SEARCH

SEARCH BY CITATION

Keywords:

  • microsatellite enrichment;
  • PCR;
  • stonefly

Abstract

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

We describe the isolation of 11 polymorphic trinucleotide microsatellite loci from the stonefly Arcynopteryx compacta. Loci were highly variable with 3 to 14 alleles (mean = 6.45). Observed heterozygosity ranged from 0 to 0.867. Seven loci showed significant deviation from Hardy–Weinberg equilibrium across both populations. There was no evidence for null alleles, and thus, Hardy–Weinberg departures could have resulted from genetic structure between populations or subpopulations. No linkage between loci was found. The 11 loci should prove highly informative for population genetic studies.

Arcynopteryx compacta (MacLachlan 1872) inhabits high-altitude springs of isolated mountain ranges in western, central and eastern Europe and has a continuous Holarctic distribution at high latitudes (Lillehammer 1988). It is a typical boreo–alpine–montane species, which putatively survived Pleistocene glaciations in the central European periglacial region and postglacially retreated to higher altitudes and latitudes (Illies 1955). Studying the intraspecific genetic variation of A. compacta will provide valuable additions to our understanding of how historic climate change impacted population regression, where refugia were located and how isolated refugial populations diverged genetically (Hewitt 1999; Schmitt & Seitz 2001). To examine A. compacta's population structure and phylogeography, we developed 11 polymorphic microsatellite loci.

Microsatellite markers were developed using an enrichment protocol developed by Glenn & Schable (2005). We extracted genomic DNA (gDNA) from one individual of A. compacta from the Black Forest, Stollenbach, in Germany, using the DNeasy tissue kit (QIAGEN). Approximately 4 µg gDNA was digested with RsaI and XmnI (New England Biolabs). SuperSNX24 linkers were ligated onto the gDNA fragments. Linkers serve as priming sites for subsequent polymerase chain reactions (PCRs) throughout the protocol. Biotinylated trinucleotide probes [(ACT)8, (ACG)6, (AAG)8, (ATC)8, (AAC)6, and (AAT)12] were hybridized to gDNA. The biotinylated probe–gDNA complex was added to streptavidin-coated magnetic beads (Dynabeads M-280, Invitrogen). This mixture was washed twice with 2xSSC, 0.1% SDS and four times with 1xSSC, 0.1% SDS at 53 °C. Between washes, a magnetic particle-collecting unit was used to capture the magnetic beads. After the last wash, enriched fragments were removed from the biotinylated probe by denaturing at 95 °C and precipitated with 95% ethanol and 3M sodium acetate. To increase the amount of enriched fragments, a ‘recovery’ PCR was performed in a 25-µL reaction containing 1× PCR buffer (Roche), 1.5 mm MgCl2, 1 × BSA, 0.16 mm of each dNTP, 0.52 µm SuperSNX24 forward primer, 1 U Taq DNA polymerase, and approximately 25 ng enriched gDNA fragments. Thermal cycling was performed in an MJ Research DYAD as follows: 95 °C for 2 min followed by 25 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 90 s, and a final elongation step of 72 °C for 30 min. Subsequent PCR fragments were cloned using the TOPO TA Cloning kit (Invitrogen) following the manufacturer's protocol. White colonies (N = 188) were amplified via PCR in 25 µL reactions containing 1× PCR buffer (Roche), 1.5 mm MgCl2, 1 × BSA, 0.12 mm of each dNTP, 0.25 µm M13 primers, and 1 U Taq DNA polymerase. Cycling conditions were: 7 min at 95 °C, 35 cycles of 95 °C for 20 s, 50 °C for 20 s, 72 °C for 90 s, and a final elongation of 72 °C for 10 min. PCR products were cleaned using MultiScreen PCR Filter Plates following the manufacturer's protocol (Millipore). All 188 colonies were sequenced using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems) and run on an ABI 3730 DNA Analyser. Sequences were assembled and edited in Sequencher (GeneCodes) and visually checked for microsatellites.

Primer pairs were developed for 27 loci using Primer 3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). We used the cost-efficient one-tube single reaction nested PCR method described by Schuelke (2000) and applied by Pauls et al. (2007) to fluorescently label the loci. We genotyped 32 specimens of A. compacta from two proximate populations in the Apuseni Mountains (Somesul Calde: n = 14, and Baişoara: n = 18, Table 1) in Romania. PCR amplification was performed using PuReTaq Ready-To-Go PCR beads (GE Healthcare) following Schuelke (2000) and Theissinger et al. (in press). Samples were scored on an ABI 3733 using 11.7 µL HiDi formamide, 0.3 µL ROX 500 standard (Applied Biosystems) and 1 µL of the PCR product. Loci were genotyped using the GeneMapper version 4.0 software (Applied Biosystems)

Table 1.  Characteristics and summary statistics for microsatellite loci from Arcynopteryx compacta, based on genotyping 14 and 18 individuals of two proximate populations in the Apuseni Mountains, Romania (Somesul Calde and BaiŞoara). Given are repeat motifs, primer sequences, number of alleles, allele size ranges, and observed and expected heterozygosities (HO, HE). Asterisk (*) denotes significant deviation of Hardy–Weinberg equilibrium. ‘M’ indicates M13 sequence was added to the 5′ end of the primer
Locus GenBank Accession no.Repeat motifPrimer sequences (5′–3′)Tm (°C)No. of alleles (SC/B/total)Allele size range (bp)Somesul CaldeBaişoara
HOHEHOHE
  • number of alleles in Somesul Calde (SC), BaiŞoara (B) and overall (total).

