., Podesta M., Moretta A., Cometa A., Comoli P., Montagna D., Daudt L., Ibatici A., Piaggio G., Pozzi S., Frassoni F. & Locatelli F. (2005) Interaction of human mesenchymal stem cells with cells involved in alloantigen-specific immune response favors the differentiation of CD4 +  T-cell subsets expressing a regulatory/suppressive phenotype. Haematologica 90, 516525.
  • Maitra B., Szekely E., Gjini K., Laughlin M.J., Dennis J., Haynesworth S.E. & Koc O.N. (2004) Human mesenchymal stem cells support unrelated donor hematopoietic stem cells and suppress T-cell activation. Bone Marrow Transplantation 33, 597604.
  • Meisel R., Zibert A., Laryea M., Gobel U., Daubener W. & Dilloo D. (2004) Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-dioxygenase-mediated tryptophan degradation. Blood 103, 46194621.
  • Nasef A., Chapel A., Mazurier C., Bouchet S., Lopez M., Mathieu N., Sensebé L., Zhang Y., Gorin N., Thierry D. & Fouillard L. (2007) Identification of IL-10 and TGF-b transcripts involved in inhibiting T Lymphocyte proliferation during cell contact with human mesenchymal stem cells. Gene Expression 13, 217226.
  • Potian J.A., Aviv H., Ponzio N.M., Harrison J.S. & Rameshwar P. (2003) Veto-like activity of mesenchymal stem cells: functional discrimination between cellular responses to alloantigens and recall antigens. Journal of Immunology 171, 34263434.
  • Roth I., Corry D.B., Locksley R.M., Abrams J.S., Litton M.J. & Fisher S.J. (1996) Human placental cytotrophoblasts produce the immunosuppressive cytokine interleukin 10. Journal of Experimental Medicine 184, 539548.
  • Rouas-Freiss N., Goncalves R.M., Menier C., Dausset J. & Carosella E.D. (1997) Direct evidence to support the role of HLA-G in protecting the fetus from maternal uterine natural killer cytolysis. Proceedings of the National Academy of Sciences of the United States of America 94, 1152011525.
  • Simmons P.J. & Torok-Storb B. (1991) Identification of stromal cell precursors in human bone marrow by a novel monoclonal antibody, STRO-1. Blood 78, 5562.
  • Steckel N.K., Kuhn U., Beelen D.W. & Elmaagacli A.H. (2003) Indoleamine 2,3-dioxygenase expression in patients with acute graft-versus-host disease after allogeneic stem cell transplantation and in pregnant women: association with the induction of allogeneic immune tolerance? Scandinavian Journal of Immunology 57, 185191.
  • Stewart K., Monk P., Walsh S., Jefferiss C.M., Letchford J. & Beresford J.N. (2003) STRO-1, HOP-26 (CD63), CD49a and SB-10 (CD166) as markers of primitive human marrow stromal cells and their more differentiated progeny: a comparative investigation in vitro. Cell and Tissue Research 313, 281290.
  • Tondreau T., Lagneaux L., Dejeneffe M., Delforge A., Massy M., Mortier C. & Bron D. (2004) Isolation of BM mesenchymal stem cells by plastic adhesion or negative selection: phenotype, proliferation kinetics and differentiation potential. Cytotherapy 6, 372379.
  • Tse W.T., Pendleton J.D., Beyer W.M., Egalka M.C. & Guinan E.C. (2003) Suppression of allogeneic T-cell proliferation by human marrow stromal cells: implications in transplantation. Transplantation 75, 389397.
  • Verfaillie C.M. (1998) Adhesion receptors as regulators of the hematopoietic process. Blood 92, 26092612.
  • Zhang W., Ge W., Li C., You S., Liao L., Han Q., Deng W. & Zhao R.C. (2004) Effects of mesenchymal stem cells on differentiation, maturation, and function of human monocyte-derived dendritic cells. Stem Cells and Development 13, 263271.