  • only one allele found in this population.

Arco_8(TAG)9F: M-GTCATCGCCACCTTGTT633/5/5179–2030.071*0.2620.278*0.465
FJ007630 R: CCTAACAAACAATCCCCACAG       
Arco_46(TTG)5CTG(TTG)10F: M-TCCAACAGACACATCGGGTA613/1/3149–1650.5000.4290.0000.000
FJ007631 R: TACCCGATGTGTCTGTTGGA       
Arco_53(GAT)13F: M-CGAAACCACATGAATCATCAA573/7/8147–2010.5000.4290.6670.802
FJ007632 R: TTGATGATTCATGTGGTTTCG       
Arco_79(AAC)9F: M-CCCCAAAGACGACAAGATTC613/7/7112–2410.5710.6240.529*0.827
FJ007633 R: TTCGGATACCCTATGGATGG       
Arco_102(TTG)6TTA(TTG)5F: M-CCGGAGTCTCACTTCTTGATG633/4/6186–2190.3080.2830.294*0.733
FJ007634 R: TCGTCTTGAATGGCATTTTG       
Arco_123(TAC)14F: M-GCGGTATCTCCACAATATTACACA634/9/11247–3250.6430.6900.833*0.867
FJ007635 R: TGTGTAATATTGTGGAGATACCGC       
Arco_126(ATC)11F: M-TCATTCCCTTGATTGAACTATTGA613/4/4219–2340.429*0.6010.7220.694
FJ007636 R: TCAATAGTTCAATCAAGGGAATGA       
Arco_138(AAC)12F: M-TGACCCGATGTGTCTGTGTT612/3/3142–1510.3570.3890.4440.481
FJ007637 R: AACACAGACACATCGGGTCA       
Arco_144(TCC)9(TAC)4F: M-TTAGGGCGAACGCTGTTACT634/6/7162–1800.231*0.6740.412*0.749
FJ007638 R: GAACTATTTGCAGGAGCAGGA       
Arco_152(ATC)9F: M-CCCCTCATCGTCTCGAATAG614/3/5203–2690.6150.4950.4440.489
FJ007639 R: AGAGGGAATGCATCGTATGG       
Arco_157(TTC)25F: M-GATCGCTCGAGGTTTAACGA616/9/14141–3570.7140.6460.667*0.849
FJ007640 R: TCGTTAAACCTCGAGCGATC       

Eleven polymorphic loci reliably amplified in all tested specimens and produced consistent results (Table 1). The other 16 primer pairs are not listed as they were either monomorphic or did not amplify reliably. Allele numbers ranged from 3 to 14, with an average of 6.45 (Table 1). Allele numbers per locus ranged from 2 to 6 (mean = 3.45) and 1 to 9 (mean = 4.46) in the two populations. We calculated observed and expected heterozygosity levels, and exact Hardy–Weinberg probability, using default parameters in the web-based version of GenePop (Raymond & Rousset 2004). Observed and expected heterozygosities ranged from 0 to 0.833 and from 0 to 0.867, respectively. One locus (Arco_46) was monomorphic in one population (Table 1). Tests for linkage disequilibrium applying a Bonferroni correction for multiple comparisons (Rice 1989), revealed no linkage between loci. The global Hardy–Weinberg test across all loci for both populations showed significant deviation from Hardy–Weinberg equilibrium for seven loci across both populations (Table 1). Using Micro-Checker version 2.2.3 (Van Oosterhout et al. 2004), we found no evidence for the presence of null alleles in any locus. Deviations from Hardy–Weinberg equilibrium could result from population substructuring (Wahlund effect) and genetic structure between the two populations.

These loci are the first microsatellite markers developed for a stonefly species and will serve to examine the phylogeography of the rare stonefly A. compacta across its European range.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

This study was funded by the German Science Foundation (DFG), project Ha3431/3-1 awarded to P. Haase (Senckenberg) and S.U. Pauls. K. Theissinger is supported by the Studienstiftung des deutschen Volkes. Microsatellite enrichment was partially funded by the Grainger Foundation and carried out in the Pritzker Laboratory for Molecular Systematics and Evolution operated with support from the Pritzker Foundation.

References

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References